CN109022227A - A kind of method of ethyl acetate content in raising white spirit original wine - Google Patents
A kind of method of ethyl acetate content in raising white spirit original wine Download PDFInfo
- Publication number
- CN109022227A CN109022227A CN201810808047.9A CN201810808047A CN109022227A CN 109022227 A CN109022227 A CN 109022227A CN 201810808047 A CN201810808047 A CN 201810808047A CN 109022227 A CN109022227 A CN 109022227A
- Authority
- CN
- China
- Prior art keywords
- ester
- ethyl acetate
- grain
- acetate content
- producing yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of methods of ethyl acetate content in raising white spirit original wine, comprising: the separation of saccharomycete；The screening of ester-producing yeast；Ester-producing yeast bacterium produces the fragrant grain of ethyl acetate；It produces the fragrant grain of ester and is applied to four steps of brewed spirit.It is waste products after brewed spirit that it is raw materials used that fragrant grain is prepared in the present invention, which is not necessarily to the secondary investment of fund, be easy to get to；It makes full use of and loses the ethyl acetate blending liquid that grain produces pure biofermentation, the baste is added in pond fermented grain out again and is distilled, to achieve the purpose that improve ethyl acetate content in former wine, this method is easy to operate, it is with short production cycle, and abandon vinasse and be in germ-free condition using preceding, reduce the link to sterilize again, saves the energy；Using former wine produced by the invention, ethyl acetate fragrance is naturally strong, and wine soma is coordinated only, quality be improved significantly；The recycling to waste may be implemented, and production process does not generate additional waste water, meets energy conservation and environmental protection requirement.
Description
Technical field
The present invention relates to brewed spirit fields, and in particular to a method of improve ethyl acetate content in white spirit original wine.
Background technique
Micro constitutent in China white wine mainly has acids, esters, aldehydes, alcohols and minimal amount of sulfur-bearing organic compound
Object.Esters are the important components of China white wine fragrance.In white wine, in addition to ethanol and water, the content of ester accounts for third position.Faint scent
In type white wine, ethyl acetate and content of ethyl lactate summation account for 90% of total ester content or more, wherein ethyl acetate content highest,
Content of ethyl lactate takes second place.The absolute content and their quantity relative ratio relationship of ethyl acetate and ethyl lactate are to fen-flavor type white spirit
Style and features have a great impact.Fruit perfume is presented in ethyl acetate, and odor characteristics are obvious, and volatile, its content in wine is high,
Threshold value is low；And ethyl lactate boiling point is higher, if its too high levels or be more than ethyl acetate content so that the volatilization of ethyl acetate
Property reduce, ethyl acetate fragrance feature outstanding will receive inhibition in wine body, and the rear taste of wine can have a degree of puckery hardship
Sense.But in production, due to being influenced by various factors, it is relatively low often to there is ethyl acetate content in the former wine distilled out
The problem of, directly affect the quality of former wine.
Vinasse as the by-product during brewed spirit, while being also waste, mostly make at present as animal feed
With.But starch, protein and a variety of metabolites from microbial fermentation in vinasse also containing a large amount of remnants, these
Ingredient is not fully utilized.Vinasse are added ferment wine brewing again after distiller's yeast by part delicate fragrance type brewery, but this method consumes
When it is laborious, and the Quality of Liquors and yield that distill out are poor, lose more than gain.
In conclusion there is an urgent need to a kind of simple and fast methods to solve to distill out in fen-flavor type white spirit brewing process
The relatively low problem of former wine ethyl acetate content, and then improve fragrance and quality in former wine.
Summary of the invention
Based on above-mentioned technical problem, the object of the invention provides a kind of method for improving ethyl acetate content in white spirit original wine.
Purebred ester-producing yeast is accessed to produce high ethyl acetate content to abandon vinasse as culture substrate from actual production for starting point
Perfume grain, the blending liquid containing high-concentration acetic acid ethyl ester is obtained by distillation, then the blending solution is uniformly sprayed in fermented grain
It is distilled, is dissolved into the ethyl acetate in blending liquid in former wine naturally, ethyl acetate content in white wine is relatively low, second to solve
The problem of newborn proportional imbalance, achievees the purpose that improve white wine quality.
The method of ethyl acetate content, includes the following steps: in a kind of raising white spirit original wine
(1) separation of saccharomycete
5g cattle pen mountain delicate fragrance type fermented grain is weighed, is placed in the triangular flask equipped with 45mL sterile water and a small amount of bead, 20 DEG C,
Shaking table vibrates 20min under the conditions of 140r/min, and the bacteria suspension containing microorganism is made, this bacteria suspension concentration is 10-1；
It draws the above-mentioned 1. middle bacteria suspension of 1mL to be placed in the test tube for containing 9mL sterile water, being configured to concentration is 10-2Bacterium it is outstanding
Liquid, being successively diluted to concentration by this method is 10-3、10-4、10-5、10-6Bacteria suspension.Drawing 0.1mL concentration gradient respectively is 10-5、10-6Bacteria suspension to being coated culture in the plate containing YPD culture medium, it is to be generated to grow in 30 DEG C of CMC model 72h
Independent yeast colony；
Switching cross respectively with the different saccharomycete bacterium colony of colonial morphology in the above-mentioned 2. plate of transfer needle picking in new YPD
72h, which is cultivated, in plate, under the conditions of being placed in 30 DEG C forms saccharomycete single colonie.
(2) screening of ester-producing yeast:
1. the preparation of 8 ° of Bx malt juice liquid mediums: taking the new sweet wort of brewery, be down to 8 ° of Bx using saccharimeter, be sub-packed in
In 500mL triangular flask, per bottled 300mL, 115 DEG C of sterilizing 30min are cooled down spare；
2. 1~2 ring above-mentioned steps (1) of oese pickingIn the different saccharomycete single colonie of form, and number is respectively
Y001, Y002, Y003, and be inoculated in equipped in above-mentioned 8 ° of Bx malt juice liquid mediums, 30 DEG C of stationary culture 72h make
At saccharomycetes to make fermentation liquid；
3. 200mL water is added in the saccharomycetes to make fermentation liquid in absorption 200mL above-mentioned steps (2) 2., distillation obtains 200mL distillate,
Utilize ethyl acetate content in gas Chromatographic Determination distillate；
4. filtering out the highest saccharomycete of ester producing capacity according to ethyl acetate content, the strongest yeast of ester producing capacity is filtered out
Bacterium is Y002, ester producing capacity 478.51mg/L.
(3) the fragrant grain of ester-producing yeast bacterium production ethyl acetate；
1. the preparation of ester-producing yeast bacteria liquid seed culture medium: fresh grain stillage being mixed with water 1:5 in mass ratio, stands filtering for 24 hours
Filtrate, add 0.5% yeast extract, 1% glucose, 1% peptone, 5.5,115 DEG C of sterilizing 30min of PH cool down spare；
2. the 4. pure bacterium colony of ester-producing yeast bacterium that two ring step (2) of picking is screened, is inoculated in the ester-producing yeast liquid of above-mentioned steps (3) 1.
In body seed culture medium, shaking table (140r/min) cultivates 72h under the conditions of 30 DEG C, is fabricated to liquid seeds suspension；
The discarding vinasse of fresh clear stubble of steaming in clear soup are taken to be sent into 20~30 DEG C of spreading-and-cooling machine spreading for cooling, during spreading-and-cooling machine spreading for cooling
Even sprinkling above-mentioned steps (3) edible ethanol that 2. the middle ester-producing yeast liquid seeds suspension prepared and alcohol concentration are 95% voL,
Then loose the pouring into ground cylinder of vinasse will be abandoned to cultivate, intermediate there are ventholes, enter 20~30 DEG C of cylinder temperature, incubation time 72
~96h is that the fragrant grain culture of production ester is mature when vinasse generate strong ethyl acetate fragrance；
(4) it produces the fragrant grain of ester and is applied to brewed spirit
By above-mentioned steps (3)The fragrant grain of mature production ester is cultivated, the loose uniform steaming bucket that is packed into carries out steam distillation, through condensing
It is collected after device condensation and obtains the blending liquid containing high-concentration acetic acid ethyl ester, which is uniformly sprayed onto the fermented grain in normal pond out
In, then will be distilled in the loading steaming bucket of pond fermented grain uniform loose out, ethyl acetate content obviously increases in the former wine of distillation, and ester
Fragrant naturally strong, wine body is plentiful.
In wine-making technology of the present invention, saccharomycete happiness is grown under the environment of meta-acid humidity.And cattle pen mountain fen-flavor type white spirit
Vinasse PH<5.0, moisture>65%, containing the abundant nutrition substance for meeting Yeast Growth, ester-producing yeast can be by acetic acid and ethyl alcohol
Ethyl acetate is generated by esterification, contains the organic acids such as suitable acetic acid, lactic acid in vinasse, provides conjunction for ester-producing yeast
At precursor substance.
Advantages of the present invention are as follows: it is waste products after brewed spirit, the raw material that the fragrant grain of preparation is raw materials used in the present invention
Without the secondary investment of fund, it is easy to get to being the first-class culture substrate of culture yeasts bacterium；The present invention, which makes full use of, loses the pure life of grain production
The ethyl acetate blending liquid of object fermentation, then the baste is added in pond fermented grain out and is distilled, to reach raising former wine
The purpose of middle ethyl acetate content, this method is easy to operate, with short production cycle, and abandons vinasse and be in sterile using preceding
State reduces the link to sterilize again, has saved the energy；Using former wine produced by the invention, ethyl acetate fragrance is naturally dense
Strongly fragrant, wine soma is coordinated only, quality be improved significantly；The recycling to waste may be implemented in the present invention, and production process is not
Additional waste water is generated, energy conservation and environmental protection requirement is met.
Detailed description of the invention
Fig. 1 passes through blast software for type strain and ester-producing yeast bacterium Y002 comparing result figure.
Specific embodiment
Embodiment 1
In order to improve the ethyl acetate content in former wine, former wine quality is promoted, experiment utilizes discarding vinasse culture ester-producing yeast
Y002 prepares the perfume grain containing ethyl acetate by microbial metabolism, then by fragrant grain distillation, obtains the ethyl acetate tune of high concentration
Fragrant liquid, then the blending liquid, which is uniformly sprayed in fermented grain, is distilled, so that the ethyl acetate in blending liquid is fused in former wine.
The specific method is as follows:
(1) separation of saccharomycete
5g cattle pen mountain delicate fragrance type fermented grain is weighed, is placed in the triangular flask equipped with 45mL sterile water and a small amount of bead, 20 DEG C,
Shaking table vibrates 20min under the conditions of 140r/min, and the bacteria suspension containing microorganism is made, this bacteria suspension concentration is 10-1；Draw 1mL
Concentration is 10-1Bacteria suspension is placed in the test tube for containing 9mL sterile water, and being configured to concentration is 10-2Bacteria suspension, successively by this method
Being diluted to concentration is 10-3、10-4、10-5、10-6Bacteria suspension, respectively draw 0.1mL concentration gradient be 10-5、10-6Bacteria suspension
It is to be generated to grow independent yeast colony in 30 DEG C of CMC model 72h to being coated culture in the plate containing YPD culture medium
?；Switching of being crossed respectively with the different saccharomycete bacterium colony of colonial morphology in the above-mentioned YPD plate of transfer needle picking is flat in new YPD
72h, which is cultivated, in plate, under the conditions of being placed in 30 DEG C forms saccharomycete single colonie.
(2) screening of ester-producing yeast
The preparation of 8 ° of Bx malt juice liquid mediums: taking the new sweet wort of brewery, is down to 8 ° of Bx using saccharimeter, is sub-packed in
In 500mL triangular flask, per bottled 300mL, 115 DEG C of sterilizing 30min are cooled down spare；1~2 ring above-mentioned steps (1) of oese picking
The different saccharomycete single colonie of isolated form is inoculated in equipped in above-mentioned 8 ° of Bx malt juice liquid mediums, and 30 DEG C of standings are trained
72h is supported, saccharomycetes to make fermentation liquid is made；The above-mentioned manufactured saccharomycetes to make fermentation liquid of 200mL is drawn, 200mL water is added, distillation obtains
200mL distillate utilizes ethyl acetate content in gas Chromatographic Determination distillate；Filtering out number according to ethyl acetate content is
The ester-producing yeast bacterium of Y002 is the highest saccharomycete of ester producing capacity；
(3) the fragrant grain of ester-producing yeast bacterium production ethyl acetate
The preparation of ester-producing yeast bacteria liquid seed culture medium: fresh grain stillage is mixed with water 1:5 in mass ratio, is stood for 24 hours, is filtered
Filtrate, adds 0.5% yeast extract, 1% glucose, 1% peptone, and 5.5,115 DEG C of sterilizing 30min of PH are cooled down spare；Picking two
The pure bacterium colony of ester-producing yeast bacterium Y002 of ring step (2) screening, is inoculated in above-mentioned configured ester-producing yeast liquid seed culture medium
In, shaking table (140r/min) cultivates 72h under the conditions of 30 DEG C, is fabricated to ester-producing yeast liquid seeds suspension；Take fresh clear stubble of steaming in clear soup
Discarding vinasse be sent into 20 DEG C of spreading-and-cooling machine spreading for cooling, uniformly sprayed during spreading-and-cooling machine spreading for cooling above-mentioned steps preparation production ester ferment
The edible ethanol that female Y002 liquid seeds suspension and alcohol concentration are 95% voL, wherein ester-producing yeast Y002 liquid seeds suspension
Additive amount be lose poor quality 2%；The usage amount of the edible ethanol of 95% voL is lose poor quality 4%；Then vinasse will be abandoned
Loose pouring into ground cylinder is cultivated, and intermediate there are ventholes, enters 20 DEG C of cylinder temperature, incubation time 96h is generated strong to vinasse
It is that the fragrant grain culture of production ester is mature when ethyl acetate fragrance；
(4) it produces the fragrant grain of ester and is applied to brewed spirit
By the fragrant grain of the mature production ester of step (3) culture, the loose uniform steaming bucket that is packed into carries out steam distillation, after condenser condenses
Collection obtains the blending liquid containing high-concentration acetic acid ethyl ester, which is uniformly sprayed onto the normal fermented grain in pond out, then will
It is distilled in the loading steaming bucket of pond fermented grain uniform loose out, ethyl acetate content obviously increases in the former wine of distillation, and ester is fragrant natural
Strong, wine body is plentiful.
Embodiment 1 has carried out 2 times, is experiment 1 and experiment 2 respectively, and set up control group.Can be apparent from table 1
Find out, the ethyl acetate content in experimental group former wine has significant improvement compared with the control group, this illustrates the work of blending liquid
With obvious.
Embodiment 2
In order to improve the ethyl acetate content in former wine, former wine quality is promoted, experiment utilizes discarding vinasse culture ester-producing yeast
Y002 prepares the perfume grain containing ethyl acetate by microbial metabolism, then by fragrant grain distillation, obtains the ethyl acetate tune of high concentration
Fragrant liquid, then the blending liquid, which is uniformly sprayed in fermented grain, is distilled, so that the ethyl acetate in blending liquid is fused in former wine.
The specific method is as follows:
(1) separation of saccharomycete
5g cattle pen mountain delicate fragrance type fermented grain is weighed, is placed in the triangular flask equipped with 45mL sterile water and a small amount of bead, 20 DEG C,
Shaking table vibrates 20min under the conditions of 140r/min, and the bacteria suspension containing microorganism is made, this bacteria suspension concentration is 10-1；Draw 1mL
Concentration is 10-1Bacteria suspension is placed in the test tube for containing 9mL sterile water, and being configured to concentration is 10-2Bacteria suspension, successively by this method
Being diluted to concentration is 10-3、10-4、10-5、10-6Bacteria suspension, respectively draw 0.1mL concentration gradient be 10-5、10-6Bacteria suspension
It is to be generated to grow independent yeast colony in 30 DEG C of CMC model 72h to being coated culture in the plate containing YPD culture medium
?；Switching of being crossed respectively with the different saccharomycete bacterium colony of colonial morphology in the above-mentioned YPD plate of transfer needle picking is flat in new YPD
72h, which is cultivated, in plate, under the conditions of being placed in 30 DEG C forms saccharomycete single colonie.
(2) screening of ester-producing yeast
The preparation of 8 ° of Bx malt juice liquid mediums: taking the new sweet wort of brewery, is down to 8 ° of Bx using saccharimeter, is sub-packed in
In 500mL triangular flask, per bottled 300mL, 115 DEG C of sterilizing 30min are cooled down spare；1~2 ring above-mentioned steps (1) of oese picking
The different saccharomycete single colonie of isolated form is inoculated in equipped in above-mentioned 8 ° of Bx malt juice liquid mediums, and 30 DEG C of standings are trained
72h is supported, saccharomycetes to make fermentation liquid is made；The above-mentioned manufactured saccharomycetes to make fermentation liquid of 200mL is drawn, 200mL water is added, distillation obtains
200mL distillate utilizes ethyl acetate content in gas Chromatographic Determination distillate；Filtering out number according to ethyl acetate content is
The ester-producing yeast bacterium of Y002 is the highest saccharomycete of ester producing capacity；
(3) the fragrant grain of ester-producing yeast bacterium production ethyl acetate
The preparation of ester-producing yeast bacteria liquid seed culture medium: fresh grain stillage is mixed with water 1:5 in mass ratio, is stood for 24 hours, is filtered
Filtrate, adds 0.5% yeast extract, 1% glucose, 1% peptone, and 5.5,115 DEG C of sterilizing 30min of PH are cooled down spare；Picking two
The pure bacterium colony of ester-producing yeast bacterium Y002 of ring step (2) screening, is inoculated in above-mentioned configured ester-producing yeast liquid seed culture medium
In, shaking table (140r/min) cultivates 72h under the conditions of 30 DEG C, is fabricated to ester-producing yeast liquid seeds suspension；Take fresh clear stubble of steaming in clear soup
Discarding vinasse be sent into 26 DEG C of spreading-and-cooling machine spreading for cooling, uniformly sprayed during spreading-and-cooling machine spreading for cooling above-mentioned steps preparation production ester ferment
The edible ethanol that female Y002 liquid seeds suspension and alcohol concentration are 95% voL, wherein ester-producing yeast Y002 liquid seeds suspension
Additive amount be lose poor quality 2%；The usage amount of the edible ethanol of 95% voL is lose poor quality 4%；Then vinasse will be abandoned
Loose pouring into ground cylinder is cultivated, and intermediate there are ventholes, enters 26 DEG C of cylinder temperature, incubation time 72h is generated strong to vinasse
It is that the fragrant grain culture of production ester is mature when ethyl acetate fragrance；
(4) it produces the fragrant grain of ester and is applied to brewed spirit
By the fragrant grain of the mature production ester of step (3) culture, the loose uniform steaming bucket that is packed into carries out steam distillation, after condenser condenses
Collection obtains the blending liquid containing high-concentration acetic acid ethyl ester, which is uniformly sprayed onto the normal fermented grain in pond out, then will
It is distilled in the loading steaming bucket of pond fermented grain uniform loose out, ethyl acetate content obviously increases in the former wine of distillation, and ester is fragrant natural
Strong, wine body is plentiful.
Embodiment 2 has carried out 2 times, is experiment 3 and experiment 4 respectively, and set up control group.Can be apparent from table 1
Find out, the ethyl acetate content in experimental group former wine has significant improvement compared with the control group, this illustrates the work of blending liquid
With obvious.
Embodiment 3
In order to improve the ethyl acetate content in former wine, former wine quality is promoted, experiment utilizes discarding vinasse culture ester-producing yeast
Y002 prepares the perfume grain containing ethyl acetate by microbial metabolism, then by fragrant grain distillation, obtains the ethyl acetate tune of high concentration
Fragrant liquid, then the blending liquid, which is uniformly sprayed in fermented grain, is distilled, so that the ethyl acetate in blending liquid is fused in former wine.
The specific method is as follows:
(1) separation of saccharomycete
5g cattle pen mountain delicate fragrance type fermented grain is weighed, is placed in the triangular flask equipped with 45mL sterile water and a small amount of bead, 20 DEG C,
Shaking table vibrates 20min under the conditions of 140r/min, and the bacteria suspension containing microorganism is made, this bacteria suspension concentration is 10-1；Draw 1mL
Concentration is 10-1Bacteria suspension is placed in the test tube for containing 9mL sterile water, and being configured to concentration is 10-2Bacteria suspension, successively by this method
Being diluted to concentration is 10-3、10-4、10-5、10-6Bacteria suspension, respectively draw 0.1mL concentration gradient be 10-5、10-6Bacteria suspension
It is to be generated to grow independent yeast colony in 30 DEG C of CMC model 72h to being coated culture in the plate containing YPD culture medium
?；Switching of being crossed respectively with the different saccharomycete bacterium colony of colonial morphology in the above-mentioned YPD plate of transfer needle picking is flat in new YPD
72h, which is cultivated, in plate, under the conditions of being placed in 30 DEG C forms saccharomycete single colonie.
(2) screening of ester-producing yeast
The preparation of 8 ° of Bx malt juice liquid mediums: taking the new sweet wort of brewery, is down to 8 ° of Bx using saccharimeter, is sub-packed in
In 500mL triangular flask, per bottled 300mL, 115 DEG C of sterilizing 30min are cooled down spare；1~2 ring above-mentioned steps (1) of oese picking
The different saccharomycete single colonie of isolated form is inoculated in equipped in above-mentioned 8 ° of Bx malt juice liquid mediums, and 30 DEG C of standings are trained
72h is supported, saccharomycetes to make fermentation liquid is made；The above-mentioned manufactured saccharomycetes to make fermentation liquid of 200mL is drawn, 200mL water is added, distillation obtains
200mL distillate utilizes ethyl acetate content in gas Chromatographic Determination distillate；Filtering out number according to ethyl acetate content is
The ester-producing yeast bacterium of Y002 is the highest saccharomycete of ester producing capacity；
(3) the fragrant grain of ester-producing yeast bacterium production ethyl acetate
The preparation of ester-producing yeast bacteria liquid seed culture medium: fresh grain stillage is mixed with water 1:5 in mass ratio, is stood for 24 hours, is filtered
Filtrate, adds 0.5% yeast extract, 1% glucose, 1% peptone, and 5.5,115 DEG C of sterilizing 30min of PH are cooled down spare；Picking two
The pure bacterium colony of ester-producing yeast bacterium Y002 of ring step (2) screening, is inoculated in above-mentioned configured ester-producing yeast liquid seed culture medium
In, shaking table (140r/min) cultivates 72h under the conditions of 30 DEG C, is fabricated to ester-producing yeast liquid seeds suspension；Take fresh clear stubble of steaming in clear soup
Discarding vinasse be sent into 30 DEG C of spreading-and-cooling machine spreading for cooling, uniformly sprayed during spreading-and-cooling machine spreading for cooling above-mentioned steps preparation production ester ferment
The edible ethanol that female Y002 liquid seeds suspension and alcohol concentration are 95% voL, wherein ester-producing yeast Y002 liquid seeds suspension
Additive amount be lose poor quality 2%；The usage amount of the edible ethanol of 95% voL is lose poor quality 4%；Then vinasse will be abandoned
Loose pouring into ground cylinder is cultivated, and intermediate there are ventholes, enters 30 DEG C of cylinder temperature, incubation time 48h is generated strong to vinasse
It is that the fragrant grain culture of production ester is mature when ethyl acetate fragrance；
(4) it produces the fragrant grain of ester and is applied to brewed spirit
By the fragrant grain of the mature production ester of step (3) culture, the loose uniform steaming bucket that is packed into carries out steam distillation, after condenser condenses
Collection obtains the blending liquid containing high-concentration acetic acid ethyl ester, which is uniformly sprayed onto the normal fermented grain in pond out, then will
It is distilled in the loading steaming bucket of pond fermented grain uniform loose out, ethyl acetate content obviously increases in the former wine of distillation, and ester is fragrant natural
Strong, wine body is plentiful.
Embodiment 3 has carried out 2 times, is experiment 5 and experiment 6 respectively, and set up control group.Can be apparent from table 1
Find out, the ethyl acetate content in experimental group former wine has significant improvement compared with the control group, this illustrates the work of blending liquid
With obvious.
Embodiment 4
The sensory evaluation of former wine
The former wine sensory evaluation of the method for the present invention preparation, is by several advanced tasters respectively to experimental group and control group former wine sample
It is secretly commented, finally summarizes to obtain the synthesis comment in table 2, former wine has been defined the level secondary sequence :+2 grades of > of -1 grade of 1 grade of >, 2 grades of > >.
As can be seen from Table 2, experimental group former wine ethyl acetate is fragrant obvious, and entrance sweet tea, pleasant impression is long, and quality is all better than control
Group especially tests 2 and experiment 3, occurs significantly returning sweet tea sense, it is determined as -1 grade；And in control group, ethyl acetate perfume (or spice) degree is weaker than reality
Test group, and wine body is miscellaneous and the micro- aobvious hardship of tail taste；Comparison discovery, the sense organ comment of experimental group former wine are better than control group, illustrate to use second
Ester blending liquid, can promote former wine quality.
Embodiment 5
The molecular biology identification of ester-producing yeast Y002
(1) it with oese from a small amount of bacterium colony of picking (ring) on the inclined-plane YPD of the Y002 yeast strain newly activated, is placed in and has sterilized
1.5mL centrifuge tube in；
(2) 100 μ L lysates are added into the centrifuge tube, and (100mM Tris, 30mMEDTA, 0.5% SDS, pH 8.0,15P goes out
Bacterium 30 minutes are spare), 100 DEG C water-bath 15 minutes；
(3) after adding the potassium acetate of 100 μ L 2.5M, 30 minutes to one hours on ice are placed in；At 4 DEG C 13000rpm from
After five minutes, Aspirate supernatant moves in a new 1.5mL centrifuge tube heart；
(6) isometric chloroform-isoamyl alcohol (24:1) is added into the centrifuge tube equipped with supernatant, acutely after concussion,
13000rpm is centrifuged 15 minutes, is pipetted in supernatant to the centrifuge tube of the 1.5mL of another sterilizing again；
(7) previous step is repeated to move to supernatant in the centrifuge tube of the 0.5mL of another sterilizing until not precipitating between two-phase；
(8) isometric cold isopropanol is added, is placed at -20 DEG C and stands 15 minutes, 13000rpm is centrifuged 15 minutes；
(9) it is precipitated with the ethanol washing of 100 μ L70%, washs precipitating again with the ethyl alcohol of 100 μ L 100%；
(10) precipitating is placed in vacuum desiccator and drains or spontaneously dries；
(11) the sterilized MiLi-Q water of 50 μ L is added, is dissolved two hours at 4 DEG C；
(12) resulting PCR amplification stoste is delivered into sequencing company, by PCR Purification Kit(Biomed company)
After purification and recovery, pass through automatic sequencer (377 DNA Sequencer, ABI PRISM of ABI PRISM, 3100 Genetic
AnaLyzer the original series of strains tested pcr amplified fragment) are obtained.
(13) manual correction is carried out to DNA sequence dna with DNA Star software and in conjunction with DNA forward and reverse sequence map.
(14) by the sequence after correction in international nucleic acid database (http://www.ncbi.nLm.nih.gov/
BLast), Yeast GenBank (http://www.cbs.knaw.nL/CoLLections/) and online sequence analyze work
Tool
The search comparison that homologous sequence is carried out in zTaxon, can obtain with bacterial strain to be identified the affiliation phase in this section of sequence
Known kind close of relevant information, including the base difference with known kind of type strain in this section of sequence, it is known that kind mode bacterium
The MBL/DDBJ/GenBank sequence number of strain.
The part 6S ribosomes sequence that first sequence is type strain Wickerhamomyces anomalus DQ-21；
Second sequence is the part 26S ribosomes sequence of ester-producing yeast bacterium Y002 made from the method for the present invention, and the sequence in figure is logical
Blast software is crossed to compare two sequences to confirm that our this plant of bacterium is Wickerhamomyces anomalus
The part 6S ribosomes sequence Wickerhamomyces of type strain Wickerhamomyces anomalus DQ-21
anomalus strain DQ-21 26S ribosomal RNA gene, partialsequence TCAAAGGGCATTGCT
CAGTACGGCGAGTGAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGG
TAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATG
CCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCT
AAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGT
GAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGA
GTTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCG
GTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAAT
GATCTA ATGCCGCCCGTCTTGAACCACGGACCA
The part 26S ribosomes sequence Y002 strain of ester-producing yeast bacterium Y002
GCTCAGTACGGCGAGTGAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTG
AAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGA
TGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAAT
TCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAA
AGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTC
TTCTTGAGCTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTT
CACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTG
GCGTAATGATCTAATGCCGCCCGTCTTGA
The gene order of type strain and ester-producing yeast bacterium Y002 is compared by blast software, the results show that the two
In detail to being 99%.
Claims (6)
1. a kind of method for improving ethyl acetate content in white spirit original wine, includes the following steps:
(1) separation of saccharomycete；
(2) screening of ester-producing yeast；
(3) the fragrant grain of ester-producing yeast bacterium production ethyl acetate；
(4) it produces the fragrant grain of ester and is applied to brewed spirit.
2. a kind of method for improving ethyl acetate content in white spirit original wine according to claim 1, which is characterized in that described
The separation of saccharomycete include the following steps:
5g cattle pen mountain delicate fragrance type fermented grain is weighed, is placed in the triangular flask equipped with 45mL sterile water and a small amount of bead, 20 DEG C,
Shaking table vibrates 20min under the conditions of 140r/min, and the bacteria suspension containing microorganism is made, this bacteria suspension concentration is 10-1；
It draws the above-mentioned 1. middle bacteria suspension of 1mL to be placed in the test tube for containing 9mL sterile water, being configured to concentration is 10-2Bacteria suspension,
Successively being diluted to concentration by this method is 10-3、10-4、10-5、10-6Bacteria suspension, respectively draw 0.1mL concentration gradient be 10-5、10-6Bacteria suspension to being coated culture in the plate containing YPD culture medium, in 30 DEG C of CMC model 72h, it is to be generated grow it is independent
Yeast colony；
Switching of being crossed respectively with the different saccharomycete bacterium colony of colonial morphology in the above-mentioned 2. plate of transfer needle picking is flat in new YPD
48~72h, which is cultivated, in plate, under the conditions of being placed in 28~30 DEG C forms saccharomycete single colonie.
3. a kind of method for improving ethyl acetate content in white spirit original wine according to claim 1, which is characterized in that described
The screening of ester-producing yeast include the following steps:
1. the preparation of 8 ° of Bx malt juice liquid mediums: taking the new sweet wort of brewery, be down to 8 ° of Bx using saccharimeter, be sub-packed in
In 500mL triangular flask, per bottled 300mL, 115 DEG C of sterilizing 30min are cooled down spare；
2. 1~2 ring of oese picking step as claimed in claim 2In the different saccharomycete single colonie of form, and respectively
Number is Y001, Y002, Y003, and is inoculated in equipped in above-mentioned 8 ° of Bx malt juice liquid mediums, 30 DEG C of stationary cultures
Saccharomycetes to make fermentation liquid is made in 72h；
3. draw 200mL step 2. in saccharomycetes to make fermentation liquid, be added 200mL water, distillation obtain 200mL distillate, utilize gas
Ethyl acetate content in phase chromatographic determination distillate；
4. filtering out the highest saccharomycete of ester producing capacity according to ethyl acetate content, the strongest production ester of ester producing capacity is filtered out
Saccharomycete.
4. a kind of method for improving ethyl acetate content in white spirit original wine according to claim 1, which is characterized in that described
Ester-producing yeast bacterium production ethyl acetate perfume (or spice) grain include the following steps:
1. the preparation of ester-producing yeast bacteria liquid seed culture medium: fresh grain stillage being mixed with water 1:5 in mass ratio, stands filtering for 24 hours
Filtrate, add 0.5% yeast extract, 1% glucose, 1% peptone, 5.5,115 DEG C of sterilizing 30min of PH cool down spare；
2. two ring step right of the picking pure bacterium colony of ester-producing yeast bacterium that as required 4. step described in 2 is screened, be inoculated in it is above-mentioned 1.
Ester-producing yeast liquid seed culture medium in, shaking table (140r/min) cultivates 72h under the conditions of 30 DEG C, and it is outstanding to be fabricated to liquid seeds
Liquid；
The discarding vinasse of fresh clear stubble of steaming in clear soup are taken to be sent into 20~30 DEG C of spreading-and-cooling machine spreading for cooling, during spreading-and-cooling machine spreading for cooling uniformly
The above-mentioned steps edible ethanol that 2. the middle ester-producing yeast liquid seeds suspension prepared and alcohol concentration are 95% voL is sprayed, then
Loose the pouring into ground cylinder of vinasse will be abandoned to cultivate, it is intermediate there are venthole, enter 20~30 DEG C of cylinder temperature, incubation time 72~
96h is that the fragrant grain culture of production ester is mature when vinasse generate strong ethyl acetate fragrance.
5. a kind of method for improving ethyl acetate content in white spirit original wine according to claim 1, which is characterized in that described
The fragrant grain of production ester include the following steps: applied to brewed spirit
By above-mentioned steps step as claimed in claim 4The fragrant grain of mature production ester is cultivated, the loose uniform steaming bucket that is packed into carries out
Steam distillation is collected after condenser condenses and obtains the blending liquid containing high-concentration acetic acid ethyl ester, which is uniformly sprayed
Into the normal fermented grain in pond out, then will be distilled in the loading steaming bucket of pond fermented grain uniform loose out.
6. a kind of method for improving ethyl acetate content in white spirit original wine according to claim 1 or 3, which is characterized in that
The ester-producing yeast bacterium Y002 ester producing capacity is 478.51mg/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810808047.9A CN109022227A (en) | 2018-07-22 | 2018-07-22 | A kind of method of ethyl acetate content in raising white spirit original wine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810808047.9A CN109022227A (en) | 2018-07-22 | 2018-07-22 | A kind of method of ethyl acetate content in raising white spirit original wine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109022227A true CN109022227A (en) | 2018-12-18 |
Family
ID=64644051
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810808047.9A Pending CN109022227A (en) | 2018-07-22 | 2018-07-22 | A kind of method of ethyl acetate content in raising white spirit original wine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109022227A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112522057A (en) * | 2020-12-11 | 2021-03-19 | 宜宾五粮液股份有限公司 | Method for reducing ethyl acetate in white spirit |
| CN113308317A (en) * | 2021-04-22 | 2021-08-27 | 山东金彩山酒业有限公司 | Method for increasing content of ethyl hexanoate in fermented grains of Luzhou-flavor liquor |
| CN113502301A (en) * | 2021-08-26 | 2021-10-15 | 泸州老窖股份有限公司 | Method for increasing yield of ethanol prepared from distilled spirit distiller grains |
| CN115109674A (en) * | 2022-06-07 | 2022-09-27 | 四川大学 | Method for reducing content of higher alcohol in fen-flavor Xiaoqu liquor and extracting ester and enhancing flavor |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807582A (en) * | 2005-09-19 | 2006-07-26 | 中国贵州茅台酒厂有限责任公司 | Saccharomyces cerevisiae engineered yeast and its uses |
| CN103232946A (en) * | 2013-05-22 | 2013-08-07 | 湖北工业大学 | High-tolerance ester-producing yeast strain and application thereof |
| CN105039076A (en) * | 2015-07-24 | 2015-11-11 | 天地缘酒业有限公司 | Fen-flavor liquor second-batch distiller grain refermentation technology |
| CN105349444A (en) * | 2015-11-27 | 2016-02-24 | 四川理工学院 | Saccharomycete for high-yield production of ethyl acetate under low temperature and application thereof |
-
2018
- 2018-07-22 CN CN201810808047.9A patent/CN109022227A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807582A (en) * | 2005-09-19 | 2006-07-26 | 中国贵州茅台酒厂有限责任公司 | Saccharomyces cerevisiae engineered yeast and its uses |
| CN103232946A (en) * | 2013-05-22 | 2013-08-07 | 湖北工业大学 | High-tolerance ester-producing yeast strain and application thereof |
| CN105039076A (en) * | 2015-07-24 | 2015-11-11 | 天地缘酒业有限公司 | Fen-flavor liquor second-batch distiller grain refermentation technology |
| CN105349444A (en) * | 2015-11-27 | 2016-02-24 | 四川理工学院 | Saccharomycete for high-yield production of ethyl acetate under low temperature and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 王勇: "牛栏山酒厂优良酿酒酵母的筛选及鉴定", 《酿酒科技》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112522057A (en) * | 2020-12-11 | 2021-03-19 | 宜宾五粮液股份有限公司 | Method for reducing ethyl acetate in white spirit |
| CN113308317A (en) * | 2021-04-22 | 2021-08-27 | 山东金彩山酒业有限公司 | Method for increasing content of ethyl hexanoate in fermented grains of Luzhou-flavor liquor |
| CN113502301A (en) * | 2021-08-26 | 2021-10-15 | 泸州老窖股份有限公司 | Method for increasing yield of ethanol prepared from distilled spirit distiller grains |
| CN115109674A (en) * | 2022-06-07 | 2022-09-27 | 四川大学 | Method for reducing content of higher alcohol in fen-flavor Xiaoqu liquor and extracting ester and enhancing flavor |
| CN115109674B (en) * | 2022-06-07 | 2023-07-21 | 四川大学 | Method for reducing content of higher alcohols in fen-flavor Xiaoqu liquor and extracting esters and enhancing flavor |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101445776B (en) | Method of preparing liquor seasoning wine or liquor seasoning liquid mainly to taste | |
| CN108239608B (en) | Torulaspora delbrueckii and application thereof in wine brewing | |
| CN109022227A (en) | A kind of method of ethyl acetate content in raising white spirit original wine | |
| CN101457190B (en) | Method for preparing spirit flavoring wine or spirit flavour liquid mainly with fragrance | |
| CN106978350B (en) | Aspergillus niger and application thereof in preparation of puerarin compounds | |
| CN106434125A (en) | Wine making multi-bacteria functional bacterial liquid, and production method and application thereof | |
| CN105802865B (en) | One plant height fermentation activity and the fragrant characteristic of production ice brewer yeast outstanding and its application | |
| CN110951629B (en) | Aroma-producing yeast with low alcohol yield as well as screening method and application thereof | |
| CN108949597B (en) | Saccharomyces cerevisiae KMLY1-2 and separation method and application thereof | |
| CN113717867B (en) | Pichia pastoris capable of producing no ethanol and application thereof | |
| CN116138429B (en) | Short Kazakhstan yeast XJ-65 and application thereof in pepper fermentation | |
| CN106591160A (en) | Compound Xiaoqu and Xiaoqu Baijiu production method | |
| CN105494715A (en) | Process for producing dark tea through inoculation method | |
| CN107164251A (en) | One Accharomyces cerevisiae and its purposes for improving grape wine Ester content | |
| CN109666616A (en) | The preparation method and the application in Shanxi mature vinegar production of high yield 3-hydroxy-2-butanone and flavouring Mo Haiwei bacillus throw type leaven | |
| CN115820432B (en) | Coriolus versicolor trametes versicolor producing strain and application thereof | |
| CN117229929A (en) | High-yield ester abnormal Wicks yeast and application thereof | |
| CN105670936B (en) | A kind of method of Trametes trogii bacterial strain and its application and Pu'er tea processing | |
| CN110218662A (en) | A kind of thermophilic low temperature produces fragrant characteristic U.S. pole plum surprise yeast outstanding and its application | |
| CN112694981B (en) | Candida zemplina strain YC32 of Candida zemplina and application thereof | |
| CN109913379A (en) | One plant height esterase active U.S. pole plum surprise yeast and its application in honey wine fermentation | |
| CN109666594A (en) | A method of using excellent indigenous high yield alcohol saccharomyces cerevisiae and producing abrotanum grass Candida strengthening digestion Shanxi mature vinegar | |
| CN110408555A (en) | One plant of Zygosaccharomyces FW30-2 and its application | |
| CN104561135B (en) | Method for producing aromatic substance by trichoderma reesei | |
| CN116836824B (en) | Candida elseta Y19 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181218 |
|
| RJ01 | Rejection of invention patent application after publication |