CN106085889B - Pichia guilliermondii 3-J15 and its application - Google Patents
Pichia guilliermondii 3-J15 and its application Download PDFInfo
- Publication number
- CN106085889B CN106085889B CN201610467541.4A CN201610467541A CN106085889B CN 106085889 B CN106085889 B CN 106085889B CN 201610467541 A CN201610467541 A CN 201610467541A CN 106085889 B CN106085889 B CN 106085889B
- Authority
- CN
- China
- Prior art keywords
- pichia guilliermondii
- guilliermondii
- fermentation
- sauce
- soy sauce
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/84—Pichia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/165—Yeast isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Soy Sauces And Products Related Thereto (AREA)
Abstract
The present invention provides a kind of Pichia guilliermondii（Meyerozyma guilliermondii）3 J15,2 phenylethanol of Pichia guilliermondii high yield Volatile infochemicals and 3 methyl, 1 butanol, and at least it is resistant to 15% salinity, not only there is good soy sauce flavouring fermentation potentiality and good adaptive capacity to environment, there are the potentiality applied in practical soy sauce production, it is alternatively arranged as fermentation strain and ferments in liquid medium preparing 3 methyl, 1 butanol and 2 phenylethanols, the preparation for 3 methyl, 1 butanol and 2 phenylethanols new effective means being provided.
Description
Technical field
The present invention relates to microorganism fields, and in particular to one plant of Pichia guilliermondii（Meyerozyma guilliermondii）3-J15 and its application.
Background technology
Traditional technology brew soy sauce be not single technique, single flavor product.Since Chinese Regional is wide,
Various regions temperature, humidity, water quality are different, and eating habit is different, and through excessively being passed on for the technology of people, and various regions form in raw material, match
Than, processing mode, moromi（Or sauce unstrained spirits）Salt content, water content, the length of fermentation time and the extracting method of soy sauce etc.
There are many differences, different regions have produced a multitude of names, flavor soy sauce with their own characteristics, for consumer's multiple choices.
There are many fragrance flavor components in soy sauce, plant, can be generally divided into fragrant mechanism complexity, detected so far nearly more than 300
The classifications such as alcohol, aldehyde, ester, ketone, phenol, organic acid, furans, pyridine, wherein what is played a major role has tens of kinds, most commonly seen three kinds
There are organic acid, alcohols and esters.
Soy sauce brewing is related to aspergillus, yeast and the synergistic effect of bacterium, and the performance of microorganism largely determines
Soy sauce quality and raw material availability.Modern speed makes technique frequently with the pure bacterial strain koji-making such as aspergillus oryzae, Aspergillus sojae, although can be
The product with stability, repeated quality is obtained in short period of time, but if things go on like this, not only adds product homogeneity effect
Play also counteracts the succession of precious traditional fermentation technique, while fermentation condition is unfavorable for microorganism production ester life perfume.Saccharomycete can
On the basis of the small molecule carbohydrate and amino acid that are generated in aspergillus metabolism, carry out alcoholic fermentation and participate in the conjunction of a variety of aroma substances
Into.Therefore, in order to supplement flavor of soy sauce and ensure quality of sauce, the strain improvement with sauce fermentation potentiality is that modern soy sauce is made
One of necessary choice of technique processed.Such as Yan Mei, the selection and breeding of high salt tolerant saccharomyces soya and its application [D] in soy sauce brewing,《Lake
Northern polytechnical university》2014, one plant of salt tolerance is filtered out in thick chilli sauce herein up to 24% yeast, can be applied to soy sauce wine
It makes.Lu Shi yeast is identified as through 26s rDNA.Through analysis of aroma components, which mainly produces with unique rose scent
Benzyl carbinol, the influence with high salt to its fragrance component is smaller.Chen Qiang, the screening of aroma-producing yeast bacterium and for soy sauce flavouring in soy sauce
It studies [D],《Agricultural University Of South China》2011, this research has filtered out 8 plants from natural fermented moromi can be in 10% sodium chloride wheat
The saccharomycete that bud juice agar medium is well grown filters out the fragrant bacterial strain of good performance of two plants of productions, identification by subjective appreciation
Show that JM01, JM06 are belonging respectively to the Lu Shi Zygosaccharomyces that the spherical torulopsis of Torulopsis and Zygosaccharomyces belong to.Liang Hui
Deng, the screening of cured fish aroma-producing yeast bacterium and its fragrant characteristic Primary Study [D] of fermentation production,《Food industry science and technology》12 phases in 2011,
Research separation screening from the cured fish of tradition has obtained two plants of aroma-producing yeasts.Combining form and saccharomycete 26S rDNA D1/D2
Region sequence is analyzed, wherein one plant of Preliminary Identification for Pichia guilliermondii (Pichia guilliermondii（Meyerozyma guilliermondii）, H9), the volatile ingredient in the fermented liquid is mainly alcohols and esters, but the salt tolerance of the yeast
It is low, salinity be 8%~10% when, yeast H9 growth almost stagnates, therefore the application in the high sauce fermentation industry of salt content by
To limitation.It being found by studying report above, the exploitation of aroma yeast is of great significance to sauce fermentation industry, therefore,
The opposite of aroma yeast lacks under the insufficient background of soy sauce fragrance for leading to industrialized production, using it is traditional it is natural shine dew technique as
It relies on, screening more has the yeast of flavouring potential, can push the combination of traditional handicraft and modern industry.
Invention content
It is few the present invention is directed to be directed to applicable flavouring potential yeast species in existing industrialized production soy sauce, production
The problem of soy sauce fragrance is insufficient provides one plant of Pichia guilliermondii（Meyerozyma guilliermondii）3-J15, should
Pichia guilliermondii high yield Volatile infochemicals 2- phenylethanols and 3- methyl-1-butanols, and at least it is resistant to 15% salt
Concentration not only possesses good soy sauce flavouring fermentation potentiality and good adaptive capacity to environment, has and applies to practical soy sauce life
Potentiality in production are alternatively arranged as fermentation strain and ferment in liquid medium to prepare 3- methyl-1-butanols and 2- phenylethanols.
In order to solve the above technical problems, the invention is realized by the following technical scheme：
Bacterial strain 3-J15, Classification And Nomenclature are Pichia guilliermondii, and Latin name isMeyerozyma Guilliermondii,It is stored in China Committee for Culture Collection of Microorganisms's common micro-organisms on May 18th, 2016
The heart（CGMCC）, deposit number is CGMCC No. 12465, preserves unit address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number.
The Pichia guilliermondii 3-J15 is that the first city's soy sauce for revealing solid-state brewing with high salt is naturally shone from Sichuan Province Hejiang County
It is isolated in the sauce unstrained spirits in fermentation third year.
The Pichia guilliermondii 3-J15, in the Yeast protein peptone glucose agar medium containing 150 g/L NaCl
Upper well-grown, bacterium colony are milky, and butyrous, surface is smooth, neat in edge.Microscopy, yeast 3-J15 are carried out to thalli morphology
Cell is in oval, gemmation, no pseudohypha.
Pichia guilliermondii 3-J15 well-growns on yeast extract peptone dextrose agar medium, in wheat
It is grown on bud juice agar medium and potato dextrose agar generally, it is poor to be grown in czapek agar medium.
The most suitable growth pH of the Pichia guilliermondii 3-J15 bacterium is 4~8, about 30 °C or so of optimum growth temperature,
Meet under conditions of sodium chloride content in optimum temperature, optimal pH and culture medium is 15%, the growing state in 26 h is such as
Under：From the 1st~2 h, bacterial strain progresses into logarithmic phase, and growth is vigorous, and stationary phase is entered after 18 h, and strain growth rate is gradual
Steadily, Metabolite Accumulation.
Above research shows that when applying in sauce unstrained spirits fermentation process, Pichia guilliermondii 3-J15 has good
Adaptive capacity to environment, have the potentiality applied in the production of practical soy sauce.
The Pichia guilliermondii uses NL1/NL4 pairs of the universal primer for yeast 26S rDNA D1/D2 regions
Its genome DNA carries out PCR amplification for template, obtains by 604 base-pairs（bp）The objective gene sequence of composition, such as
Shown in Sequence Listing 1；
Existing sequence progress BLAST in obtained gene order and ncbi database will be sequenced to compare, NL1/NL4 primer pairs
Long 604 bp of amplified fragments sequencing, and in GenbankMeyerozyma guilliermondiiType strain NG_042640 phases
Like rate up to 99%, can Preliminary Identification 3-J15 be one plantMeyerozyma guilliermondii（Also referred to asPichia guilliermondii）, i.e. Pichia guilliermondii.
The present invention also provides a kind of simulation sauce unstrained spirits liquid for being suitble to the Pichia guilliermondii 3-J15 Quick shaking bottles fermentation
Body culture medium：The culture medium is by analysis for soybean powder, wheat flour, fresh sauce unstrained spirits buffer solution Na2HPO4/KH2PO4It is configured to buffer body
Then even, four layers of filtered through gauze after stirring is boiled by system, adjust pH=5~5.2, sterilizing, thus obtaining the product, wherein every 1 L buffer solutions Na2HPO4/
KH2PO4In containing 10 g of analysis for soybean powder, 2.5 g of wheat flour, fresh 50 g of sauce unstrained spirits.This kind of culture medium can be used for Rapid Fermentation to prepare 3-
Methyl-1-butanol and 2- phenylethanols.
Beneficial effects of the present invention：
The present invention is screened from the fresh sauce unstrained spirits of natural ferment in nature soy sauce has the function of the Pichia guilliermondii of flavouring
3-J15, which can generate a variety of different flavor components, and high yield has soy sauce mouthfeel the tart flavour and caramel of positive influences
（p<0.05）3- methyl-1-butanols, there are flowers and plants fragrance and the 2- phenylethanols of melon and fruit breath both flavor components, be sauce
Oily flavor substance and quality safety lay the foundation.
The Pichia guilliermondii 3-J15 of present invention well-growns under 15% salinity, and can adapt to wider pH models
It encloses, there is stronger application potential in the artificial hypersaline environment of sauce fermentation, provide reliably, have for modern times brewing sauce technique
The aroma yeast of effect improves flavor of soy sauce and quality.
The Pichia guilliermondii 3-J15 of the present invention can be inoculated in sauce unstrained spirits fermented sauce, also high under non-salt coercion
3- methyl-1-butanols and 2- phenylethanols are produced, therefore the preparation 3- methyl-1s that can in liquid medium ferment as fermenting microbe-
Butanol and 2- phenylethanols, the preparation for 3- methyl-1-butanols and 2- phenylethanols provide new effective means.
Description of the drawings
Fig. 1 is the 3-J15 and its related strain built using Neighbor-Joining methods about 26S rDNA D1/D2
The phylogenetic tree in area；
Fig. 2 is colonial morphology figures of the bacterial strain 3-J15 on yeast extract peptone dextrose agar medium；
Fig. 3 is colonial morphology figures of the bacterial strain 3-J15 on wort agar culture medium；
Fig. 4 is colonial morphology figures of the bacterial strain 3-J15 on potato dextrose agar；
Fig. 5 is colonial morphology figures of the bacterial strain 3-J15 on czapek agar medium；
Fig. 6 is the cellular morphology figures of bacterial strain 3-J15 under an optical microscope；
Fig. 7 is bacterial strain 3-J15 salt tolerant curve graphs；
Pichia guilliermondii 3-J15 was stored in China Committee for Culture Collection of Microorganisms on May 18th, 2016
Common micro-organisms center（CGMCC）, deposit number is CGMCC No. 12465, preserves unit address：Chaoyang District, Beijing City north
The institute 3 of occasion West Road 1.
Specific embodiment
Illustrate the present invention With reference to embodiment.
In the present invention, the culture medium that is used in following embodiments：
Yeast extract peptone dextrose agar medium（YPDA）：20 g peptones, 20 g glucose, the leaching of 10 g yeast
Powder, 15 g agar powders, moisturizing to 1 L, natural pH sterilizings.The yeast extract peptone same YPDA of Liquid Culture based formulas, but it is not added with fine jade
Cosmetics.
Wort agar culture medium（MEA）：130 g malt extract mediums（Think the limited public affairs of biotechnology purchased from Hangzhou hundred
Department）, 15 g agar powders, moisturizing to 1 L, natural pH, sterilizing.
Potato dextrose agar（PDA）：300 g potatoes, clean peeling are cut into small pieces, water are added to mend to 1 L and is boiled
Boil 20 min.Eight layers of filtered through gauze, filtrate add in 20 g glucose, 18 g agar and moisturizing to 1 L, and heating makes it fully molten
Solution, natural pH, sterilizing before plate is down flat, need to add in the 0.1 g chloramphenicol dissolved with a small amount of ethyl alcohol, 0.22 μm of membrane filtration
To being cooled in 50 °C or so of culture medium.
Czapek agar medium（CDA）：3 g NaNO3, 1 g KH2PO4, 0.5 g MgSO4, 0.5 g KCl, 0.01 g
FeSO4, 30 g sucrose, 15 g agar powders, moisturizing to 1 L, natural pH, sterilizing.
Sauce unstrained spirits sample in the present invention in following embodiments is provided by fermentation food Co., Ltd of Sichuan Province Hejiang County city of elder generation.
Embodiment 1
Separation, culture and the molecular biology identification of Pichia guilliermondii bacterial strain 3-J15.
Under aseptic technique, 5 g of sauce unstrained spirits sample is taken to add in the 45 mL sterile salines equipped with bead in advance,
37 °C of shaking tables shake 15 min.1 mL sample diluting liquids is taken to carry out 10 times of gradient dilutions successively, suitable dilution is selected to be coated with
In in the PDA culture medium containing 10% sodium chloride.Characteristic bacterium colony is selected after cultivating 72 h in 28 °C, through crossing repeatedly after purification,
More than 20 strain yeast are isolated from fermentation sauce unstrained spirits, it is contemplated that increasing of the food fermentation background and yeast of different strain to product
Perfume effect focuses primarily upon the fermentation middle and later periods, and finishing screen selects one plant of isolated yeast 3- from sauce unstrained spirits is fermented in third year
J15.Isolated yeast 3-J15 is seeded to respective liquid culture medium and is enlarged culture.It waits after the completion of expanding culture, extraction
Purpose bacterial strain DNA, and specific amplification is carried out for its 26S rDNA D1/D2 regional sequence using universal primer NL1/NL4,
PCR reaction conditions are 94 °C of 3 min of pre-degeneration；94 °C of 30 s of denaturation, 55 °C of 30 s of annealing, 72 °C extend 1 min, cycle
30 times；72 °C of 5 min of extension.Amplified production is after electrophoresis in single band, no non-specific amplification on 1.5% Ago-Gel
Phenomenon, about 600 bp of band length send out sequencing.
Above-mentioned universal primer is to NL1/NL4 by Invitrogen companies（Shanghai）Synthesis, sequence are as follows：
NL1：GCATATCAATAAGCGGAGGAAAAG；
NL4：GGTCCGTGTTTCAAGACGG；
Existing sequence progress BLAST in obtained gene order and ncbi database will be sequenced to compare, NL1/NL4 primer pairs
Long 604 bp of amplified fragments sequencing, and in GenbankMeyerozyma guilliermondiiType strain NG_042640 phases
Like rate up to 99%, can Preliminary Identification 3-J15 be one plantMeyerozyma guilliermondii（Also referred to asPichia guilliermondii）, i.e. Pichia guilliermondii.
Screening and the higher sequence of Pichia guilliermondii 3-J15 homologys, are built by Neighbor-Joining methods
Phylogenetic tree, as shown in Figure 1,3-J15 and two plantMeyerozyma guilliermondiiType strain is in same point
Branch.
The Pichia guilliermondii 3-J15 is lined on four kinds of common Yeast Cultivation tablets, 30 °C are inverted culture 48
After h, to bacterial strain 3-J15, cultural characteristic is observed on each tablet, as shown in Fig. 2, bacterial strain well-grown on YPDA,
Bacterium colony is milky, and bacterium colony is larger, and butyrous, surface is smooth, neat in edge；As shown in Figure 3, Figure 4, Pichia guilliermondii 3-
J15 is grown generally on MEA and PDA, and bacterium colony is white, and bacterium colony is slightly smaller compared with YPDA；As shown in figure 5, poor, bacterium is grown on CDA
It falls as white, bacterium colony is minimum.
Carry out microscopy under an optical microscope to thalli morphology, the yeast cells is in oval, gemmation, without false bacterium
Silk, as shown in Figure 6.
Embodiment 2
Bacterial strain 3-J15 salt-tolerant traits are probed into：
Using YPD fluid nutrient medium activated strains, then to bacterial strain in the YPD culture mediums containing different gradient concentration NaCl
In growing state be measured.30 °C, after 120 rpm shaking tables vibrate 24 h, by spectrophotometer at 660 nm of wavelength
The light absorption value of culture solution is measured, draws tolerance curve of the bacterial strain to NaCl, as shown in Figure 7, the results showed that also cover complete red ferment the season
Female 3-J15 can at least be resistant to 15% salinity.
Embodiment 3
Pichia guilliermondii is applied to simulation sauce unstrained spirits solution culture fermentation：
1st, sauce unstrained spirits fluid nutrient medium is simulated：10 g analysis for soybean powder, 2.5 g wheat flours, the fresh sauce unstrained spirits of 50 g use buffer solution system
Na2HPO4/KH2PO41 L systems are configured to, boil four layers of filtered through gauze after even stirring, pH=5~5.2, sterilizing.According to experimental design
It is divided into the salt stress type of 150 g/L sodium chloride of additional addition and does not add the non-salt stress type of sodium chloride.
2nd, it will also cover in the season of glycerol tube preservation in yeast access YPD fluid nutrient mediums after activating, 4000 rpm centrifugations take nothing
Bacterium physiological saline washing thalline repeatedly, by 1 mL 5 × 106The thallus suspension liquid of CFU/mL is added to described in 30 mL and simulates sauce
In unstrained spirits fluid nutrient medium, the shaking flask time is appropriately extended to after growing stationary phase in 120 rpm shaking flasks under optimum growth temperature, sterile
Under the conditions of zymotic fluid is collected by filtration.
3rd, the GC-MS analyses of fermentation culture fragrance component
The detection method of the Volatile infochemicals of the zymotic fluid is：It is accurate to draw 6 mL fermentation broth samples and 20 μ L
2- methyl -3- heptanone dilutions（5 μL/L）It in 15 mL ml headspace bottles, seals, the extracting head for having completed aging is inserted into
The head space part of bottle, extracts 30 min in 60 °C of water bath with thermostatic control.Not add the fermentation medium of bacterium as feminine gender during detection
Control.Sample passes through DB-5MS type elastic quartz capillary chromatographs（30 m×0.25 mm×0.25 μm）It is detached；Program
Elevated Temperature Conditions are 40 °C of initial temperature, with 3 °C it is per minute be raised to 120 °C, keep 2 min, then per minute rise to 15 °C
250 °C, keep 2 min；Carrier gas is high-purity helium（1.0 mL/min）；Split ratio 10:1.Mass spectrum uses electron impact ionization
Source；70 eV of electron energy；230 °C of ion source temperature；35~350 m/z of scanning range.Collected mass spectrogram is utilized
NIST08 and WILEY09 library searchings carry out component analysis, and calculate each aroma component with the normalization of gas-chromatography peak area
Relative amount.It the results are shown in Table 1.
1 Pichia guilliermondii 3-J15 of table is in salt stress and the major volatile constituents relative amount of non-condition of salt stress
（%）.
From table 1 it follows that the phase of the 2- phenylethanols and 3- methyl-1-butanols in Pichia guilliermondii zymotic fluid
Far surpass remaining ingredient to content, become the main source of its Volatile infochemicals.Feng etc. by research find 3- methyl-1s-
Butanol is one of fragrance reactive compound most strong in high-salt diluted state fermentation soy, and proves to add appropriate 3- first in the product
Base-n-butyl alcohol can be to its final tart flavour and caramel of the mouthfeel contribution with positive influences（p<0.05）.2- phenylethanols are made
For saccharomycete degrade phenylalanine metabolite, have flowers and plants fragrance and melon and fruit breath, by researcher be applied to soy sauce and
In the flavouring means of the fermented products such as beans sauce.
SEQUENCE LISTING 1
<110>Sichuan University
<120>Pichia guilliermondii（Meyerozyma guilliermondii）3-J15 and its application
<130> 2016
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 604
<212> DNA
<213>Pichia guilliermondii（Meyerozyma guilliermondii）
<400> 1
gcatatccaa aagcggagga aaagaaacca acagggattg ccttagtagc ggcgagtgaa 60
gcggcaaaag ctcaaatttg aaatctggcg ccttcggtgt ccgagttgta atttgaagat 120
tgtaaccttg gggttggctc ttgtctatgt ttcttggaac aggacgtcac agagggtgag 180
aatcccgtgc gatgagatgc ccaattctat gtaaggtgct ttcgaagagt cgagttgttt 240
gggaatgcag ctctaagtgg gtggtaaatt ccatctaaag ctaaatattg gcgagagacc 300
gatagcgaac aagtacagtg atggaaagat gaaaagaact ttgaaaagag agtgaaaaag 360
tacgtgaaat tgttgaaagg gaagggtttg agatcagact cgatattttg tgagccttgc 420
cttcgtggcg gggtgacccg cagcttatcg ggccagcatc ggtttgggcg gtaggataat 480
ggcgtaggaa tgtgacttta cttcggtgaa gtgttatagc ctgcgttgat gctgcctgcc 540
tagaccgagg actgcgattt tatcaaggat gctggcataa tgatcccaaa ccgcccgtct 600
tgaa 604
Claims (4)
1. Pichia guilliermondii（Meyerozyma guilliermondii）3-J15, it is CGMCC No. to preserve number
12465。
2. applications of the Pichia guilliermondii 3-J15 according to claim 1 in the fermentation of soy sauce flavouring.
3. Pichia guilliermondii according to claim 1 as fermenting microbe prepare 2- phenylethanols and 3- methyl-
Application in n-butyl alcohol.
4. application according to claim 3, it is characterised in that：The Rapid Fermentation Liquid Culture of the Pichia guilliermondii
Base is by analysis for soybean powder, wheat flour, fresh sauce unstrained spirits buffer solution Na2HPO4/KH2PO4Buffer system is configured to, then boils even, stirring
Four layers of filtered through gauze afterwards adjusts pH=5~5.2, sterilizing, thus obtaining the product, wherein per 1L buffer solutions Na2HPO4/KH2PO4In contain analysis for soybean powder
10 g, 2.5 g of wheat flour, fresh 50 g of sauce unstrained spirits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610467541.4A CN106085889B (en) | 2016-06-24 | 2016-06-24 | Pichia guilliermondii 3-J15 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610467541.4A CN106085889B (en) | 2016-06-24 | 2016-06-24 | Pichia guilliermondii 3-J15 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106085889A CN106085889A (en) | 2016-11-09 |
| CN106085889B true CN106085889B (en) | 2018-07-06 |
Family
ID=57253648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610467541.4A Active CN106085889B (en) | 2016-06-24 | 2016-06-24 | Pichia guilliermondii 3-J15 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106085889B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047733B (en) * | 2016-07-13 | 2020-06-30 | 华中农业大学 | Yeast strain for food fermentation, leaven and application thereof |
| CN112501038B (en) * | 2020-11-11 | 2024-02-02 | 大连海洋大学 | Pichia guilliermondii and method for treating high-salt wastewater |
| CN112538504A (en) * | 2020-11-13 | 2021-03-23 | 南京工业大学 | Method for producing 2-phenethyl alcohol by mixed fermentation |
| CN112442452A (en) * | 2020-11-13 | 2021-03-05 | 南京工业大学 | Strain for producing 2-phenethyl alcohol and application thereof |
| CN114574374B (en) * | 2022-03-18 | 2023-07-04 | 南京工业大学 | Strain for producing 2-phenethyl alcohol and application thereof |
| CN114703075A (en) * | 2022-05-07 | 2022-07-05 | 河南农业大学 | Yeast for inhibiting generation of N-nitrosamine substances in fermented meat product and application thereof |
| CN114711391B (en) * | 2022-05-07 | 2024-01-23 | 河南农业大学 | Fermented meat product and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2013116067A (en) * | 2011-12-02 | 2013-06-13 | Univ Of Tsukuba | Fat and oil decomposing yeast and treatment method using the same |
-
2016
- 2016-06-24 CN CN201610467541.4A patent/CN106085889B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2013116067A (en) * | 2011-12-02 | 2013-06-13 | Univ Of Tsukuba | Fat and oil decomposing yeast and treatment method using the same |
Non-Patent Citations (3)
| Title |
|---|
| 传统发酵豆酱中酵母的分离、筛选及功能酵母的鉴定;柴洋洋等;《中国食品学报》;20130331;第13卷(第3期);第183-188页 * |
| 胀罐酱油中耐渗透压酵母菌分离及鉴定;欧阳友生等;《微生物学通报》;20050922;第32卷(第4期);第120-123页 * |
| 高盐稀醪酱油发酵原油中微生物区系研究;谢小保等;《微生物学通报》;20070716;第34卷(第3期);第504-507页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106085889A (en) | 2016-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106085889B (en) | Pichia guilliermondii 3-J15 and its application | |
| Zhang et al. | Characterization of γ-aminobutyric acid (GABA)-producing Saccharomyces cerevisiae and coculture with Lactobacillus plantarum for mulberry beverage brewing | |
| CN108018218B (en) | High-yield ethyl acetate yeast strain and culture method and application thereof | |
| JP2009500013A (en) | Method for producing corosolic acid by plant cell suspension culture | |
| CN109370927A (en) | Candidiasis FW922-1 and its application | |
| CN102352323B (en) | Ester producing yeast as well as method and application of yeast for producing Xiaoqu fen-flavor seasoning wine | |
| CN102505002A (en) | Micro-organic bacterial strain for quick flavor enhancement of flue-cured tobacco and application thereof in tobacco fermentation | |
| CN104087511A (en) | Mucor racemosus strain and its application | |
| CN103589651B (en) | A kind of high salt tolerant Lu Shi zygosaccharomyces | |
| CN106723310B (en) | Application of the bacillus subtilis in degrading tobacco product in terms of protein | |
| CN113215006A (en) | Pichia pastoris and application thereof | |
| CN108315271A (en) | One primary yeast and its application | |
| CN108949597A (en) | A kind of S. cervisiae KMLY1-2 and its separation method and application | |
| CN109554318A (en) | Gluconic acid acetobacter and its application in a kind of fermented tea | |
| CN106987531B (en) | Wine membrana tectoria yeast and application thereof in monoterpene production | |
| Han et al. | Screening of γ-aminobutyric acid (GABA)-producing wild yeasts and their microbiological characteristics | |
| CN109022227A (en) | A kind of method of ethyl acetate content in raising white spirit original wine | |
| CN103305442A (en) | Acetobacter pasteurianus and application thereof | |
| JP5967607B2 (en) | Yeast and method for producing fermented food and drink | |
| CN102876592A (en) | Pichia anomala | |
| CN104404016A (en) | Naringinase production method | |
| CN108795771B (en) | Musk mould strain and perfume prepared from same | |
| CN112522120B (en) | Non-saccharomyces cerevisiae hsmt-1 and application thereof | |
| CN109749962A (en) | One plant of tolerance is strong, produces acid high Shanxi mature vinegar advantage original inhabitants' flavor plant lactobacillus and application | |
| CN113337432B (en) | Methylophilus for producing pyrroloquinoline quinone and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |