CN106086006A - A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application - Google Patents
A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application Download PDFInfo
- Publication number
- CN106086006A CN106086006A CN201610758645.0A CN201610758645A CN106086006A CN 106086006 A CN106086006 A CN 106086006A CN 201610758645 A CN201610758645 A CN 201610758645A CN 106086006 A CN106086006 A CN 106086006A
- Authority
- CN
- China
- Prior art keywords
- ntfls2
- tobacco leaf
- gene
- rpm
- rutin content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
- C12Y114/11023—Flavonol synthase (1.14.11.23)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses and a kind of improve the cloning process of rutin content gene NtFLS2 in tobacco leaf, comprise the following steps: A, extract tobacco leaf and the total serum IgE of flower with TRIzol, then reverse transcription obtains cDNA the first chain；B, using cDNA the first chain as template, utilize primer to carry out PCR amplification；C, genes of interest fragment are connected to pTOPO carrier and check order.The invention also discloses and improve the application of rutin content gene NtFLS2 in tobacco leaf.The clone of NtFLS2 gene of the present invention, the exploitation of this genetic resources are that tobacco leaf industrialization extraction rutin is laid a good foundation；The transgenic tobacco plant of the present invention, through functional verification, shows that the NtFLS2 gene that the present invention clones has and improves the function of rutin content in tobacco leaf.
Description
Technical field
The invention belongs to field of plant genetic, be specifically related to rutin content gene in a kind of raising tobacco leaf
The cloning process of NtFLS2 and application.
Background technology
Rutin, one of metabolite of flavonoid path, in medicine and biological pesticide, there is extremely important application.By
In the oxidation resistance that it is powerful, rutin has antiinflammatory, antibacterial, antitumor, asthma attribute.Rutin is also as stabilizer, anti-
Rotten agent, natural colorant are widely used in pharmacy, nutraceutical and cosmeceutical industry.But rutin amassing in plant
Tired less, it is difficult to meet industrial requirement.Utilize genetic engineering means to increase rutin accumulation in plant, be to solve rutin
The less available strategy of content.
Rutin synthesis is branch's approach of flavonoid metabolism, and it synthesizes with coumaric acyl CoA and malonyl CoA as precursor,
The lower chalcone forming yellow of effect at chalcone synthase (Chalcone synthase, CHS), this step is that flavonoid closes
First rate-limiting step of one-tenth approach.Then raw by enzyme, namely chalcone isomerase (Chalconeisomerase, CHI) catalysis chalcone
Becoming colourless naringenin, naringenin is catalyzed through flavonol-3-hydroxylase (Flavanone 3-hydroxylase, F3H), raw
Becoming dihydrokaempferol class (DHK), DHK forms dihydroquercetin (DHQ) and dihydromyricetin (DHM) the most respectively.Above three
Flavanone alcohol compound can enter anthocyanidin route of synthesis in flavanonol reductase (DFR) catalysis, finally produces flower
Emerald green element (Delphindin), cyanidin (Cyanidin) and pelargonidin (Pelargonidin)；Also can be closed by flavonol
Become enzyme (Flavonol synthase, FLS) effect to enter flavonol route of synthesis, produce kaempferol, Quercetin and ampelopsin,
Quercetin can generate rutin by two step glycosylations.
Therefore, research and develop and a kind of improve the candidate gene of rutin content in tobacco leaf, strengthen its flavonol branch approach generation
In Xie Liu, and then raising tobacco leaf, rutin content is very important.
Summary of the invention
The first object of the present invention is to provide described and improves the clone of rutin content gene NtFLS2 in tobacco leaf
Method；The second object of the present invention is to provide described and improves the application of rutin content gene NtFLS2 in tobacco leaf.
The first object of the present invention is achieved in that rutin content gene NtFLS2 in described raising tobacco leaf
Cloning process, comprises the following steps:
A, with TRIzol extract tobacco leaf and flower total serum IgE, then reverse transcription obtain cDNA the first chain；
B, using cDNA the first chain as template, utilize primer to carry out PCR amplification；
C, genes of interest fragment are connected to pTOPO carrier and check order；
The second object of the present invention be achieved in that described improve rutin content gene NtFLS2 in tobacco leaf should
With, comprise the steps:
(1) plant expression vector is prepared
With BamHI and XhoI double digestion pTOPO-NtFLS2 and pENTRTM2B, be separately recovered obtain purpose fragment NtFLS2 and
Carrier segments pENTRTM2B；Entry vector pENTR is obtained after connecting with T4 DNA LigaseTM2B-NtFLS2, carries with purpose
Body pK2GW7 obtains plant expression vector pK2-NtFLS2 by LR reaction.
(2) preparation Agrobacterium tumefaciens strain containing plant expression vector:
Take 0.5 ~ 2 l recombiant plasmid pK2-NtFLS2, join the Agrobacterium C58C1 bacterial strain competence that 50 l thaw on ice thin
Born of the same parents, softly mix, ice bath 5 min, and quick freeze 5 min in liquid nitrogen, then 37 DEG C of water-bath 5 min, add 1 ml LB liquid
Body culture medium, 28 DEG C of 210 rpm cultivates that 3.5 h, 7500 rpm are centrifugal abandons part supernatant, stays 100 ul resuspension thalline, by bacterium
Liquid is applied to the LB solid plate of the spectinomycin of the rifamycin containing 50 g/ml and 100 g/ml, cultivates 2 ~ 3 for 28 DEG C
D, grows single bacterium colony to flat board；
(3) transgenic tobacco plant is prepared:
Picking agrobacterium strains is inoculated in the LB culture medium containing Spe 100 g/mL of 50ml, 180 rpm, cultivates 24 for 28 DEG C
H, bacterium solution OD600 to 1.0,3000 rpm are centrifuged 10 min, precipitate thalline, then suspend with the MS fluid medium of 10ml, and 3000
Rpm is centrifuged 10 min, precipitates thalline, repeats above operation 2～3 times, finally with the MS liquid culture basic weight adding certain volume
Suspending, the OD600 value making thalline is 0.5, chooses aseptic seedling or the tobacco leaf of sterilization Seedling, in the Agrobacterium bacterium solution prepared
Contaminate 15 ~ 20 min, after blotting with aseptic absorbent paper, be laid in dark in MS culture medium and co-culture 2 days, outer implant is transferred to
The enterprising row filter of bud inducement culture medium containing antibiotic, about 15 days subcultures once, after having blastogenesis to become, proceed to the life containing antibiotic
In root culture medium MS, carry out root induction growth, obtain transgenic tobacco plant.
Compared with prior art, the present invention has the following advantages and effect:
1, the clone of NtFLS2 gene, the exploitation of this genetic resources are that tobacco leaf industrialization extraction rutin has established base
Plinth；
2, the transgenic tobacco plant of the present invention, through functional verification, shows that the NtFLS2 gene that the present invention clones has raising cigarette
The function of rutin content in blade of grass sheet.
Accompanying drawing explanation
Fig. 1 is NtFLS2 gene amplification and intermediate carrier pTOPO-NtFLS2 restriction enzyme digestion and electrophoresis figure；
Fig. 2 is entry clones pENTRTMThe restriction enzyme digestion and electrophoresis figure of 2B-NtFLS2；
Fig. 3 is that the PCR of plant expression vector pK2-NtFLS2 detects electrophoretogram；
Fig. 4 is transgene tobacco phenotype；
Fig. 5 is that T0 is for NtFLS2 gene expression dose analysis in transgene tobacco；
Fig. 6 is that T1 is for NtFLS2 gene expression dose analysis in transgene tobacco；
Fig. 7 is transgenic tobacco leaf rutin content testing result.
Detailed description of the invention
The present invention is further illustrated below in conjunction with the accompanying drawings, but is any limitation as the present invention never in any form, base
In present invention teach that any conversion or replacement made, belong to protection scope of the present invention.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf as described in accompanying drawing 1 ~ Fig. 7, including following
Step:
A, with TRIzol extract tobacco leaf and flower total serum IgE, then reverse transcription obtain cDNA the first chain；
B, using cDNA the first chain as template, utilize primer to carry out PCR amplification；
C, genes of interest fragment are connected to pTOPO carrier and check order.
Described gene nucleotide series is as shown in SEQ ID:No.1.
The aminoacid sequence of described gene code is as shown in SEQ ID:No.2.
In described step B, the sequence of primer is:
NtFLS2_BamHI:GGATCCATGAAAACAGCTGAAGCTCA；
NtFLS2_XhoI:CTCGAGTCACTGAGGAAGCTTGTTAA.
In described step B, the reaction condition of PCR amplification is 98 DEG C of denaturations 30s；98 DEG C of degeneration 10s, 56 DEG C of annealing
30s, 72 DEG C extend 2min, totally 30 circulations；Last 72 DEG C extend 7min.
In described step B, PCR amplification uses high-fidelity DNA polymerase.
In described step A, cDNA the first chain is to use PrimeScriptTM RT reagent Kit with gDNA
Eraser(Perfect real Time) test kit synthesizes.
Described improves the application of rutin content gene NtFLS2 in tobacco leaf, it is characterised in that comprise the following steps:
(1) plant expression vector is prepared
With BamHI and XhoI double digestion pTOPO-NtFLS2 and pENTRTM2B, be separately recovered obtain purpose fragment NtFLS2 and
Carrier segments pENTRTM2B；Entry vector pENTR is obtained after connecting with T4 DNA LigaseTM2B-NtFLS2, carries with purpose
Body pK2GW7 obtains plant expression vector pK2-NtFLS2 by LR reaction.
(2) preparation Agrobacterium tumefaciens strain containing plant expression vector:
Take 0.5 ~ 2 l recombiant plasmid pK2-NtFLS2, join the Agrobacterium C58C1 bacterial strain competence that 50 l thaw on ice thin
Born of the same parents, softly mix, ice bath 5 min, and quick freeze 5 min in liquid nitrogen, then 37 DEG C of water-bath 5 min, add 1 ml LB liquid
Body culture medium, 28 DEG C of 210 rpm cultivates that 3.5 h, 7500 rpm are centrifugal abandons part supernatant, stays 100 ul resuspension thalline, by bacterium
Liquid is applied to the LB solid plate of the spectinomycin of the rifamycin containing 50 g/ml and 100 g/ml, cultivates 2 ~ 3 for 28 DEG C
D, grows single bacterium colony to flat board；
(3) transgenic tobacco plant is prepared:
Picking agrobacterium strains is inoculated in the LB culture medium containing Spe 100 g/mL of 50ml, 180 rpm, cultivates 24 for 28 DEG C
H, bacterium solution OD600 to 1.0,3000 rpm are centrifuged 10 min, precipitate thalline, then suspend with the MS fluid medium of 10ml, and 3000
Rpm is centrifuged 10 min, precipitates thalline, repeats above operation 2～3 times, finally with the MS liquid culture basic weight adding certain volume
Suspending, the OD600 value making thalline is 0.5.Choose aseptic seedling or the tobacco leaf of sterilization Seedling, in the Agrobacterium bacterium solution prepared
Contaminate 15 ~ 20 min, after blotting with aseptic absorbent paper, be laid in dark in MS culture medium and co-culture 2 days, outer implant is transferred to
The enterprising row filter of bud inducement culture medium containing antibiotic, about 15 days subcultures once, after having blastogenesis to become, proceed to the life containing antibiotic
In root culture medium MS, carry out root induction growth, obtain transgenic tobacco plant.
In described step (1), competent cell is first to provoke Agrobacterium list colony inoculation in 5 ml LB liquid medium,
28 DEG C, 200 ~ 250 rpm concussions are cultivated to OD600 is 0.5, then are transferred to 50 ml fresh liquid culture medium in the ratio of 1:10
Middle amplification culture, 28 DEG C, 200 ~ 250 rpm concussions are cultivated is 0.5 to OD600, ice bath 30 min, 5000 rpm are centrifuged 5 min
Abandon supernatant, the 10 ml CaCl of 20 mM2Resuspension thalline, 5000 rpm are centrifuged 5 min, add the 350 l CaCl of 20 mM2Outstanding
Floating thalline, then add the sterile glycerol of 150 l 50%, mixing, subpackage 100 l/ is in control, and described competent cell is in-80
DEG C preserve.
Embodiment 1: the clone of gene NtFLS2
(1) Nicotiana tabacum L. Total RNAs extraction
Take about 1g tobacco leaf, grind into powder in liquid nitrogen；The a little powder of picking is transferred in 1.5mL EP pipe, and adds
1mL Trizol, acutely concussion makes cell cracking completely, stands 10min with Trizol after fully mixing；Chlorine is added in EP pipe
Imitative 0.25mL, uses forced oscillation 15s, and room temperature stands 10min；After standing, it is centrifuged 20min in 4 DEG C of 12000rpm/min；Draw upper strata
Colourless liquid 400 μ L, adds equal-volume isopropanol 500 μ L mixing；It is centrifuged 10min in 4 DEG C of 12000rpm/min；Supernatant is abandoned in suction,
Precipitation adds 75% ethanol (dehydrated alcohol+RNase free water) 1mL, blows afloat precipitation；It is centrifuged in 4 DEG C of 7500rpm/min
10min；Careful suction abandons supernatant, is careful not to the RNA reject precipitation, and EP pipe is placed in superclean bench standing forced air drying
10min；Add 35 μ L RNase free water dissolution precipitations in EP pipe, preserve in-80 DEG C of refrigerators；
(2) cDNA the first chain synthesis
Use the PrimeScript of TaKaRa companyTMRT reagent Kit with gDNA Eraser(Perfect
Real Time) test kit carries out the synthesis of template cDNA.
Genomic DNA removed by table 1
Table 2 reverse transcription reaction
(3) NtFLS2 gene amplification and vector construction
Reverse transcription obtains cDNA the first chain as template amplification genes of interest NtFLS2(Figure 1A), primer sequence is:
NtFLS2_BamHI:GGATCCATGAAAACAGCTGAAGCTCA；
NtFLS2_XhoI:CTCGAGTCACTGAGGAAGCTTGTTAA.
PCR uses high-fidelity DNA polymerase (Phusion High-Fidelity DNA Polymerase, NEB), PCR
Reaction condition is 98 DEG C of denaturations 30s；98 DEG C of degeneration 10s, 56 DEG C of annealing 30s, 72 DEG C extend 2min, totally 30 circulations；Finally
72 DEG C extend 7min.
Genes of interest fragment is connected to pTOPO carrier and carries out check order (Figure 1B).
Embodiment 2: prepare plant expression vector pK2-NtFLS2
With BamHI and XhoI double digestion pTOPO-NtFLS2 and pENTRTM2B, be separately recovered obtain purpose fragment NtFLS2 and
Carrier segments pENTRTM2B, utilizes T4 DNA Ligase to obtain entry vector pENTR after connectingTM2B-NtFLS2(Fig. 2), with
Purpose carrier pK2GW7 obtains plant expression vector pK2-NtFLS2(Fig. 3 by LR reaction).
Embodiment 3: the preparation Agrobacterium tumefaciens strain containing plant expression vector pK2-NtFLS2
Provoke Agrobacterium list colony inoculation in 5 ml LB liquid medium, 28 DEG C, 250 rpm concussions cultivate to OD600 be 0.5,
Being transferred to amplification culture in 50 ml fresh liquid culture medium in the ratio of 1:10,28 DEG C, 250 rpm concussion cultivations to OD600 are
0.5.Ice bath 30 min, 5000 rpm are centrifuged 5 min and abandon supernatant, 10 ml CaCl2(20 mM) resuspension thalline, recentrifuge,
Add 350 l CaCl2(20 mM) suspension thalline, then add the sterile glycerol of 150 l 50%, mixing, subpackage 100 l/ manages, sense
By state cell in-80 DEG C of preservations.
Take 0.5-2 l recombiant plasmid pK2-NtFLS2, join the Agrobacterium C58C1 bacterial strain impression that 50 l thaw on ice
State cell, softly mixes, ice bath 5 min, and quick freeze 5 min in liquid nitrogen, and 37 DEG C of water-bath 5 min, add 1 ml therewith
LB fluid medium, 28 DEG C of 210 rpm cultivates that 3.5 h, 7500 rpm are centrifugal abandons part supernatant, stays 100 ul resuspension thalline,
Bacterium solution is applied to the LB solid plate of the spectinomycin (Spe) of rifamycin (Rif)+100 g/ml containing 50 g/ml,
Cultivate 3d, grow single bacterium colony to flat board for 28 DEG C.
Embodiment 4: prepare transgenic tobacco plant
Picking agrobacterium strains is inoculated in the LB culture medium of 50 ml (containing Spe 100 g/mL), 180 rpm, cultivates 24 for 28 DEG C
H, bacterium solution OD600 to 1.0,3000 rpm are centrifuged 10 min, precipitate thalline.Suspend with the MS fluid medium of 10ml again, 3000
Rpm is centrifuged 10 min, precipitates thalline.Repeat above operation 2～3 times.Finally with the MS liquid culture basic weight adding certain volume
Suspending, the OD600 value making thalline is 0.5.Choose tobacco leaf, the Agrobacterium bacterium solution prepared contaminated 15-20 min,
After blotting with aseptic absorbent paper, it is laid in dark in MS culture medium and co-cultures 2 days, the bud that outer implant is transferred to containing antibiotic is lured
Leading the enterprising row filter of culture medium, about 15 days subcultures are once.After having blastogenesis to become, proceed on the root media MS containing antibiotic,
Carry out root induction growth.Aseptic seedling is transplanted to greenhouse, uses normal agronomic culture measure to manage, and observes phenotype, result such as Fig. 4.
Embodiment 5: transgene tobacco screens
Extracting transgenic tobacco leaf total serum IgE, reverse transcription obtains cDNA the first chain.Use SYBR Green method to NtFLS2 gene
Carrying out fluorescence real-time quantitative PCR (qRT-PCR) to analyze, quantitative primer is:
NtFLS2_q_F:AAAACTCCAGGGTCTCAG；
NtFLS2_q_R:CTGTAGGAGGGAGGATTT.
In plant expression vector, the expression of target gene is driven by CaMV 35S promoter composing type.As shown in Figure 5, T0
QRT-PCR analysis result for transfer-gen plant shows that the NtFLS2 gene expression dose of major part plant is the most notable
Improve, reach as high as 43.6 times, select two strains of OE4 and OE28 to carry out follow-up test.Collect T1 for seed and in resistance training
Carrying out screening in foster base and obtain resistance seedling, transplant and plant to greenhouse, period of maturation collection blade carries out gene expression dose and divides
Analysis, it will be appreciated from fig. 6 that result shows that OE4 and OE28 is 6.9 and 56.7 times of comparison expression respectively.
Embodiment 6: transgene tobacco rutin content detects
Transgenic and comparison Nicotiana tabacum L. period of maturation gather grind into powder in the blade liquid nitrogen fixing leaf position, after lyophilization, weigh
20 mg dry samples add the methanol trituration of 3 ml 75%, and ultrasonic Treatment 30 min, 10000 rpm are centrifuged 10 min, take on 1ml
Transfer to clearly 10 ml pipes, then, add 1 ml water and 2 ml chloroforms remove chlorophyll.Rotate and shake mixture 1 min, 10 000
Rpm is centrifuged 10 min, collects upper solution and is used for analyzing.
Use Waters ACQUITY UPLC system(Waters) combine AB Sciex Triple Quad 5500 matter
Spectrometer analyzes tobacco leaf and the Flavonoid Content in spending, and chromatographic column uses Waters BEH C18 column (150 × 2.1
Mm i.d., 1.7 um particle sizes, Waters Corporation), column temperature is set to 30 DEG C, and sample size is
1 μ l, solvent orange 2 A and B are water and acetonitrile respectively, and the ammonium acetate of formic acid (0.1%, v/v) and 0.2 mmol/L is separately added into solvent orange 2 A
With B to promote chromatographic isolation, eluent gradient is set to 10% solvent B 1min, 10-90% solvent B 8min, 90-100% solvent B
2min.Total run time is 13min, including 2min equilibration time.Liquid chromatography eluant is directly with flow velocity 0.2 ml/
Min introduces ESI interface, in conjunction with positive and negative ionization pattern analysis flavonoid.The impact energy of 20,30,40, and 50 V is used for MS2
Broken.Gas curtain 40 psi；Collision gas 6 psi；Ion spray voltage ± 4000 V；Temperature 700 DEG C；Ion source gas 1,60
psi；Ion source gas 2,50 psi.In crushing experiment, helium is as collision gas.
As shown in Figure 7, in transgenic line (OE4 and OE28), rutin content is comparison 4.4 times and 3.5 times respectively, shows
Process LAN NtFLS2 gene is remarkably improved rutin accumulation in tobacco leaf.
SEQUENCE LISTING
<110>Yunnan Academy of Tobacco Agricultural Science
<120>a kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application
<130> 2016
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 1041
<212> DNA
<213>NtFLS2 nucleotide
<400> 1
atgaaaacag ctgaagctca gagtgcaaca accctaacaa tggaggttgc aagagtacag 60
gcaatagcgt caataacaaa atgcatggac acaataccat cagaatatat taggtcagag 120
aacgagcagc cagcgtccac aacgttgcat ggtgtgctac ttcaagttcc agtaattgac 180
atagacgata aaaatgtagt gaaactcata tcggatgcta gcaaagaatg ggggatattt 240
caagtgataa atcatggaat tccagatgag gtaattgcga atttgcaaaa agtagggaag 300
gaattctttg aggttgtacc acaagaggag aaagaggtga ttgcaaaaac tccagggtct 360
cagaatattg aagggtatgg tacttctttg cagaaagaac ttgaagggaa aaggggttgg 420
gttgatcatt tgttccataa gatttggcct ccttctgcca tcaattatcg ttattggcct 480
aaaaatcctc cctcctacag ggaagcaaat gaggaatacg caaagaggct gcgagaagtt 540
gtggagaaaa tctttaagag cttatcactt gggcttgggt taggagccca tgaaatgatg 600
gaggcagcag gtggtgaaga tattgtttac ttgttgaaaa tcaattatta cccaccatgc 660
ccaaggcctg atttggcact tggtgttgtg gcccatacag acatgtccca tataaccatt 720
cttgtcccaa atgaagtcca aggcctccaa gtgttcaagg atggccattg gtatgatgtc 780
aagtacatac ctaatgccct aattgtccac attggtgacc aagttgagat tcttagcaat 840
gggaaataca agagtgtgta ccataggaca acagtgacaa aggacaagac aagaatgtca 900
tggccagtat tcttggagcc accatcagag catgaagtag ggccaatttc taagctggtt 960
aatgaggcca atccacccaa attcaagacc aagaagtaca aggattatgt ttattgtaag 1020
cttaacaagc ttcctcagtg a 1041
<210> 2
<211> 346
<212> PRT
<213>NtFLS2 aminoacid
<400> 2
Met Lys Thr Ala Glu Ala Gln Ser Ala Thr Thr Leu Thr Met Glu Val
1 5 10 15
Ala Arg Val Gln Ala Ile Ala Ser Ile Thr Lys Cys Met Asp Thr Ile
20 25 30
Pro Ser Glu Tyr Ile Arg Ser Glu Asn Glu Gln Pro Ala Ser Thr Thr
35 40 45
Leu His Gly Val Leu Leu Gln Val Pro Val Ile Asp Ile Asp Asp Lys
50 55 60
Asn Val Val Lys Leu Ile Ser Asp Ala Ser Lys Glu Trp Gly Ile Phe
65 70 75 80
Gln Val Ile Asn His Gly Ile Pro Asp Glu Val Ile Ala Asn Leu Gln
85 90 95
Lys Val Gly Lys Glu Phe Phe Glu Val Val Pro Gln Glu Glu Lys Glu
100 105 110
Val Ile Ala Lys Thr Pro Gly Ser Gln Asn Ile Glu Gly Tyr Gly Thr
115 120 125
Ser Leu Gln Lys Glu Leu Glu Gly Lys Arg Gly Trp Val Asp His Leu
130 135 140
Phe His Lys Ile Trp Pro Pro Ser Ala Ile Asn Tyr Arg Tyr Trp Pro
145 150 155 160
Lys Asn Pro Pro Ser Tyr Arg Glu Ala Asn Glu Glu Tyr Ala Lys Arg
165 170 175
Leu Arg Glu Val Val Glu Lys Ile Phe Lys Ser Leu Ser Leu Gly Leu
180 185 190
Gly Leu Gly Ala His Glu Met Met Glu Ala Ala Gly Gly Glu Asp Ile
195 200 205
Val Tyr Leu Leu Lys Ile Asn Tyr Tyr Pro Pro Cys Pro Arg Pro Asp
210 215 220
Leu Ala Leu Gly Val Val Ala His Thr Asp Met Ser His Ile Thr Ile
225 230 235 240
Leu Val Pro Asn Glu Val Gln Gly Leu Gln Val Phe Lys Asp Gly His
245 250 255
Trp Tyr Asp Val Lys Tyr Ile Pro Asn Ala Leu Ile Val His Ile Gly
260 265 270
Asp Gln Val Glu Ile Leu Ser Asn Gly Lys Tyr Lys Ser Val Tyr His
275 280 285
Arg Thr Thr Val Thr Lys Asp Lys Thr Arg Met Ser Trp Pro Val Phe
290 295 300
Leu Glu Pro Pro Ser Glu His Glu Val Gly Pro Ile Ser Lys Leu Val
305 310 315 320
Asn Glu Ala Asn Pro Pro Lys Phe Lys Thr Lys Lys Tyr Lys Asp Tyr
325 330 335
Val Tyr Cys Lys Leu Asn Lys Leu Pro Gln
340 345
<210> 3
<211> 26
<212> DNA
<213> NtFLS2_BamHI
<400> 3
ggatccatga aaacagctga agctca 26
<210> 4
<211> 26
<212> DNA
<213> NtFLS2_XhoI
<400> 4
ctcgagtcac tgaggaagct tgttaa 26
<210> 5
<211> 18
<212> DNA
<213> NtFLS2_q_F
<400> 5
aaaactccag ggtctcag 18
<210> 6
<211> 18
<212> DNA
<213> NtFLS2_q_R
<400> 6
ctgtaggagg gaggattt 18
Claims (9)
1. one kind is improved the cloning process of rutin content gene NtFLS2 in tobacco leaf, it is characterised in that comprise the following steps:
A, with TRIzol extract tobacco leaf and flower total serum IgE, then reverse transcription obtain cDNA the first chain；
B, using cDNA the first chain as template, utilize primer to carry out PCR amplification；
C, genes of interest fragment are connected to pTOPO carrier and check order.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
In described gene nucleotide series as shown in SEQ ID:No.1.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
In the aminoacid sequence of described gene code as shown in SEQ ID:No.2.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
Sequence in the primer described in step B is:
NtFLS2_BamHI:GGATCCATGAAAACAGCTGAAGCTCA；
NtFLS2_XhoI:CTCGAGTCACTGAGGAAGCTTGTTAA.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
The reaction condition expanded in the PCR described in step B is 98 DEG C of denaturations 30s；98 DEG C of degeneration 10s, 56 DEG C of annealing 30s, 72 DEG C
Extend 2min, totally 30 circulations；Last 72 DEG C extend 7min.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
Expand in the PCR described in step B and use high-fidelity DNA polymerase.
The cloning process of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 1, its feature exists
It is to use PrimeScript in cDNA the first chain described in step ATM RT reagent Kit with gDNA Eraser
(Perfect real Time) test kit synthesizes.
8. the application of rutin content gene NtFLS2 in the raising tobacco leaf described in a claim 1, it is characterised in that bag
Include following steps:
(1) plant expression vector is prepared
With BamHI and XhoI double digestion pTOPO-NtFLS2 and pENTRTM2B, be separately recovered obtain purpose fragment NtFLS2 and
Carrier segments pENTRTM2B；Entry vector pENTR is obtained after connecting with T4 DNA LigaseTM2B-NtFLS2, carries with purpose
Body pK2GW7 obtains plant expression vector pK2-NtFLS2 by LR reaction；
(2) preparation Agrobacterium tumefaciens strain containing plant expression vector:
Take 0.5 ~ 2 l recombiant plasmid pK2-NtFLS2, join the Agrobacterium C58C1 bacterial strain competence that 50 l thaw on ice thin
Born of the same parents, softly mix, ice bath 5 min, and quick freeze 5 min in liquid nitrogen, then 37 DEG C of water-bath 5 min, add 1 ml LB liquid
Body culture medium, 28 DEG C of 210 rpm cultivates that 3.5 h, 7500 rpm are centrifugal abandons part supernatant, stays 100 ul resuspension thalline, by bacterium
Liquid is applied to the LB solid plate of the spectinomycin of the rifamycin containing 50 g/ml and 100 g/ml, cultivates 2 ~ 3 for 28 DEG C
D, grows single bacterium colony to flat board；
(3) transgenic tobacco plant is prepared:
Picking agrobacterium strains is inoculated in the LB culture medium containing Spe 100 g/mL of 50ml, 180 rpm, cultivates 24 for 28 DEG C
H, bacterium solution OD600 to 1.0,3000 rpm are centrifuged 10 min, precipitate thalline, then suspend with the MS fluid medium of 10ml, and 3000
Rpm is centrifuged 10 min, precipitates thalline, repeats above operation 2～3 times, finally with the MS liquid culture basic weight adding certain volume
Suspending, the OD600 value making thalline is 0.5, chooses aseptic seedling or the tobacco leaf of sterilization Seedling, in the Agrobacterium bacterium solution prepared
Contaminate 15 ~ 20 min, after blotting with aseptic absorbent paper, be laid in dark in MS culture medium and co-culture 2 days, outer implant is transferred to
The enterprising row filter of bud inducement culture medium containing antibiotic, about 15 days subcultures once, after having blastogenesis to become, proceed to the life containing antibiotic
In root culture medium MS, carry out root induction growth, obtain transgenic tobacco plant.
The application of rutin content gene NtFLS2 in raising tobacco leaf the most according to claim 8, it is characterised in that step
Suddenly the competent cell described in (1) is first to provoke Agrobacterium list colony inoculation in 5 ml LB liquid medium, 28 DEG C, 200 ~
250 rpm concussion cultivations are 0.5 to OD600, then are transferred in 50 ml fresh liquid culture medium expand training in the ratio of 1:10
Supporting, 28 DEG C, 200 ~ 250 rpm concussions are cultivated is 0.5 to OD600, ice bath 30 min, 5000 rpm are centrifuged 5 min and abandon supernatant, and 20
The 10 ml CaCl of mM2Resuspension thalline, 5000 rpm are centrifuged 5 min, add the 350 l CaCl of 20 mM2Suspension thalline, then add
The sterile glycerol of 150 l 50%, mixing, subpackage 100 l/ is in control, and described competent cell is in-80 DEG C of preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610758645.0A CN106086006A (en) | 2016-08-30 | 2016-08-30 | A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610758645.0A CN106086006A (en) | 2016-08-30 | 2016-08-30 | A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086006A true CN106086006A (en) | 2016-11-09 |
Family
ID=57223966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610758645.0A Pending CN106086006A (en) | 2016-08-30 | 2016-08-30 | A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086006A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110747201B (en) * | 2019-11-12 | 2021-06-04 | 河南省烟草公司三门峡市公司 | Tobacco OA1 gene, primer and application |
-
2016
- 2016-08-30 CN CN201610758645.0A patent/CN106086006A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| ASHUTOSH ET AL: "Development of AtMYB12-expressing transgenic tobacco callus culture for production of rutin with biopesticidal potential", 《PLANT CELL REP》 * |
| NAKATSUKA ET AL: "BAF96939.1", 《GENBANK》 * |
| PRASHANT ET AL: "Modulation of Transcriptome and Metabolome of Tobacco by Arabidopsis Transcription Factor, AtMYB12, Leads to Insect Resistance", 《PLANT PHYSIOLOGY》 * |
| VINAY ET AL: "Transgenic Tobacco Overexpressing Tea cDNA Encoding Dihydroflavonol 4-Reductase and Anthocyanidin Reductase Induces Early Flowering and Provides Biotic Stress Tolerance", 《PLOS ONE》 * |
| 李洋等: "烟草NtHCT 基因对次生代谢物质绿原酸和类黄酮合成的影响", 《中国烟草学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110747201B (en) * | 2019-11-12 | 2021-06-04 | 河南省烟草公司三门峡市公司 | Tobacco OA1 gene, primer and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102485897B (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN109055399B (en) | Gene sequence related to flavone composition in scutellaria baicalensis and application thereof | |
| Zhang et al. | Virus-induced gene silencing in soybean and common bean | |
| CN107723297A (en) | Iris R3 MYBx1 genes and its application in pattern regulation | |
| CN107435047A (en) | In a kind of plant phosphorus signal network Tolerant to low P key gene GmPHR25 and its with application | |
| CN108795971A (en) | Applications of the miR159 in changing plant root species form | |
| CN106047889A (en) | Application of soybean MYB transcription factor gene in improvement of soybean isoflavone biosynthesis | |
| Bao et al. | CRISPR/Cas9-based gene editing in soybean | |
| CN106117327A (en) | Synthesize the relevant synthetic transcription factor of flavonoid and promote the application in flavonoid synthesis and regulation and control Anthocyanin | |
| CN104593380B (en) | For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application | |
| CN105646686A (en) | Gene for regulating and controlling synthesis of plant flavonol and application | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN105255942B (en) | A method of homoisoflavone GM Roundup-Ready soyabean is cultivated using genetic engineering | |
| CN106086006A (en) | A kind of cloning process improving rutin content gene NtFLS2 in tobacco leaf and application | |
| CN107267551A (en) | Application of the rose RrNUDX1 genes in the enhancing plant fragrance of a flower | |
| CN106755072A (en) | A kind of method for cultivating transgene abrotanum, constructed expression vector and application | |
| KR20210011394A (en) | Composition for editing flavonoid biosynthetic genome using CRISPR/CAS9 system and use thereof | |
| CN114854703B (en) | Flavone synthase I/flavanone-3-hydroxylase and application thereof in field of flavonoid compound synthesis | |
| CN100412195C (en) | Promotor specificly-response to heavy metal ion | |
| CN106978499B (en) | Transgenic soybean event GC1-1 external source Insert Fragment flanking sequence and its application | |
| CN112662641B (en) | Marchantia cuneata flavonoid glycosyltransferase and coding gene and application thereof | |
| CN107312794A (en) | Rose RrNUDX1 genes are changing the interim application of plant flowers | |
| CN110438148A (en) | A method of content of artemisinin in sweet wormwood is improved using AaSPL2 gene | |
| Ray et al. | An efficient method of isolation and transformation of protoplasts from tomato leaf mesophyll tissue using the binary vector pCambia 1302 | |
| CN106434742B (en) | Utilize the method for soybean expression canine distemper albumen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |
|
| RJ01 | Rejection of invention patent application after publication |