CN106039312A - Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation - Google Patents
Applications of ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation Download PDFInfo
- Publication number
- CN106039312A CN106039312A CN201610357423.8A CN201610357423A CN106039312A CN 106039312 A CN106039312 A CN 106039312A CN 201610357423 A CN201610357423 A CN 201610357423A CN 106039312 A CN106039312 A CN 106039312A
- Authority
- CN
- China
- Prior art keywords
- znf367
- gene
- breast cancer
- reagent
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Oncology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses applications of a ZNF367 gene in preparing medicines for treating breast cancer and reagents for realizing diagnosis and prognosis evaluation. The in vitro and vivo experimental result of the inventor proves that ZNF367 is highly expressed in the breast cancer tissue, and the survival analysis shows that the expression level of the ZNF367 gene is closely related to the staging and prognosis of breast cancer. Therefore, an inhibitor of the gene can be synthesized or prepared to be taken as the potential targeted medicine for breast cancer; the gene has DNA amplification and expression increase in the breast cancer, therefore, a kit for detecting the DNA variation and expression change of the gene can be prepared for diagnosing the breast cancer; the increase of the gene expression is related to the poor prognosis, and therefore, the kit for detecting the expression level change of the gene also can be used for prognosis evaluation thereof, so that the clinical treatment can be guided.
Description
Technical field
Present invention relates particularly to ZNF367 gene answering in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent
With.
Background technology
Malignant tumor is the disease that serious harm human life is healthy, China annual pathogenesis of cancer number about 3,070,000 people, and
Annual because of number about 2,200,000 people of cancer mortality.World Health Organization's 2012 " report of world's cancer " points out the new diagnosis of China
Cases of cancer is 3,070,000, accounts for the 21.8% of whole world sum；And year death toll 2,200,000, account for whole world cancer year death toll
26.9%.More seriously these data increase the most year by year.Malignant tumor has exceeded cardiovascular disease
For lethal first cause.Therefore, explore cancer occur Study on Molecular Mechanism and find its effective treatment means to the mankind be good for
Health is significant.
Breast carcinoma is world's second largest common cancer, and in female malignant, fatality rate ranks first, and the whole world is annual
There are nearly 1,300,000 women to suffer from breast carcinoma, and it is dead because of the transfer and relapse of breast carcinoma to have more than 400,000 women.Breast carcinoma
Being the tumor that a kind of heterogeneity is the strongest, different types of breast carcinoma can have dramatically different biological characteristics and clinical table
Existing.Therefore, the breast carcinoma to patient is classified the important component part become for determining therapeutic scheme.At present, clinical
On mainly apply immunohistochemical method, according to estrogen receptor (estrogen receptor, ER), progesterone receptor
(progesterone receptor, PR) and the testing result of HER-2, be divided into 4 kinds of molecular isoforms by breast carcinoma: luminal A
(the ER positive or the PR positive, HER-2 is the most positive for type (ER is positive or PR is positive, and HER-2 is negative, the low expression of Ki67), luminal Type B
Property), HER-2 process LAN type (ER, PR are negative, and HER-2 is positive, and Ki67 mostly is high expressed) and basal-like type (ER, PR,
HER-2 is all negative).
Although the breast carcinoma for different subtype has different therapeutic strategy, as the breast carcinoma for ER receptor positive can
To use the ER acceptor inhibitors such as tamoxifen, the breast carcinoma positive for HER2 can use the HER2 receptors such as Herceptin
Blocking antibody, can use the schemes such as combined chemotherapy for three cloudy breast carcinoma, but existing therapeutic strategy is not for swollen
The target spot of tumor relapse and metastasis, it is impossible to overcome clinical problem recurrence maximum in oncotherapy and transfer.
ZNF367 gene, full name zinc finger protein 367, at American National Biotechnology Information center
(NCBI) accession number of gene bank is Gene ID:195828, is positioned at No. 9 chromosome long arm 9q22 sites.ZNF367 is one
Transcription factor, it is known that it has important function in growth.But the effect that ZNF367 is in tumor, and whether can be as swollen
Tumor diagnoses and treatment target is not studied thoroughly the most yet.
Summary of the invention
It is an object of the invention to find markers for breast cancer ZNF367 gene, to distinguish the wind of breast cancer relapse and transfer
Danger, and as new therapy target.
The technical solution used in the present invention is:
The application in preparation treatment breast cancer medicines of the reagent of suppression ZNF367 gene expression or translation.
Preferably, the reagent of suppression ZNF367 gene expression or translation is ZNF367 gene promoter inhibitor, ZNF367
Genetic transcription inhibitor or ZNF367 protein synthesis inhibitor.
Preferably, dsRNA, ZNF367 gene that reagent is ZNF367 gene of ZNF367 gene expression or translation is suppressed
The shRNA of siRNA or ZNF367 gene.
Preferably, the shRNA portion of siRNA or the ZNF367 gene of dsRNA, ZNF367 gene of described ZNF367 gene
Point base lock nucleic acid is modified.
Make ZNF367 protein active reduce in vivo or the application treated in breast cancer medicines prepared by the reagent of inactivation.
Preferably, make in vivo ZNF367 protein active reduce or inactivation reagent selected from ZNF367 protein antibodies,
ZNF367 activity inhibitor.
Quantitatively the reagent of ZNF367 gene DNA amplification amount or expression as breast cancer diagnosis or prognosis evaluation reagent should
With.
Quantitatively the reagent of ZNF367 protein D NA amplification amount or expression as breast cancer diagnosis or prognosis evaluation reagent should
With.
A kind of breast cancer diagnosis or prognosis evaluation reagent, this reagent contains quantitative ZNF367 gene or the examination of expressing quantity
Agent.
The invention has the beneficial effects as follows:
The invention provides a kind of target gene ZNF367 for breast cancer diagnosis and treatment.The method utilizing bioinformatics is divided
Analysis mastocarcinoma gene expresses high flux data, and experiment in vitro (quantitative fluorescent PCR, SABC, Clone formation) result shows
ZNF367 is high expressed in breast cancer tissue, and survival analysis show the expression of ZNF367 gene and breast carcinoma by stages,
Prognosis is closely related.In addition experiment in vivo also shows that the expression of reticent ZNF367 gene can significantly inhibit the one-tenth tumor of breast carcinoma
And transfer ability.Two sections of hairpin RNAs (shRNA) of ZNF367 gene of present invention offer and the lock nucleic acid for ZNF367 gene
(LNA) sequence can be used for the medicine of preparation treatment breast cancer disease.Such as, the method using gene therapy, with plasmid or disease
Poison is expression vector so that it is in the expression of cancer site silence ZNF367.
Accompanying drawing explanation
Fig. 1, ZNF367 gene mRNA high expressed in breast cancer tissue and to difference prognosis relevant: (A) clinical tissue specimen samples
Chip data in, the ZNF367 gene RNA level of tumor tissues be higher than normal galactophore tissue；(B) the ZNF367 base of high expressed
Because the total life span poor to patient with breast cancer is relevant；(C) when the high expressed of ZNF367 gene imply that shorter disease free survival
Between；(D) quantitative PCR result shows, the ZNF367 gene high expression of tumor tissues is in Carcinoma side normal tissue；(E) relative to non-
Pernicious galactophore epithelial cell (MCF-10A), ZNF367 gene is high expressed in multiple breast cancer cell lines；
Fig. 2, ZNF367 gene protein high expressed in breast cancer tissue and to difference prognosis relevant: (A) ZNF367 staining power with
The clinical stages of patient with breast cancer, raises and deepens；(B-C) patient with breast cancer of the ZNF367 gene of high expressed, it is always survived
Time (B) and disease free survival time (C) are the shortest；(D) high expression level of ZNF367, indicates patient's higher recurrence wind
Danger, therefore can be as the independent factor judging patient's prognosis；
Fig. 3, utilize the stable reticent ZNF367 of children purpura nephritis can suppress the malignant phenotype of breast carcinoma: (A) immunoblot experiment, really
Recognizing two sections of shRNA all can the expression of ZNF367 in effectively reticent breast cancer cell；(B) reticent ZNF367 can suppress breast carcinoma thin
The clonal growth of born of the same parents；(C) with doxorubicin associated with under the conditions of, reticent ZNF367 can the apoptosis of notable inducing mammary cancerous cell；
(D) reticent ZNF367 can suppress the size of internal formation tumor of breast cancer cell；(E) reticent ZNF367 can suppress breast carcinoma
The Lung metastases ability of cell；
Fig. 4, utilize the LNA of targeting ZNF367 can suppress the malignant phenotype of breast carcinoma: (A) immunoblot experiment, confirm two sections
LNA all can the expression of ZNF367 in effectively reticent breast cancer cell；(B) reticent ZNF367 can suppress the clone of breast cancer cell
Growth；(C) with doxorubicin associated with under the conditions of, reticent ZNF367 can the apoptosis of notable inducing mammary cancerous cell；(D) reticent
ZNF367 can suppress the size of the internal formation tumor of breast cancer cell；(E) reticent ZNF367 can suppress the lung of breast cancer cell
Transfer ability.
Detailed description of the invention
Anti-gene therapy (anti-gene therapy) is phonetic with gathering with target double-stranded DNA by specific oligodeoxynucleotide
Pyridine or combine with polypurine tract specificity and form local triple-helix structure, stops target DNA and the albumen such as polymerase, transcription factor to be tied
Close, it is achieved the duplication of suppression target gene and the purpose of expression.
Lock nucleic acid (lock mucleic acid, LNA) is the nucleotide derivative of newfound a kind of band circulus,
Compared with other oligonucleotide, there is higher heat stability, more preferable molecule hybridization ability, higher nuclease-resistant degraded energy
The advantages such as power, the most fat-soluble and lower cytotoxicity.
Inventor, by utilizing the mrna expression spectrum chip of multiple breast carcinoma and normal galactophore tissue to carry out confluence analysis, sends out
Existing ZNF367 gene high expression is in breast cancer tissue, and the high expressed of ZNF367 imply that poor total life span and without diease occurrence
Deposit the time.Further experiment finds that the mRNA of ZNF367 gene is at three cloudy breast cancer cell line BT-549, HCC1937, MDA-
High expressed in MB-231, MDA-MB-468, and other breast cancer cell lines relative expression is relatively low.Inventor designs further and closes
One-tenth can detect the diagnosis for three cloudy breast carcinoma of the fluorescence quantification PCR primer of ZNF367 gene RNA expression and probe sequence；
Also design and synthesize two sections of hairpin RNA (shRNA) sequences for ZNF367 gene, the method cloned by gene, incited somebody to action
ShRNA sequence is cloned into pSUPER-pure carrier.Utilize retroviral infection system, construct what reticent ZNF367 expressed
ShRNA breast cancer cell line (SKBR3-shZNF367#1, SKBR3-shZNF367#2, BT549-shZNF367#1 and BT549-
ShZNF367#2)；Inventor also designs lock nucleic acid (LNA) sequence for ZNF367 gene, and for deoxidation core in LNA sequence
Acid carries out D2EHDTPA and modifies design, by chemosynthesis obtain two LNA sequences for ZNF367 (LNA-ZNF367#1 and
LNA-ZNF367#2).Two sections of hairpin RNA (shRNA) sequences that the present invention provides and two LNA sequences for ZNF367 can be used
Treatment in breast carcinoma.
In conjunction with specific embodiment, the present invention is further illustrated, but is not limited thereto.
Embodiment 1:ZNF367 raises at breast carcinoma
(1) cDNA microarray
By utilizing the mrna expression spectrum chip of multiple breast carcinoma and normal galactophore tissue to carry out confluence analysis.
Result: from the clinical tissue specimen samples chip data integrated, the ZNF367 gene RNA water of tumor tissues can be specified
Flat higher than normal galactophore tissue (Fig. 1-A)；The Patient Sample A having clinical prognosis data is chosen, analyzes expression and the trouble of ZNF367
The relation of person's prognosis finds, the ZNF367 gene of high expressed imply that total life span (Fig. 1-B) and more of patient with breast cancer's difference
The short disease free survival time (Fig. 1-C).
(2) mRNA level in-site of ZNF367 gene during qRT-PCR detects breast cancer tissue and pairing cancer beside organism
Further the ZNF367 in breast cancer tissue and pairing cancer beside organism is carried out qRT-PCR detection checking.
Method:
1) breast cancer tissue source: from cancer and the cancer beside organism of the pairing of Zhongshan University treatment and prevention of tumour central collection patient with breast cancer
Sample (n=8, including P1-P8).
2) cell line and cell are cultivated: 12 strain breast cancer cell lines: MCF10A, BT474, MCF7, MDA-MB-361, MDA-
MB-453、SK-BR-3、T-47D、ZR-75-1、BT-549、HCC1937、MDA-MB-231、MDA-MB-468.Cell is cultivated
In containing 10%FBS DMEM (Dulbecco's Minimum Essential Medium, Invitrogen, Carlsbad,
USA), in culture medium, 5% CO of 37 DEG C is placed2Incubator.
3) real-time fluorescence quantitative PCR: collect above-mentioned tissue and 12 kinds of cells, is utilized respectively Trizol and extracts RNA, use
MMLV reverse transcription (Promega) carries out reverse transcription synthesis cDNA, uses 2 × SYBR mix (Roche) in each group of cell
The expression of ZNF367 carries out qRT-PCR detection.
Internal reference is done with GAPDH.Q-PCR primer used is:
ZNF367-QF:AATCGCGGACAGTATCTGCT(SEQ ID NO:1)；
ZNF367-QR:GTGAGGACGAGGAGGAAGC(SEQ ID NO:2)；
GAPDH-QF:GCACCGTCAAGGCTGAGAAC(SEQ ID NO:3)；
GAPDH-QR:TGGTGAAGACGCCAGTGGA(SEQ ID NO:4)；
The Ct value of the ZNF367 gene obtained by each sample deducts the Ct of its reference gene GAPDH and is worth to △ Ct, and result is used
2-△CtRepresenting, △ Ct value is the highest, represents that the expression of this gene is the lowest.
Result: quantitative PCR result shows, the ZNF367 gene high expression of tumor tissues is in Carcinoma side normal tissue (Fig. 1-D)；
Relative to nonmalignant galactophore epithelial cell (MCF-10A), ZNF367 gene at breast cancer cell line, especially three cloudy breast carcinoma
Significantly high expression in cell line (Fig. 1-E).
(3) Immunohistochemical Method detection ZNF367 gene protein expression in breast tumor tissue sections
To the 207 example breast tumor tissue sections chosen, ZNF367 antibody is used to carry out immunohistochemical staining.ImmunohistochemistryMethods Methods
For:
1) roasting sheet 60 DEG C, 1h 30min；
2) dewaxing and rehydration: dimethylbenzene two cylinder, 15min/ time；100% ethanol twice, once, 75% ethanol once, steams 95% ethanol
Distilled water is washed twice, each each 3min；
3) cut into slices in wet box, add 3% hydrogen peroxide, room temperature 25min, distillation washing twice, each each 3min；
4) citrate repair liquid, Pressure method, 3min after steaming；
5) section naturally cools to room temperature in repair liquid；
6) 1 × PBST, 3min × 3 time；
7) dry, add A liquid (unspecific staining blocker) in room temperature, 15min in wet box；
8) abandoning confining liquid, it is anti-to add one；
9) 1 × PBST, 3min × 3 time, dry；
10) B liquid (biotin goat-anti rabbit/Mus IgG) 15min is added, 1 × PBST, 3min × 3 times, dry；
11) C liquid (strepto-avidin) 15min is added, 1 × PBST, 3min × 3 times；
12) DAB colour developing, tap water terminates dyeing；
13) tap water flowing water rinsing；
14) haematoxylin redyes 3min, and tap water is scrubbed to without purple；
15) 95% hydrochloride alcohol differentiation 10 ~ 15s, tap water rinse returns blue 45min；
16) 60% ethanol, 80% ethanol, 100% ethanol dehydration 2min；
17) put into dimethylbenzene 2min, after transparence, time the most dry, drip 100uL resin, mounting.
Being observed coloration result by two observers, tumor cell ratio is evaluated by following standard:
0 (no positive tumor cell), 1(positive tumor cell number < 10%), 2(positive tumor cell number accounts for 10-50%), 3(is positive
Tumor cell number > 50%).
Result: ZNF367 staining power raises with the clinical stages of patient with breast cancer and deepens (Fig. 2-A), high expressed
The patient with breast cancer of ZNF367 gene (ZNF-H), its total life span (Fig. 2-B) is compared low with the disease free survival time (Fig. 2-C)
Expressing patient (ZNF-L) the shortest, multiplicity confirms (n=207), the high expression level of ZNF367, and indication patient is higher
Risk of recurrence, therefore can be as the independent factor (Fig. 2-D) judging patient's prognosis.
Embodiment 2: utilize the stable reticent ZNF367 of children purpura nephritis (shRNA) that the malignant phenotype of breast carcinoma can be suppressed
(1) cell is cultivated and is stablized strain and builds
Method: respectively with negative control pSUPER-V and can shRNA(shZNF367#1, shZNF367# of reticent ZNF367
2) processing three cloudy breast cancer cell SKBR3 and BT549, working concentration is 5nM.WB checking is carried out by receiving corresponding albumen.
The sequence of shZNF367#1 is: ccgggcagatactgtccgcgatttactcgagtaaatcgcggacagtatct
Gcttttt(SEQ ID NO:5)；
The sequence of shZNF367#2 is: ccgggagcagattcacccatgcaaactcgagtttgcatgggtgaatctgctctt
Ttt(SEQ ID NO:6)；
Result: as shown in Fig. 3-A, obtains cellular control unit SKBR3 pSUPER-V, BT549 pSUPER-V and silence respectively
Cell SKBR3 shZNF367#1, the SKBR3 shZNF367#2 of ZNF367 and BT549 shZNF367#1, BT549
shZNF367#2.Beta tubulin is as comparison.
(2) colony formation
Method: by 5 × 102Individual cell is inoculated in six orifice plates respectively, and after cultivating 10 days, fixes 5 minutes through 10% formaldehyde, then
By violet staining 30s of 1%.
Result: as shown in Fig. 3-B, compared with matched group SKBR3 pSUPER-V, BT549 pSUPER-V, reticent ZNF367
SKBR3 shZNF367#1, SKBR3 shZNF367#2 and BT549 shZNF367#1, BT549 shZNF367#2 breast carcinoma
Cell can significantly inhibit the clonal growth of breast cancer cell.
(3) drug-induced apoptosis experiment
Method: by 5 × 105Individual cell is inoculated in six orifice plates respectively, adds the doxorubicin of 1 μm ol/L after 12 h
(Doxorubicin 1 M) processes cell, processes cell with the double transfection reagent box of AnnexinV-FITC/PI, and uses flow cytometer
Detection apoptotic cell ratio.
Result: as shown in Fig. 3-C, suppression ZNF367 can dramatically increase the apoptosis ratio of doxorubicin induction.
(4) experiment in vivo
1) tumor experiment is become in Mice Body
Method builds cancer model in Mice Body, by 1 × 106Individual breast cancer cell BT549 pSUPER-V and BT549
ShZNF367#1, BT549 shZNF367#2 carries out mouse subcutaneous injection, by living imaging systematic observation fluorescence intensity after 5 weeks,
And dissect animal measurement tumor weight.
Result: as shown in Fig. 3-D, process group is compared with matched group, and gross tumor volume and weight are significantly less than matched group, show
With doxorubicin associated with under the conditions of, reticent ZNF367 can the apoptosis of notable inducing mammary cancerous cell and suppression breast cancer cell
The size of internal formation tumor.
2) mouse lung metastasis model
Method: through mouse tail vein injection BT549 pSUPER-V, BT549 shZNF367#1, BT549 shZNF367#2 mammary gland
Cancerous cell, by living imaging systematic observation fluorescence intensity after 5 weeks, and dissects animal observation lung internal segment footing mesh.
Result: as shown in Fig. 3-E, the number of statistics mouse lung metastasis, learn with BT549 shZNF367#1, BT549
The energy for growth of the metastatic lung cancer of the mice that shZNF367#2 processes declines, and shows that reticent ZNF367 can suppress breast cancer cell
Lung metastases ability.
Embodiment 3: utilize the stable reticent ZNF367 of lock nucleic acid (LNA) of targeting ZNF367 can suppress the pernicious table of breast carcinoma
Type
(1) cell is cultivated and is stablized strain and builds
Method: respectively with negative control LNA-NC and can LNA(LNA-ZNF367#1, LNA-ZNF367#2 of reticent ZNF367)
Processing breast cancer cell SKBR3 and BT549, working concentration is 50 nM.WB checking is carried out by receiving corresponding albumen.
LNA-NC sequence is: TGagaagaccgttcttccaactTgG(SEQ ID NO:7)；
LNA-ZNF367#1 sequence is: TGaaccagcttgcctttcaaagTgG(SEQ ID NO:8)；
LNA-ZNF367#2 sequence is: TCtcatttcccaatacctcgccTgC(SEQ ID NO:9)；
Note: lower case is the RNA base that D2EHDTPA is modified, and capitalization is LNA base.
Result: as shown in Fig. 4-A, relative to LNA-NC process group, in two breast cancer cells with LNA-ZNF367#1 and
LNA-ZNF367#2 processes cell, can significantly reduce the expression of ZNF367.
(2) colony formation
Method: by 5 × 102Individual cell is inoculated in six orifice plates respectively, and after cultivating 10 days, fixes 5 minutes through 10% formaldehyde, then
By violet staining 30s of 1%.
Result: as shown in Fig. 4-B, relative to LNA-NC process group, with LNA-ZNF367#1 and LNA-ZNF367#2 process
Cell, can significantly inhibit the clonality of two breast carcinoma.
(3) drug-induced apoptosis experiment
Method: by 5 × 105Individual cell is inoculated in six orifice plates respectively, adds the doxorubicin and 50 of 1 μm ol/L after 12 h
LNA-NC, LNA-ZNF367#1 or LNA-ZNF367#2 of nmol/L, processes thin with the double transfection reagent box of AnnexinV-FITC/PI
Born of the same parents, and by flow cytomery apoptotic cell ratio.
Result: as shown in Fig. 4-C, is combined doxorubicin with the LNA for ZNF367 and can significantly induce two breast carcinoma thin
The apoptosis of born of the same parents.
(4) experiment in vivo
1) tumor experiment is become in Mice Body
Method: first carry out building cancer model in Mice Body, by 1 × 106Individual breast cancer cell BT549 carries out mouse mammary fat
Fat pad is injected, and 3 days after inoculating cell start, weekly 2 LNA-NC, LNA-ZNF367#1 or LNA-ZNF367#2 of injection, body
Amassing is 100 μ l, and concentration is 1 mmol/L, continuously after injection 4 weeks, by living imaging systematic observation fluorescence intensity, and dissects animal
Measure tumor weight.
Result: as shown in Fig. 4-D, compared with LNA-NC process group, with LNA-ZNF367#1 or LNA-ZNF367#2 process
Tumor-bearing mice, can significantly inhibit the volume of tumor.
2) mouse lung metastasis model
Method: 3 days after mouse tail vein injection BT549 breast cancer cell start, weekly 2 LNA-NC, LNA-of injection
ZNF367#1 or LNA-ZNF367#2, volume is 100 μ l, and concentration is 1 mmol/L, after injecting 4 weeks continuously, uses living imaging system
Overall view examines fluorescence intensity, and dissects animal observation lung internal segment footing mesh.
Result: as shown in Fig. 4-E, the number of statistics mouse lung metastasis, compared with LNA-NC group, use LNA-ZNF367#1
The mice processed with LNA-ZNF367#2, the energy for growth of its tumor cell metastatic lung cancer declines, shows targeted silent ZNF367
The Lung metastases ability of breast cancer cell can be suppressed.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment
Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify,
All should be the substitute mode of equivalence, within being included in protection scope of the present invention.
<110>Zhongshan Univ. Cancer Cure Center
<120>ZNF367 gene application in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
aatcgcggac agtatctgct 20
<210> 2
<211> 19
<212> DNA
<213>artificial sequence
<400> 2
gtgaggacga ggaggaagc 19
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
gcaccgtcaa ggctgagaac 20
<210> 4
<211> 19
<212> DNA
<213>artificial sequence
<400> 4
tggtgaagac gccagtgga 19
<210> 5
<211> 57
<212> DNA
<213>artificial sequence
<400> 5
ccgggcagat actgtccgcg atttactcga gtaaatcgcg gacagtatct gcttttt 57
<210> 6
<211> 57
<212> DNA
<213>artificial sequence
<400> 6
ccgggagcag attcacccat gcaaactcga gtttgcatgg gtgaatctgc tcttttt 57
<210> 7
<211> 25
<212> DNA
<213>artificial sequence
<400> 7
tgagaagacc gttcttccaa cttgg 25
<210> 8
<211> 25
<212> DNA
<213>artificial sequence
<400> 8
tgaaccagct tgcctttcaa agtgg 25
<210> 9
<211> 25
<212> DNA
<213>artificial sequence
<400> 9
tctcatttcc caatacctcg cctgc 25
Claims (8)
1. the reagent of suppression ZNF367 gene expression or translation application in preparation treatment breast cancer medicines.
2. according to the application described in claim 1, it is characterised in that: the reagent of suppression ZNF367 gene expression or translation is
ZNF367 gene promoter inhibitor, ZNF367 genetic transcription inhibitor or ZNF367 protein synthesis inhibitor.
3. according to the application described in claim 1, it is characterised in that: the reagent of suppression ZNF367 gene expression or translation is
The shRNA of siRNA or the ZNF367 gene of dsRNA, ZNF367 gene of ZNF367 gene.
Make ZNF367 protein active reduce the most in vivo or the application treated in breast cancer medicines prepared by the reagent of inactivation.
5. according to the application described in claim 4, it is characterised in that: make ZNF367 protein active reduce in vivo or inactivation
Reagent selected from ZNF367 protein antibodies, ZNF367 activity inhibitor.
6. quantitatively the reagent of ZNF367 gene DNA amplification amount or expression as breast cancer diagnosis or prognosis evaluation reagent should
With.
7. quantitatively the reagent of ZNF367 protein D NA amplification amount or expression as breast cancer diagnosis or prognosis evaluation reagent should
With.
8. breast cancer diagnosis or a prognosis evaluation reagent, this reagent contains quantitative ZNF367 gene or the examination of expressing quantity
Agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610357423.8A CN106039312B (en) | 2016-05-25 | 2016-05-25 | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610357423.8A CN106039312B (en) | 2016-05-25 | 2016-05-25 | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106039312A true CN106039312A (en) | 2016-10-26 |
| CN106039312B CN106039312B (en) | 2019-07-23 |
Family
ID=57175884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610357423.8A Active CN106039312B (en) | 2016-05-25 | 2016-05-25 | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106039312B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113667748A (en) * | 2021-07-19 | 2021-11-19 | 中山大学肿瘤防治中心（中山大学附属肿瘤医院、中山大学肿瘤研究所） | Inhibitor of circIKB and application of detection reagent thereof in kit for diagnosis, treatment and prognosis of breast cancer bone metastasis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109637A1 (en) * | 2010-03-03 | 2011-09-09 | Koo Foundation Sun Yat-Sen Cancer Center | Methods for classifying and treating breast cancers |
| CN102533990A (en) * | 2011-12-27 | 2012-07-04 | 芮屈生物技术（上海）有限公司 | In situ hybridization detection kit for mRNA level at precancerous stage of breast cancer, detection method and application thereof |
| WO2016042164A1 (en) * | 2014-09-19 | 2016-03-24 | The Provost, Fellows, Foundation Scholars, & The Other Members Of Board, Of The College Of The Holy & Unidv. Trinity Of Queen Elizabeth, Near Dublin | A method of predicting risk of recurrence of cancer |
-
2016
- 2016-05-25 CN CN201610357423.8A patent/CN106039312B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109637A1 (en) * | 2010-03-03 | 2011-09-09 | Koo Foundation Sun Yat-Sen Cancer Center | Methods for classifying and treating breast cancers |
| CN102533990A (en) * | 2011-12-27 | 2012-07-04 | 芮屈生物技术（上海）有限公司 | In situ hybridization detection kit for mRNA level at precancerous stage of breast cancer, detection method and application thereof |
| WO2016042164A1 (en) * | 2014-09-19 | 2016-03-24 | The Provost, Fellows, Foundation Scholars, & The Other Members Of Board, Of The College Of The Holy & Unidv. Trinity Of Queen Elizabeth, Near Dublin | A method of predicting risk of recurrence of cancer |
Non-Patent Citations (2)
| Title |
|---|
| JAIN M ET AL.: "ZNF367 Inhibits Cancer Progression and Is Targeted by miR-195", 《PLOS ONE》 * |
| 张林杰等: "高密度cDNA微阵列技术检测乳腺癌差异表达基因", 《安徽医科大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113667748A (en) * | 2021-07-19 | 2021-11-19 | 中山大学肿瘤防治中心（中山大学附属肿瘤医院、中山大学肿瘤研究所） | Inhibitor of circIKB and application of detection reagent thereof in kit for diagnosis, treatment and prognosis of breast cancer bone metastasis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106039312B (en) | 2019-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104388556B (en) | The application in preparing ovarian cancer diagnosis or medicine of a kind of long-chain non-coding RNA | |
| CN107326071B (en) | Application of PLPP4 as non-small cell lung cancer diagnosis, treatment and prognosis target | |
| CN108949984A (en) | Application of the gene DESI2 in three negative breast cancer diagnosis, prognosis evaluation and treatment | |
| CN104774929B (en) | The application of diagnosis, treatment and prognosis of the 3p of miR 455 in esophageal squamous cell carcinoma | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN109055548A (en) | Application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment | |
| CN104726584B (en) | Applications of the miR 425 in the diagnosis, treatment and prognosis of tumour | |
| CN109321656A (en) | Purposes of the protein D EPDC1 as the marker of the negative breast cancer of diagnosis three | |
| CN106039312B (en) | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent | |
| CN107937526A (en) | A kind of relevant tumor markers of neuroblastoma and its application | |
| CN104083368B (en) | G-1 application in terms of preparing three negative breast cancer targeted drugs based on g protein coupled receptor 30 | |
| Liu et al. | Mitofusin1 is a major mediator in glucose-induced epithelial-to-mesenchymal transition in lung adenocarcinoma cells | |
| CN107488735B (en) | MiR-339-5p is inhibiting the application in prostate cancer with osseous metastasis and TGF-β signal path | |
| CN111560433B (en) | Application of human NUFIP1 and related products | |
| CN108085385A (en) | A kind of colorectal cancer biomarker and its application | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN106860879B (en) | The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer | |
| CN103468799B (en) | EIF5A2 application in preparation treatment esophageal squamous cell carcinoma preparation | |
| CN106916887A (en) | Application of the ERH genes in carcinoma of urinary bladder diagnosis and treatment product is prepared | |
| CN105648103B (en) | Purposes of the VSIG10L gene as lung squamous cancer transfer diagnosis and treatment marker | |
| CN105018484A (en) | CRTAP gene and expression product thereof capable of serving as target for diagnosing and treating Alzheimer's disease | |
| CN110396544A (en) | Application of the CUL7 in diagnosis of glioma, treatment and prognosis | |
| CN110283825A (en) | SiRNA and its application of low SRC-1 gene expression can be struck | |
| CN105497916B (en) | Small molecule non-coding RNA miR-125b is preparing the application in the drug for treating the wrap-around vascular group liver cancer of tumour | |
| CN108245679A (en) | SPAG5 is preparing the application in treating bladder cancer drug as target site |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |