CN109055548A - Application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment - Google Patents
Application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment Download PDFInfo
- Publication number
- CN109055548A CN109055548A CN201810824526.XA CN201810824526A CN109055548A CN 109055548 A CN109055548 A CN 109055548A CN 201810824526 A CN201810824526 A CN 201810824526A CN 109055548 A CN109055548 A CN 109055548A
- Authority
- CN
- China
- Prior art keywords
- hes2
- squamous cell
- expression
- esophageal squamous
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment.Present invention discover that HES2 gene high expression is in esophageal squamous cell carcinoma tissue.Further experiment find HES2 gene mRNA esophageal squamous cell system height express, HES2 high expressors tumour progression faster and be more likely to occur lymph node or distant organs transfer, it is significant related to poor 5 years disease-free survival rates and 5 years overall survivals.In addition the antisense oligonucleotides chain-ordering for being directed to HES2 gene is also designed, silencing HES2 expression can be used for the treatment of the cancer of the esophagus.Illustrate that HES2 can be used as esophageal squamous cell carcinoma auxiliary diagnosis and predict the detection marker of esophageal squamous cell carcinoma recurrence trend, and the target spot for the treatment of.
Description
Technical field
The present invention relates to molecular biology and tumour medicine field, and in particular to a kind of esophageal squamous cell carcinoma marker
HES2 and its application in esophageal squamous cell carcinoma auxiliary diagnosis, treatment and Index for diagnosis.
Background technique
The cancer of the esophagus is common malignant tumour, and according to global tumour statistics in 2012, the whole world was estimated to be 45.58 ten thousand new foods
Pipe carninomatosis example.China is one of Esophageal Cancer area in the world, and disease incidence accounts for about the whole world 50%, and every annual dies of illness about 150,000
People.
The morbidity and mortality various countries of the cancer of the esophagus are widely different, and there are about 300,000 people to die of the cancer of the esophagus every year in the whole world.I
State has become the whole world and suffers from the highest country of mortality rate of esophageal cancer.The case that about half is diagnosed with the cancer of the esophagus exists cannot
The tumour of excision or transfer.Most of patient has developed to Locally Advanced (30%) or advanced stage (40%) in discovery.This two groups
5 years survival rates of patient are 39% and 4%.The cancer of the esophagus mainly has squamous cell carcinoma and gland cancer two types, and wherein squamous carcinoma is the most
It is common, account for about the 90% of the global cancer of the esophagus.
In order to more efficiently identify high-risk tumour and more accurately predict the development trend of high-risk tumour, find simultaneously rationally to answer
It is the premise of lesion detection and recurrence prediction with tumor markers.Currently, the cancer of the esophagus that prediction early stage recurs and prognosis is bad
Marker it is still immature, and the tool for helping new cases to understand progression of disease risk and guiding treatment is also extremely limited.
Therefore, recurrence of Esophageal Carcinoma marker research oneself become great Scientific Research Problem in the urgent need to address.
HES family gene is the Drug Discovery target of regenerative medicine and oncology.HES2 is that HES family bHLH turns
The factor 2 is recorded, gene is located in human genomic sequence AL031848.il, encodes 173-aa albumen.Some researches show that HES2
It can interact with transcription initiation complex and inhibit its function, the regulation of various genes may be participated in, and may be in cell point
It works in change.In addition, HES2mRNA is in placenta, cancer of pancreas, RER colon cancer is expressed in cervical carcinoma and head and neck neoplasm.
Anti- gene therapy (anti-gene therapy) is phonetic with gathering with target double-stranded DNA by specific oligodeoxynucleotide
Pyridine forms local triple-helix structure with the combination of polypurine tract specificity, passes through and prevents the eggs such as target DNA and polymerase, transcription factor
It is white in conjunction with and realize inhibit target gene duplication and expression purpose.Antisense oligonucleotides (AON) is that one kind passes through sequence specific
Ground inhibits the gene expression in conjunction with target gene DNA or mRNA, in the molecular drug of gene level regulation.It is more satisfactory at present
Antisense substance --- lock nucleic acid (lock mucleic acid, LNA) is a kind of special double-ring nucleotide derivative, with
Other oligonucleotides are compared, and have that thermal stability is higher, molecule hybridization ability is more preferable, nuclease-resistant degradation capability is stronger, liposoluble
Property the more preferable and more low advantage of cytotoxicity.
Summary of the invention
The purpose of the present invention is to provide a kind of for esophageal squamous cell carcinoma auxiliary diagnosis or/and the product of Prognosis.
Another object of the present invention is to provide a kind of medicaments for treating esophageal squamous cell carcinoma.
The technical solution used in the present invention is:
The reagent of quantitative detection HES2 is preparing the application in esophageal squamous cell carcinoma auxiliary diagnosis or/and Prognosis product.
Further, the reagent of the quantitative detection HES2 is selected from the reagent of the rna transcription level of quantitative detection HES2, determines
At least one of the reagent of protein expression level of amount detection HES2.
Further, the reagent of the rna transcription level of the quantitative detection HES2 be selected from quantitative detection HES2 primer or
Probe.
Further, the primer of the quantitative detection HES2 are as follows:
Upstream primer: 5'-AACCAGAGCCTGAGCCAGCTTA-3'(SEQ ID NO:1)；
Downstream primer: 5'-TGCAGGAAGCGCACGGTCATTT-3'(SEQ ID NO:2).
Further, the product is kit or chip.
Inhibit application of the reagent of HES2 expression in preparation treatment or adjuvant treatment esophageal squamous cell carcinoma product.
Further, the reagent for inhibiting HES 2 to express is selected from siRNA, silencing the HES2 expression of silencing HES2 expression
ShRNA, silencing HES 2 expression at least one of antisense oligonucleotides chain.
Further, the targeting sequence of the silencing HES 2 is expressed siRNA or shRNA are selected from following at least one:
5'-CTGGAGCACCTGTGGCGGAG-3'(SEQ ID NO:5)；
5'-GCCTTGCGACAGCTACCGCG-3'(SEQ ID NO:6).
Further, the antisense oligonucleotides chain of the silencing HES2 expression is selected from following at least one:
HES2-AON#1:5'-GCTCACTAGTCCACTA-3'(SEQ ID NO:7)；
HES2-AON#2:5'-GCTGGTTAGATCTTAC-3'(SEQ ID NO:8)；
HES2-AON#3:5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9)；
HES2-AON#5:5'-TCCAGAGTCAAGCAAG-3'(SEQ ID NO:11).
Further, the product is medicament or health care product.
The beneficial effects of the present invention are:
Inventor, which passes through, carries out confluence analysis, hair using the mRNA chip of expression spectrum of multiple cancer of the esophagus and normal esophageal tissue
Existing HES2 gene high expression is in esophageal squamous cell carcinoma tissue.The mRNA of further experiment discovery HES2 gene is in esophageal squamous cell system
High expression in Eca109, EC9706, HKESC1, Kyse410, Kyse520, and other esophageal carcinoma cell lines relative expression is lower.
Inventor further designs and synthesizes the fluorescence quantification PCR primer that can detect HES2 gene RNA expression and probe sequence is used
In the diagnosis of esophageal squamous cell carcinoma；The standards of grading for also designing and having formulated HES2 albumen in immune labeled esophageal squamous cell carcinoma, by immune
Histochemical method identifies and predicts the grade malignancy and development trend of esophageal squamous cell carcinoma.Inventor also designs for HES2 base
Antisense oligonucleotides chain (AON) sequence of cause, and thiophosphoric acid modification design is carried out for picodna in AON sequence, pass through
Chemical synthesis obtains an AON sequence (HES2-AON#3) for HES2.Immune labeled HES2 albumen provided by the invention
Standards of grading and Index for diagnosis and the treatment that can be used for the cancer of the esophagus for an AON sequence of HES2.
Detailed description of the invention
Fig. 1, HES2 gene mRNA height are expressed in esophageal squamous cell carcinoma tissue.(A) in the chip data of clinical tissue specimen samples, tumour
The HES2 gene RNA level of tissue is higher than normal esophageal tissue；(B) detect HES2's in the cancerous tissue of pairing and cancer beside organism
Expression.Quantitative PCR is the results show that cancer beside organism of expression of the HES2 in esophageal squamous cell carcinoma compared to pairing, up-regulation
The multiple that raises than adenocarcinoma of esophagus of multiple change it is more obvious；(C) relative to nonmalignant esophageal epithelial cell (NEEC-
1, NEEC-2), the high expression in multiple esophageal squamous cell systems of HES2 gene；ESCC indicates that esophageal squamous cell carcinoma, EAC indicate food in figure
Pipe gland cancer.
Fig. 2, HES2 gene protein height be expressed in human esophageal carcinoma and to difference prognosis it is related.(A) relative to adenocarcinoma of esophagus
In HES2 dyeing (41.31%) ,-intensity ratio in esophageal squamous cell carcinoma (87.62%) is significantly raised；(B) exempt from by what we drafted
Expression of the HES2 in esophageal squamous cell carcinoma is divided into 2 groups by epidemic disease group standards of grading (SI scoring), and 0-4 points are low expression group
(HES2-L), 6-12 points are high expression group (HES2-H)；(C) the high expression of HES2 gene implies shorter Overall survival
With the disease-free survival time.
Fig. 3, the malignant phenotype that the cancer of the esophagus can be inhibited using the stable silencing HES2 of children purpura nephritis.(A, B) silencing HES2
(shHes2#1, shHes2#2) can significantly inhibit the proliferative capacity of esophageal squamous cell；(C) silencing HES2 (shHes2#1,
ShHes2#2 the transfer ability of esophageal squamous cell) can be inhibited；(D) silencing HES2 (shHes2#1, shHes2#2) can inhibit food
The invasive ability of pipe cancer cell.
Fig. 4, the malignant phenotype that the cancer of the esophagus can be inhibited using the AON of targeting HES2.(A, B) Real time PCR and exempt from
Epidemic disease Blot experiment confirms the expression of HES2 in this section of AON energy effective reticence esophageal squamous cell；(C) subcutaneous respectively to mouse to infuse
Penetrate cellular control unit (Eca109) and the cell (Eca109HES2-AON#3) of silencing HES2, the results showed that silencing HES2 can press down
The size of the internal formation tumour of esophageal squamous cell processed；(D) tail vein injection cellular control unit (Eca109 is distinguished to mouse
Vector) and the cell of silencing HES2 (Eca109HES2-AON#3), the results showed that silencing HES2 can inhibit esophageal squamous cell
Lung metastases ability.
Specific embodiment
The reagent of quantitative detection HES2 is preparing the application in esophageal squamous cell carcinoma auxiliary diagnosis or/and Prognosis product.
Preferably, the reagent of the quantitative detection HES2 is selected from the reagent of the rna transcription level of quantitative detection HES2, quantifies
Detect at least one of the reagent of protein expression level of HES2.
Preferably, the reagent of the rna transcription level of the quantitative detection HES2 is selected from primer or the spy of quantitative detection HES2
Needle.
Application according to claim 3, which is characterized in that the primer of the quantitative detection HES2 are as follows:
Upstream primer: 5'-AACCAGAGCCTGAGCCAGCTTA-3'(SEQ ID NO:1)；
Downstream primer: 5'-TGCAGGAAGCGCACGGTCATTT-3'(SEQ ID NO:2).
Preferably, the product is kit or chip.
Inhibit application of the reagent of HES2 expression in preparation treatment or adjuvant treatment esophageal squamous cell carcinoma product.
Preferably, the reagent for inhibiting HES2 expression is selected from the reagent for inhibiting HES2RNA transcription or inhibits HES2 albumen
At least one of reagent of expression.
Preferably, the reagent for inhibiting HES2 expression is selected from the anti-of shRNA, silencing the HES2 expression of silencing HES2 expression
At least one of oligonucleotide chain.
Preferably, the targeting sequence of the silencing HES 2 is expressed siRNA or shRNA are selected from following at least one:
5'-CTGGAGCACCTGTGGCGGAG-3'(SEQ ID NO:5)；
5'-GCCTTGCGACAGCTACCGCG-3'(SEQ ID NO:6).
Preferably, the antisense oligonucleotides chain of the silencing HES2 expression is selected from following at least one:
HES2-AON#1:5'-GCTCACTAGTCCACTA-3'(SEQ ID NO:7)；
HES2-AON#2:5'-GCTGGTTAGATCTTAC-3'(SEQ ID NO:8)；
HES2-AON#3:5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9)；
HES2-AON#5:5'-TCCAGAGTCAAGCAAG-3'(SEQ ID NO:11).
It is a kind of for esophageal squamous cell carcinoma auxiliary diagnosis or/and the product of Prognosis, contain quantitative detection in the product
The reagent of HES2.
Preferably, the reagent of the quantitative detection HES2 is selected from the reagent of the rna transcription level of quantitative detection HES2, quantifies
Detect at least one of the reagent of protein expression level of HES2.
Preferably, the reagent of the rna transcription level of the quantitative detection HES2 is selected from primer or the spy of quantitative detection HES2
Needle.
Preferably, the primer of the quantitative detection HES2 are as follows:
Upstream primer: 5'-AACCAGAGCCTGAGCCAGCTTA-3'(SEQ ID NO:1)；
Downstream primer: 5'-TGCAGGAAGCGCACGGTCATTT-3'(SEQ ID NO:2).
Preferably, the product is kit or chip.
Preferably, the reagent for inhibiting HES2 expression is contained in the medicament.
Preferably, the reagent for inhibiting HES2 expression is selected from the reagent for inhibiting HES2RNA transcription or inhibits HES2 albumen
At least one of reagent of expression.
Preferably, the reagent for inhibiting HES2 expression is selected from the anti-of shRNA, silencing the HES2 expression of silencing HES2 expression
At least one of oligonucleotide chain.
Preferably, the targeting sequence of the silencing HES 2 is expressed siRNA or shRNA are selected from following at least one:
5'-CTGGAGCACCTGTGGCGGAG-3'(SEQ ID NO:5)；
5'-GCCTTGCGACAGCTACCGCG-3'(SEQ ID NO:6).
Preferably, the antisense oligonucleotides chain of the silencing HES2 expression is selected from following at least one:
HES2-AON#1:5'-GCTCACTAGTCCACTA-3'(SEQ ID NO:7)；
HES2-AON#2:5'-GCTGGTTAGATCTTAC-3'(SEQ ID NO:8)；
HES2-AON#3:5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9)；
HES2-AON#5:5'-TCCAGAGTCAAGCAAG-3'(SEQ ID NO:11).
The present invention is further illustrated combined with specific embodiments below.
The present invention provides a kind of target gene HES2 for esophageal squamous cell carcinoma auxiliary diagnosis and Index for diagnosis.Believed using biology
The method that breath is learned analyzes oesophagus oncogene expression high throughput data, experiment in vitro (quantitative fluorescent PCR, immunohistochemistry, clone's shape
At) the result shows that HES2 high expression and survival analysis in esophageal squamous cell carcinoma tissue show the expression and esophageal squamous cell of HES2 gene
The proliferation of cancer and prognosis are closely related, this is consistent with experimental result in Mice Body.The invention discloses immune labeled oesophaguses
The standards of grading of HES2 albumen and antisense oligonucleotides chain (AON) sequence for HES2 gene in squamous carcinoma can be used for assisting examining
Disconnected esophageal squamous cell carcinoma, treatment and the recurrence trend for predicting esophageal squamous cell carcinoma.For example, HES2 high expressors tumour progression faster and is more prone to
In lymph node or distant organs transfer occurring and its 5 years disease-free survival rates and 5 years overall survivals are in be decreased obviously trend.
(2) standards of grading (table 1) for designing and having formulated HES2 albumen in immune labeled esophageal squamous cell carcinoma, pass through immuning tissue
The method of chemistry, identifies and predicts the grade malignancy and development trend of esophageal squamous cell carcinoma.
(3) the antisense oligonucleotides chain (Antisense that design is modified for the lock nucleic acid of HES2 gene
Oligonucleotide, AON), the AON of most effective downward HES2 expression is obtained by testing the verifying from 5 different AON
It targets sequence (HES2-AON#3), sequence is 5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9).
Embodiment 1:HES2 expresses up-regulation in esophageal squamous cell carcinoma
(1) TCGA database analysis
Method: in order to inquire into expression of the HES2 in the cancer of the esophagus, applied biology analytical The
MRNA expresses data in Normal and Tumor in the related cancer of the esophagus in Cancer Genome Atlas (TCGA) database, goes forward side by side
Row prognostic analysis.
As a result (Figure 1A): the HES2 gene RNA level of esophageal squamous cell carcinoma tissue is higher than normal esophageal tissue and adenocarcinoma of esophagus group
It knits.
(2) qRT-PCR detects esophageal squamous cell carcinoma tissue and matches the mRNA level in-site of HES2 gene in cancer beside organism
Know that HES2 mRNA level in-site height in esophageal squamous cell carcinoma is expressed by above-mentioned analysis, the present invention is further to esophageal squamous cell carcinoma
HES2 in tissue and pairing cancer beside organism carries out qRT-PCR detection verifying.
Method:
1) human esophageal carcinoma source: we collect the group of patient with esophageal carcinoma from Zhongshan Univ. Cancer Cure Center (n=30)
Knit sample；
2) cell line and cell culture: people normal esophageal epithelial cell NEEC-1, NEEC-2 and 12 plants of esophageal cancer cells
System: OE19, OE33, Kyse30, Kyse140, Kyse510, TE-1, Kyse410, EC18, Eca109, EC9706, Kyse520,
HKESC1.By cell culture in containing 10%FBS DMEM (Dulbecco's Minimum Essential Medium,
Invitrogen, Carlsbad, USA) in culture medium, place 37 DEG C of 5%CO2Incubator.
3) real-time fluorescence quantitative PCR: collecting above-mentioned tissue and 12 kinds of cells, is utilized respectively Trizol and extracts RNA, uses
MMLV reverse transcriptase (Promega) carries out reverse transcription and synthesizes cDNA, using 2X SYBR mix (Roche) in group of cells
The expression of HES2 carries out qRT-PCR detection.
Internal reference is done with GAPDH.Q-PCR primer used are as follows:
HES2-QF:AACCAGAGCCTGAGCCAGCTTA(SEQ ID NO:1)
HES2-QR:TGCAGGAAGCGCACGGTCATTT(SEQ ID NO:2)
GAPDH-QF:GCACCGTCAAGGCTGAGAAC(SEQ ID NO:3)
GAPDH-QR:TGGTGAAGACGCCAGTGGA(SEQ ID NO:4)
The Ct value that the Ct value for the HES2 gene that each sample obtains subtracts its reference gene GAPDH is obtained into △ Ct, as a result
It is indicated with △ Ct, △ Ct value is higher, indicates that the expression of the gene is lower.
As a result: the HES2 gene expression of quantitative PCR result (Figure 1B, C) display, tumor tissues is higher than cancer beside organism；Relatively
In nonmalignant esophageal epithelial cell (NEEC-1, NEEC-2), the high expression in multiple esophageal carcinoma cell lines of HES2 gene.
(3) expression of the Immunohistochemical Method detection HES2 gene protein in human esophageal carcinoma slice
To 361 (including adenocarcinoma of esophagus tissue) human esophageal carcinomas slice of selection, immune group is carried out using HES2 antibody
Change dyeing.Our ImmunohistochemistryMethods Methods are as follows:
1) 60 DEG C of piece, 1h 30min are baked；
2) dewaxing and rehydration: three cylinder of dimethylbenzene, 5min/ times；Twice, 95% ethyl alcohol is primary for 100% ethyl alcohol, 75% ethyl alcohol one
Secondary, distillation is washed twice, each each 3min；
3) EDTA repairs liquid, Pressure method, 3min after steaming；
4) slice cooled to room temperature in repairing liquid；
5) distilled water, 3min × 3 time add 3% hydrogen peroxide, are placed in shaking table, and 70 turns/min, 15min；
6) hydrogen peroxide is abandoned, distilled water rinses, 1 × PBST, 3min × 3 time；
7) it dries, adds A liquid (unspecific staining blocking agent) in 20min in room temperature, wet box；
8) confining liquid is abandoned, primary antibody is added；
9) 1 × PBST, 3min × 3 time, drying；
10) plus B liquid (biotin goat-anti rabbit/mouse IgG) 20min, 1 × PBST, 3min × 3 time dry；
11) add C liquid (strepto- avidin) 20min, 1 × PBST, 3min × 3 time；
12) DAB develops the color, and tap water terminates dyeing；
13) tap water flowing water rinses；
14) haematoxylin redyes 3min, and tap water is scrubbed to no purple；
15) 95% hydrochloride alcohol breaks up 10~15s, and tap water rinse returns blue 45min；
16) 60% ethyl alcohol, 80% ethyl alcohol, 100% ethyl alcohol are successively dehydrated 3min；
17) it is put into dimethylbenzene 5min, after transparence, 100uL resin, mounting is added dropwise when not dry.
The standards of grading (table 1) for designing and having formulated HES2 albumen in immune labeled esophageal squamous cell carcinoma, pass through immuning tissue
Method identifies and predicts the grade malignancy and development trend of esophageal squamous cell carcinoma.Tumour cell ratio (by taking DAB develops the color as an example) meter
Calculation standard: semiquantitative determination, staining power are carried out by staining power comprehensive under high power lens (20 ×) and positive cell proportion
Standards of grading: not colored 0 point, yellow 1 is divided, and brown color 2 is divided, and yellowish-brown 3 is divided；Positive cell proportion standards of grading: without sun
Property cell person 0 divides, and positive cell number < 10% 1 are divided；10%~35% 2 divide, and 36%~75% 3 divide, and >=75% 4 divide.
Two kinds of scoring multiplications obtain score value SI (Staining Index): 0~1 point is Negative；2~4 points are Weak；6~8 points are
Moderate；9~12 points are strong, are shown in Table 1.
The standards of grading of HES2 albumen in the immune labeled esophageal squamous cell carcinoma of table 1
As a result (such as Fig. 2A-C): HES2 dyeing is strong to be concentrated in esophageal squamous cell carcinoma case, and staining power is with food
The reduction of the tumor differentiation degree of pipe squamous cell carcinoma patients and deepen；The patients with esophageal squamous cell carcinoma of height expression HES2 gene, when always surviving
Between and the disease-free survival time it is shorter, the high expression level of HES2 indicates the higher risk of recurrence of patient, therefore can be used as judgement
The independent factor of patients with esophageal squamous cell prognosis.
Embodiment 2: the malignant phenotype of the cancer of the esophagus can be inhibited by stablizing silencing HES2 using children purpura nephritis (shRNA).
(1) cell culture and stable strain building
Method: using negative control shGFP respectively and can be with the shRNA (including shHES2#1 and shHES2#2) of silencing HES2
Handle esophageal cancer cell Eca109 and Kyse520.WB verifying is carried out by receiving corresponding albumen.The wherein targeting sequence of shHES2#1
Are as follows: 5'-CTGGAGCACCTGTGGCGGAG-3'(SEQ ID NO:5), the targeting sequence of shHES2#2 are as follows: 5'-
GCCTTGCGACAGCTACCGCG-3'(SEQ ID NO:6).
As a result: obtaining the cell of cellular control unit Eca109 shGFP, Kyse520 shGFP and silencing HES2 respectively
Eca109 shHES2#1, Eca109 shHES2#2 and Kyse520 shHES2#1, Kyse520 shHES2#2.
(2) cell growth assay
Method: being made into individual cells suspension with culture solution is obtained containing 10% tire calf serum, thin with every hole 1000-10000
Born of the same parents are inoculated into 96 orifice plates, every pore volume 200ul.After same condition of culture culture 5 days, every hole adds MTT solution (5mg/ml PBS
With) 20ul.Continue to be incubated for 4 hours, terminates culture；Liquid carefully is discarded supernatant, every hole adds 150ul DMSO, sufficiently blows and beats.Selection
490nm wavelength measures each hole absorbance value on enzyme linked immunological monitor, records as a result, light absorption value is using the time as abscissa
Ordinate draws cell growth curve.This experiment is repeated 3 times in parallel.
As a result: as shown in the A figure in Fig. 3, compared with the control group, Eca109 shHES2#1, the Eca109 of silencing HES2
ShHES2#2 and Kyse520 shHES2#1, Kyse520 shHES2#2 esophageal squamous cell proliferative capacity significantly pressed down
System.
(3) soft agarose Colony forming is tested
Method: by 1 × 104A cellular control unit and experimental group cell are seeded in respectively in the culture medium containing 0.4% agar,
And it is laid on the culture medium curing gel containing 0.6% agar.Colonies number after 2 to 4 weeks, and calculate colony-forming efficiency
(colony-forming efficiency=colony number/planted cell number × 100%), this experiment is repeated 3 times in parallel.
As a result: as shown in the B figure in Fig. 3, compared with the control group, Eca109 shHES2#1, the Eca109 of silencing HES2
ShHES2#2 and Kyse520 shHES2#1, Kyse520 shHES2#2 esophageal squamous cell Colony forming ability by significant
Inhibit.
(4) external migration test
Method: the cell seeding of serum free medium will be resuspended in built-in 8 micron membrane filters cell.Cell is contained
The culture medium of 10% fetal calf serum is attracted.After 30 hours, cell is fixed, dyes, counts.In Matrigel, molecular filter is
One layer of matrigel covering.It is repeated 3 times independent experiment.
As a result: as shown in the C figure in Fig. 3, compared with the control group, Eca109 shHES2#1, the Eca109 of silencing HES2
ShHES2#2 and Kyse520 shHES2#1, Kyse520 shHES2#2 esophageal squamous cell transfer ability significantly pressed down
System.
(5) Three-dimensional cell culture is tested
Method: 50% preprepared Matrigel glue 200ul system is added into 24 orifice plates, 37 DEG C of environment are placed in
In make its solidification, then 300ul ultimate density containing 10%FBS, 25%Matrigel ultimate density, 2 × 10 is added in every hole4A cell
The system of final amt is placed in 37 DEG C, 5%CO2It is cultivated 2 weeks in incubator.This experiment is repeated 3 times in parallel.
As a result: as shown in the D figure in Fig. 3, compared with the control group, Eca109 shHES2#1, the Eca109 of silencing HES2
ShHES2#2 and Kyse520 shHES2#1, Kyse520 shHES2#2 esophageal squamous cell invasive ability significantly pressed down
System.
Embodiment 3: the evil of the cancer of the esophagus can be inhibited by stablizing silencing HES2 using the antisense oligonucleotides chain (AON) of targeting HES2
Property phenotype
(1) cell culture and stable strain building
Method: respectively with negative control Scramble and can with the AON of silencing HES2 (HES2-AON#1, HES2-AON#2,
HES2-AON#3, HES2-AON#4, HES2-AON#5) processing esophageal cancer cell Eca109, working concentration 5nM.
HES2-AON#1:5'-GCTCACTAGTCCACTA-3'(SEQ ID NO:7)；
HES2-AON#2:5'-GCTGGTTAGATCTTAC-3'(SEQ ID NO:8)；
HES2-AON#3:5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9)；
HES2-AON#4:5'-AAGCAAGAGGTGGCAA-3'(SEQ ID NO:10)；
HES2-AON#5:5'-TCCAGAGTCAAGCAAG-3'(SEQ ID NO:11).
1) qRT-PCR detect antisense oligonucleotides chain silencing HES2 gene after esophageal squamous cell system in HES2 mRNA
Expression.
Method collects above-mentioned negative control group and experimental group totally 6 groups of cells, is utilized respectively Trizol and extracts RNA, uses
MMLV reverse transcriptase (Promega) carries out reverse transcription and synthesizes cDNA, using 2X SYBR mix (Roche) in group of cells
The expression of HES2 carries out qRT-PCR detection.
Internal reference is done with GAPDH.Q-PCR primer used are as follows:
HES2-QF:AACCAGAGCCTGAGCCAGCTTA(SEQ ID NO:1)
HES2-QR:TGCAGGAAGCGCACGGTCATTT(SEQ ID NO:2)
GAPDH-QF:GCACCGTCAAGGCTGAGAAC(SEQ ID NO:3)
GAPDH-QR:TGGTGAAGACGCCAGTGGA(SEQ ID NO:4)
The Ct value that the Ct value for the HES2 gene that each sample obtains subtracts its reference gene GAPDH is obtained into △ Ct, as a result
It is indicated with △ Ct, △ Ct value is higher, indicates that the expression of the gene is lower.
As a result: quantitative PCR result (A figure) in Fig. 4 display uses HES gene in AON treated esophageal squamous cell
MRNA expression be substantially reduced, the especially effect of AON#3 is the most significant.
2) HES2 in the esophageal squamous cell system after immunoblot experiment verifying antisense oligonucleotides chain silencing HES2 gene
Protein expression level.
Method extracts the total protein of above-mentioned negative control group and experimental group totally 6 groups of cells respectively；Using SDS-PAGE electrophoresis
After protein isolate, albumen is gone on nitrocellulose filter, skim milk closed protein；With in conjunction with HES2 protein-specific
Monoclonal antibody (primary antibody) is sufficiently combined with it, then with the secondary antibody specifically bound with primary antibody it is in connection after, it is aobvious to carry out fluorescence
Shadow, fixing；By picture scanning and quantitative analysis.
As a result: consistent with above-mentioned qRT-PCR result as shown in the B figure in Fig. 4, using AON, treated that esophageal squamous cell carcinoma is thin
The protein expression level of HES gene is substantially reduced in born of the same parents, and the especially effect of AON#3 is the most significant.As it can be seen that by experiment from 5
Verifying obtains the most effective AON for lowering HES2 expression and targets sequence HES2-AON#3 in different AON.
(3) experiment in vivo
1) tumor formation is tested in Mice Body
Method: carrying out cancer model in building Mice Body first, by 1 × 106A esophageal cancer cell Eca109 carries out mouse
Subcutaneous injection starts to carry out HES2-AON#3 (experimental group) or the injection of PBS (control group) in subcutaneous tumors after culture 1 week.
As a result: as shown in the C figure in Fig. 4, compared with the control group, gross tumor volume is significantly less than control group to processing group, shows
Silencing HES2 can significantly inhibit the size of the internal formation tumour of esophageal cancer cell.
2) mouse lung metastasis model
Method: through mouse tail vein injection 1 × 105A Eca109 cell after cultivating 1 week in vivo, passes through intraperitoneal injection
The case where HES2-AON#3 (experimental group) or PBS (control group), observation mouse Lung metastases.
As a result: as shown in the D figure in Fig. 4, with the growth ability of the metastatic lung cancer of the Eca109HES2-AON mouse handled
Decline, shows that silencing HES2 can inhibit the Lung metastases ability of esophageal cancer cell.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Zhongshan Univ. Cancer Cure Center (Tumor Hospital Attached to Zhongshan Univ., institute of oncology of Zhongshan University)
Guangzhou Jie Erke Bioisystech Co., Ltd
<120>application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment
<130>
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
aaccagagcc tgagccagct ta 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
tgcaggaagc gcacggtcat tt 22
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
gcaccgtcaa ggctgagaac 20
<210> 4
<211> 19
<212> DNA
<213>artificial sequence
<400> 4
tggtgaagac gccagtgga 19
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ctggagcacc tgtggcggag 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
gccttgcgac agctaccgcg 20
<210> 7
<211> 16
<212> DNA
<213>artificial sequence
<400> 7
gctcactagt ccacta 16
<210> 8
<211> 15
<212> DNA
<213>artificial sequence
<400> 8
gctggttaga tctta 15
<210> 9
<211> 16
<212> DNA
<213>artificial sequence
<400> 9
gtgaaattga tgctcg 16
<210> 10
<211> 16
<212> DNA
<213>artificial sequence
<400> 10
aagcaagagg tggcaa 16
<210> 11
<211> 16
<212> DNA
<213>artificial sequence
<400> 11
tccagagtca agcaag 16
Claims (10)
1. the reagent of quantitative detection HES2 is preparing the application in esophageal squamous cell carcinoma auxiliary diagnosis or/and Prognosis product.
2. application according to claim 1, which is characterized in that the reagent of the quantitative detection HES2 is selected from quantitative detection
At least one of the reagent of the rna transcription level of HES2, reagent of protein expression level of quantitative detection HES2.
3. application according to claim 2, which is characterized in that the reagent of the rna transcription level of the quantitative detection HES2
Primer or probe selected from quantitative detection HES2.
4. application according to claim 3, which is characterized in that the primer of the quantitative detection HES2 are as follows:
Upstream primer: 5'-AACCAGAGCCTGAGCCAGCTTA-3'(SEQ ID NO:1)；
Downstream primer: 5'-TGCAGGAAGCGCACGGTCATTT-3'(SEQ ID NO:2).
5. application according to any one of claims 1 to 4, which is characterized in that the product is kit or chip.
6. inhibiting application of the reagent of HES2 expression in preparation treatment or adjuvant treatment esophageal squamous cell carcinoma product.
7. application according to claim 6, which is characterized in that the reagent for inhibiting HES 2 to express is selected from silencing HES2
At least one of the antisense oligonucleotides chain of shRNA, silencing HES 2 expression of siRNA, silencing the HES2 expression of expression.
8. application according to claim 7, which is characterized in that the siRNA's or shRNA of the expression of silencing HES 2
It targets sequence and is selected from following at least one:
5'-CTGGAGCACCTGTGGCGGAG-3'(SEQ ID NO:5)；
5'-GCCTTGCGACAGCTACCGCG-3'(SEQ ID NO:6).
9. application according to claim 6, which is characterized in that the antisense oligonucleotides chain of the silencing HES2 expression is selected from
Following at least one:
HES2-AON#1:5'-GCTCACTAGTCCACTA-3'(SEQ ID NO:7)；
HES2-AON#2:5'-GCTGGTTAGATCTTAC-3'(SEQ ID NO:8)；
HES2-AON#3:5'-GTGAAATTGATGCTCG-3'(SEQ ID NO:9)；
HES2-AON#5:5'-TCCAGAGTCAAGCAAG-3'(SEQ ID NO:11).
10. according to the described in any item applications of claim 6~9, which is characterized in that the product is medicament or health care product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810824526.XA CN109055548B (en) | 2018-07-25 | 2018-07-25 | Application of gene HES2 in auxiliary diagnosis, prognosis judgment and treatment of esophageal squamous cell carcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810824526.XA CN109055548B (en) | 2018-07-25 | 2018-07-25 | Application of gene HES2 in auxiliary diagnosis, prognosis judgment and treatment of esophageal squamous cell carcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055548A true CN109055548A (en) | 2018-12-21 |
| CN109055548B CN109055548B (en) | 2021-09-21 |
Family
ID=64836065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810824526.XA Active CN109055548B (en) | 2018-07-25 | 2018-07-25 | Application of gene HES2 in auxiliary diagnosis, prognosis judgment and treatment of esophageal squamous cell carcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055548B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111128385A (en) * | 2020-01-17 | 2020-05-08 | 河南科技大学第一附属医院 | Prognosis early warning system for esophageal squamous carcinoma and application thereof |
| CN114381527A (en) * | 2022-01-29 | 2022-04-22 | 中山大学孙逸仙纪念医院 | Novel biomarker for esophageal cancer immunotherapy prognosis and application |
| CN116500270A (en) * | 2023-06-30 | 2023-07-28 | 北京市肿瘤防治研究所 | Early warning metabolic marker for malignant esophageal lesions |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243161A (en) * | 2013-05-07 | 2013-08-14 | 中国医学科学院肿瘤医院 | Product for performing assisted prediction on postoperative survival time length of esophageal squamous carcinoma patient |
| CN103923982A (en) * | 2014-03-27 | 2014-07-16 | 南京市第一医院 | Function of HOXD-AS1 in diagnosis and treatment of esophageal squamous carcinoma |
| CN104774929A (en) * | 2015-03-18 | 2015-07-15 | 中山大学肿瘤防治中心 | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer |
| US20170067111A1 (en) * | 2004-12-07 | 2017-03-09 | Children's Hospital Medical Center | Evaluation of Eosinophilic Esophagitis |
| CN107519193A (en) * | 2017-08-31 | 2017-12-29 | 北京泱深生物信息技术有限公司 | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application |
-
2018
- 2018-07-25 CN CN201810824526.XA patent/CN109055548B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170067111A1 (en) * | 2004-12-07 | 2017-03-09 | Children's Hospital Medical Center | Evaluation of Eosinophilic Esophagitis |
| CN103243161A (en) * | 2013-05-07 | 2013-08-14 | 中国医学科学院肿瘤医院 | Product for performing assisted prediction on postoperative survival time length of esophageal squamous carcinoma patient |
| CN103923982A (en) * | 2014-03-27 | 2014-07-16 | 南京市第一医院 | Function of HOXD-AS1 in diagnosis and treatment of esophageal squamous carcinoma |
| CN104774929A (en) * | 2015-03-18 | 2015-07-15 | 中山大学肿瘤防治中心 | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer |
| CN107519193A (en) * | 2017-08-31 | 2017-12-29 | 北京泱深生物信息技术有限公司 | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application |
Non-Patent Citations (4)
| Title |
|---|
| KATOH M等: "identification and characterization of human HES2, HES3,and HES5 genes in silico", 《INT J ONCOL》 * |
| THERESA D AHRENS等: "Selective inhibition of esophageal cancer cells by combination of HDAC inhibitors and Azacytidine", 《EPIGENETICS》 * |
| 胡丽娜等: "HES1基因沉默可抑制食管腺癌OE33细胞的增殖、迁移及侵袭", 《肿瘤》 * |
| 萨巴亭: "《麻省总医院内科手册》", 30 September 2015, 世界图书西安出版公司 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111128385A (en) * | 2020-01-17 | 2020-05-08 | 河南科技大学第一附属医院 | Prognosis early warning system for esophageal squamous carcinoma and application thereof |
| CN111128385B (en) * | 2020-01-17 | 2020-11-10 | 河南科技大学第一附属医院 | Prognosis early warning system for esophageal squamous carcinoma and application thereof |
| CN114381527A (en) * | 2022-01-29 | 2022-04-22 | 中山大学孙逸仙纪念医院 | Novel biomarker for esophageal cancer immunotherapy prognosis and application |
| CN114381527B (en) * | 2022-01-29 | 2022-08-02 | 中山大学孙逸仙纪念医院 | Novel biomarker for esophageal cancer immunotherapy prognosis and application |
| CN116500270A (en) * | 2023-06-30 | 2023-07-28 | 北京市肿瘤防治研究所 | Early warning metabolic marker for malignant esophageal lesions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055548B (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102321760A (en) | Non-small cell lung cancer (NSCLC) marker and its application | |
| CN106148538B (en) | MicroRNA marker group and its preparing the application in evaluating breast cancer chemosensitivity kit | |
| CN109055548A (en) | Application of the gene HES2 in esophageal squamous cell carcinoma auxiliary diagnosis, Index for diagnosis and treatment | |
| CN107326071B (en) | Application of PLPP4 as non-small cell lung cancer diagnosis, treatment and prognosis target | |
| CN109423517B (en) | Use of exosomes in tumor diagnosis, treatment and prognosis evaluation | |
| CN108531596A (en) | A kind of application of lncRNA as biomarker in gastric cancer diagnosis and treatment | |
| CN109880902A (en) | A kind of application of long-chain non-coding RP11-499F3.2 in head and neck cancer clinical detection and the treatment of reversing tumor Cetuximab drug resistance | |
| CN110225984A (en) | Identify the method and therapeutic choice of risk of cancer | |
| CN104711341B (en) | DLK1 gene is preparing the application in gastrointestinal stromal tumor diagnostic reagent | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN117144007A (en) | Application of PIK3CA mutation with high 5-LOX expression as Luminal breast cancer prognosis marker | |
| Sun et al. | MicroRNA-92a regulates the development of cutaneous malignant melanoma by mediating FOXP1. | |
| CN109251982B (en) | Mutant sequence of ADGRG6 enhancer, detection method, specific primer pair used and application | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN106916887B (en) | Application of the ERH genes in carcinoma of urinary bladder diagnosis and treatment product is prepared | |
| CN113832226B (en) | Method for researching correlation between GNL3 and liver cancer development and application of GNL3 as liver tumor stem cell and liver cancer marker | |
| CN111778333B (en) | Application of reagent for determining EDAR expression level and kit | |
| CN106039312B (en) | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent | |
| CN113502329A (en) | Application of reagent for detecting adenosine receptor A2B expression level in preparation of kit for diagnosis and/or prognosis of lung adenocarcinoma | |
| CN106521022A (en) | Application of SET gene in preparing product for diagnosing and/or treating gastric cancer | |
| CN109251983B (en) | FRS2 gene copy number amplification and application thereof, and specific primer pair for detecting copy number amplification | |
| CN103083686B (en) | Application of DKK4 gene and coding protein thereof in preparation of medicament | |
| CN103800918B (en) | The application in preparing anti-tumor drug of a kind of Microrna | |
| CN105582536B (en) | Application of AGPAT9 gene in preparation of liver cancer treatment drug and diagnosis and prognosis evaluation reagent | |
| CN104878012B (en) | Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |