CN104878012B - Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit - Google Patents
Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit Download PDFInfo
- Publication number
- CN104878012B CN104878012B CN201510266985.7A CN201510266985A CN104878012B CN 104878012 B CN104878012 B CN 104878012B CN 201510266985 A CN201510266985 A CN 201510266985A CN 104878012 B CN104878012 B CN 104878012B
- Authority
- CN
- China
- Prior art keywords
- brachyury
- mir
- kit
- diagnosis
- micrornas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to technical field of biomedical detection, the present invention filters out using microRNA chip technologies regulated and controled by Brachyury after some microRNAs for significantly raising occur, and a series of this microRNAs have been carried out with Real Time PCR checkings.The invention provides the molecular marked compound of Brachyury positive tumors, significantly high expression is presented in the 5p of molecular marked compound miR 3200 in patients with lung cancer, and expression exception is then had no in other lung's solid lesion patients and normal population.Present invention also offers applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit.The 5p of miR 3200 of the present invention can carry out examination in tumorigenic early stage or diagnosis, the saving of early treatment and medical treatment cost for tumour are all significant.
Description
Technical field
The present invention relates to technical field of biomedical detection, is that microRNAs is preparing early screening or diagnosis
Application in Brachyury positive tumors reagent or kit.
Background technology
Lung cancer is current global death rate highest malignant tumour.Annual about 170,000 people in the U.S. die from lung cancer, account for whole
The 30% of body number of cancer deaths.With the fast development of economy and the increasingly exacerbation of air pollution, the lung cancer morbidity rate in China
Also the trend risen year by year is presented, has become the first cause of China's urban population cancer mortality.According to statistics, patients with lung cancer
Five year survival rate is only 5-15%, and it has occurred that not main reason is that be difficult to early detection, during most of patient assessment
With the transfer of degree.Such as die from the postmortem of the patient of lung cancer, there is 90% or so backbone metastatic lesion can all occur, lung cancer turns
Move into as the major reason of the short poor prognosis of patient survival, and the great pain of metastatic lesion also make it that the life quality of patient is tight
Decline again, accelerate the dead process of patient.Turn although the treatment for lung cancer metastasis is suited the medicine to the illness by original passiveness in the world
To be aided with the synthesis sexual norm of the Multidisciplinary Cooperations such as chemotherapy, radiotherapy, targeted therapy based on surgical operation, the life cycle of patient and
Life quality is improved to a certain extent, but due to lacking simple and effective methods for screening and lung cancer is occurred
With metastasis cognition deficiency, the limitation of therapeutic modality, lung cancer is still the major reason for causing mortality high.
Low-dose CT scanning is mainly applied in the examination for High Risk of Lung Cancer crowd in the world at present, but due to of a relatively high cost and spoke
Penetrate the extensive use for constraining it clinically.Based on above reason, early detection occurs to tumour and transfer process is related
Molecular diagnostic markers thing can think that the regular hour is got in oncotherapy, turn into the important channel of control tumor development.In order to
Reach this purpose, first have to find out compared to normal somatic cell, occur in lung cancer it is specific expressed change and with transfer etc.
The closely related tumour of kinds of tumors development process " target spot ", that is, find has phase with alpha-fetoprotein (AFP) famous in liver cell
Like the tumor marker of point.
" tumor targets " this concept is widely recognized as and has carried out substantial amounts of research already, and the core of this concept is to look for
It is straight by " biological missile " to specific expressed only in tumour and do not express in the normal tissue or the molecule of limitation expression
Tumour is hit, normal tissue causes the destruction minimized.The appearance of this concept and the numerous studies carried out therewith just gradually make
The exclusive feature instantiated of tumour, and final " without being stealthy " is possible to, also the mankind are grasped in the struggle with tumour
Certain initiative.Early detection and effectively treatment to tumour are all of great importance.
TATA-box transcription factors Brachyury is one of member of T-box transcription factor families, and its autoploid is many
Expressed in multicellular organism body, expression is (referring to document in such as C. Elegans Automatic Screening, xenopous laevis, mouse, mankind embryo
Papaioannou VE,Silver LM,et al.The T-box gene family.Bioessays 1998；20:9-
19.Kispert A,Herrmann BG,et al.Homologs of the mouse Brachyury gene are
involved in the specification of posterior terminal structures in Drosophila,
Tribolium,and Locusta.Genes Dev 1994；8:2137-50.Herrmann BG,Labeit S,et
al.Cloning of theTgene required in mesoderm formation in the mouse.Nature
1990；343:617-22).T-box albumen mainly plays an important roll in mesoblastic formation and differentiation, in embryonic development evening
Phase then closes expression in most tissues and concentrates merely on the expression of notochord area, and is disappeared after backbone is formed with the degeneration of notochord
And do not expressed in most of normal adult tissues, only there is the limitation for having low expression level in expression, spleen and small intestine in testis
Property expression way is (referring to document Duane H.Hamilton, Ph.D., Postdoctoral Fellow, et al.Cancer
vaccines targeting the epithelial-mesenchymal transition:tissue distribution
of Brachyury and other drivers of the mesenchymal-like phenotype of
carcinomas.Semin Oncol.2012Jun；39(3):358-66.).However, in known mankind's kinds of tumors tissue and
In cell line, Brachyury but shows high-caliber expression, and these tumor tissues and tumor cell line are：Small intestine, stomach, kidney,
Bladder, uterus, ovary, testis, brain and lymphoid tissue, lung tissue, colon and prostata tissue source cell line (referring to
Document Palena C, Polev DE, et al.The human T-box mesodermal transcription factor
Brachyury is a candidate target for T-cell-mediated cancer immunotherapy.Clin
Cancer Res.2007 Apr 15；13(8):2471-8.Park JC,Chae YK,et al.Epigenetic
silencing of human T(brachyury homologue)gene in non-small-cell lung
cancer.Biochem Biophys Res Commun.2008 Jan 11；365(2):221-6.).Above result of study all carries
Show that Brachyury can apply in the tumor diagnosis and therapy in a variety of sources.However, how to apply high table in tumor tissues
The Brachyury reached carries out tumor screening non-invasive in early days to crowd or carries out clinical diagnosis but without specific effective method
And research.As transcription factor, Brachyury has the function that powerful startup or suppresses downstream gene transcription, therefore, passes through
Detect some easily the detection molecules such as Extracellular proteins or miRNA being adjusted downstream expression quantity can using as
The index of Brachyury expressions.
MicroRNA is only 20-24bp non-coding short nucleotide fragment, has stable expression in peripheral blood
Spectrum, and asexuality difference, and significant changes then occur for the microRNAs express spectras of tumor patient (referring to document Chen X, Ba
Y,et al.Characterization of microRNAs in serum:a novel class of biomarkers
for diagnosis of cancer and other diseases.Cell Res.2008Oct；18(10):997-1006.)
Protected when going out cell due to microRNAs by lipid microbubble (Micro vesicle), therefore can keep stable, be easy to detect,
, can in body fluid such as peripheral blood, sputum, saliva, leural effusion in frozen tissue, formalin-fixed tissue, paraffin organization
Detected, and because microRNA fragments are shorter, greatly reduce testing cost, therefore, it is as non-invasive tumour early stage
The research of diagnostic marker is increasing (referring to document Du M, Liu S et al.Clinical potential role of
circulating microRNAs in early diagnosis of colorectal cancer
patients.Carcinogenesis.2014 Sep 19.Jeong HC.Clinical Aspect of MicroRNA in
Lung Cancer.Tuberc Respir Dis(Seoul).2014Aug；77(2):60-4.)
According to literature search, the function for miR-3200-5p and expression in the world has no report, is only directed to core at one
It may be NF- κ B target base that miR-3200-3p is found in the research of factor K appa B (NF- κ B) downstream micorRNAs express spectras
Cause.Effect in lung cancer occurrence and development and diagnosis also has no report.
Current studies there is not yet the microRNAs associated with tumour-specific target is as tumour (including lung cancer etc.)
The label of early diagnosis, also there has been no be directed to for detecting a series of kit of this microRNAs content in serum
Tumour (including lung cancer etc.) patient that part has Brachyury overexpressions carries out examination.
The content of the invention
It is an object of the invention to search out the tumor molecular marker related to the high expression lung cancer of Brachyury, this hair
Bright another object is that providing a certain microRNA is preparing early screening or clinical diagnosis Brachyury positive tumor reagents
Or the application in kit.
The main technical schemes of the present invention：In order to find the microRNAs regulated and controled by Brachyury, the present inventor is in lung
In cancer cell H1299 and conduct normal human's control cell 293T exogenous Brachyury is transferred to using slow-virus infection technology
CDS sequences be allowed to reapply after being successfully overexpressed microRNA chip technologies filter out regulated and controled by Brachyury after occur it is aobvious
Reconcile some microRNAs of downward on work.And real-time quantitative PCR is carried out to a series of this microRNAs
(quantitative RT-PCR) is verified.Then to clinically patients with lung cancer, chronic obstructive pneumonia patient, be similarly
Found in chordoma patient positive Brachyury and the sampled plasma of normal population and detection, hsa- in microRNAs groups
MiR-3200-5p is presented significantly high expression in patients with lung cancer, and chordoma patient, other lung's solid lesion patients and
Expression exception is then had no in normal population.
Shown in the microRNA array experiment results of early stage：Hsa-miR-34a and has-miR-22 is in Brachyury sun
Property patients with lung cancer in also there occurs notable up-regulation, these microRNAs are reported in peripheral blood from patients with lung cancer occur on
Adjust, author think with as lung cancer specific diagnosis label value (Franchina T, Amodeo V,
Circulating miR-22,miR-24 and miR-34a as novel predictive biomarkers to
pemetrexed-based chemotherapy in advanced non-small cell lung cancer.J Cell
Physiol.2014 Jan；229(1):97-9.).On the one hand document above result illustrates the research side that the present inventor is taken
The reliability of method, on the other hand also show that the microRNAs regulated and controled by Brachyury can be used as potential pulmonary cancer diagnosis
Label.A series of microRNAs in the present invention are by the experiment of molecular level and the checking of clinical patients sample, in lung cancer
Diagnosis in there is very strong specificity, and using reverse transcription association aggregation PCR (RT-PCR) as detection basis,
By the detection of a small amount of peripheral blood to people at highest risk and clinical imageology difficult diagnosis come examination prediction and diagnosing tumour
Occur, be feasible.
The first aspect of the invention, it there is provided the molecular marked compound of the tumour related to the high expression of Brachyury, institute
The molecular marked compound stated is microRNA-3200-5p.
Described miR-3200-5p particular sequence is as follows：
hsa-miR-3200-5p AAUCUGAGAAGGCGCACAAGGU MIMAT0017392
(SEQ ID NO:1)
Described " tumour related to the high expression of Brachyury " i.e. " Brachyury positive tumors ", refers in the tumour
Brachyury shows the tumour of the grade malignancy higher (multiplication capacity is relatively strong) of high level expression, including but not limited to lung
Cancer, melanoma, breast cancer, carcinoma of small intestine, stomach cancer, kidney, carcinoma of urinary bladder, uterine cancer, oophoroma, carcinoma of testis, the cancer of the brain, lymph cancer,
Colon cancer, prostate cancer etc..
In a preferred embodiment of the invention, there is provided described miR-3200-5p is preparing lung cancer early screening
Or the application in diagnostic kit.
The present invention can be used for carrying out early screening to High Risk of Lung Cancer crowd and doubtful patients with lung cancer and diagnosis, the present invention pass through
The content of miR-3200-5p in corresponding crowd's peripheral blood, early screening or diagnosis Brachyury positive lung cancer patients are detected, with
Phase is intervened or treated early, prevention transfer, and extending patient survival to greatest extent reduces the death rate.
The present invention is filtered out in lung carcinoma cell model a series of by outer-gene expression control technique
MicroRNAs and the collection and checking for having carried out clinical samples, and find miR-3200-5p containing in peripheral blood from patients with lung cancer
The relatively other pulmonary parenchyma lesions of amount and normal population are that generation is significantly elevated, and have obvious statistical significance.Illustrate this
The change of one microRNA contents in peripheral blood, can be as the molecular labeling of pulmonary cancer diagnosis.
The second aspect of the present invention, it there is provided miR-3200-5p and preparing early screening or the diagnosis Brachyury positives
Application in tumor reagent or kit, described reagent specifically refer to detect the oligonucleotide of miR-3200-5p expression quantity；
Described kit specifically refers to include the oligonucleotide of detection miR-3200-5p expression quantity.
The invention provides the oligonucleotide for detecting miR-3200-5p, described oligonucleotide includes：Reversion
Record primer, PCR sense primers, PCR anti-sense primers.
In a preferred embodiment of the invention, the specific of the oligonucleotide of above-mentioned microRNAs expression quantity is detected
Sequence is as follows：
The present invention specificity PCR primer be according to known to microRNAs storehouses (http:// www.mirbase.org/) the ripe body sequence that retrieves carries out design of primers.
Further, present invention also offers the kit of detection microRNAs expression quantity, the kit to include such as
SEQ ID NO:Sequence shown in 2；
The kit of the detection microRNAs expression quantity of the present invention, described kit also include：
Arm's length standard product：Described arm's length standard product are made up of the microRNAs mixtures for meeting average value content；
In a preferred embodiment of the invention, kit of the invention, including following components：
A.Real-Time PCR specific amplification sense primers, 1 pipe 10uM concentration, 100uL/ pipes；
The general reversely anti-sense primer (Qiagen) of B.Real-Time PCR amplifications, 1 pipe 10uM concentration, 100uL/ pipes；
C. arm's length standard product, 1 pipe, 10uM concentration, 100uL.
The third aspect of the present invention, there is provided the side of the microRNA expression quantity is detected using above-mentioned oligonucleotide
Method, namely applications of the miR-3200-5p in preparing early screening or diagnosing Brachyury positive tumors reagent or kit
Specific detection method, comprises the following steps：
Total serum IgE in sampling originally, add μ L of 5 × miScript HiSpec Buffer 2, the μ of 10 × Nucleics Mix 1
L, the μ L of miScript Reverse Transcriptase Mix 0.5, Nuclease-free H2O are mended to total amount 10 μ L, ABI
After 37 DEG C of insulation 60min make reverse transcription reaction complete in 9700 type PCR instruments, 95 DEG C of 5min terminating reactions.Using EASY
Arm's length standard product in Dilution dilution kits, are added into reaction system using the cDNA of institute's reverse transcription as templateIt is μ L of 480 SYBRGreen I Master 5, the μ L of fragments specific PCR primer 0.2, cDNA 1 μ L, logical
With the μ L of reverse transcription primer (Qiagen) 0.2, Nuclease-free water is added to mend anti-by reverse transcription association aggregation enzyme chain type to 10 μ L
(RT-PCR) is answered to detect above-mentioned microRNAs expression quantity.
The blood sample (being not excluded for body fluid sample and sample of hair) of the sample, preferably people, i.e. serum sample or blood plasma
Sample.
It can be monitored using the reagent or kit of the present invention or high-risk in the early stage that obvious Imageology not yet occurs
Brachyury positive tumors (lung cancer) in crowd.
By the use of the standard items in kit as normal control, the peripheral blood of any tested crowd is taken to carry out always
MicroRNAs extractings, reverse transcription and PCR amplifications, are compared with standard items result, confirm the group of subject's peripheral blood
Whether microRNAs raises, if raising, you can it is Brachyury positive tumor (lungs to primarily determine that the subject
Cancer) patient, it can be further monitored by iconography, be easy to carry out early treatment to subject.
The kit of the present invention carries out early stage Brachyury positive tumor (lung cancer) detection method, concretely comprises the following steps：
Subject periphery anticoagulation 4-5ml is taken, centrifugation collects blood plasma, takes 200ul blood plasma with Blood miRNA kit twice
Total microRNAs is extracted, after the reverse transcription primer reverse transcription in kit, is carried out jointly with the standard items in kit
Real-Time PCR expand, determine subject's peripheral blood in this group of microRNAs content, and with the detection data of standard items
It is compared, whether identification raises.
MiR-3200-5p in the present invention is directed to the specific tumour target spot of limiting expression in normal adult's body
Tumor patient positive Brachyury carries out early screening and the diagnosis of tumour, and its specificity and sensitivity are significantly higher than at present
Each related neoplasms diagnostic marker clinically used, can be diagnosed in tumorigenic early stage, not only increase diagnosis
Accuracy, and provide foundation for the preclinical discovery of tumour, the saving of early treatment and medical treatment cost for tumour
It is all significant.The miRNA combination thing can be applied in the reagent or instrument for preparing detection Brachyury positive tumors.
Tumour early screening and diagnosis can be carried out for normal population.
Brief description of the drawings
Fig. 1：After exogenous transcriptional factor B rachyury being transferred in lung cancer cell line H1299 using slow virus, control group
Cell carries out immunofluorescence in situ detection Brachyury expression and expression efficiency with being overexpressed Brachyury groups cell.
It can be seen that Brachyury expression and localizations in H1299 cell lines are nucleus (transcription factor), expression efficiency be 60% with
On；
Fig. 2：Foregoing overexpression Brachyury H1299 cells have carried out microRNAs cores with empty vector control group cell
Piece analyzes (biology repetition three times), and the prompting of thermal map RED sector is the miR- for being overexpressed and being raised after Brachyury
3200-5p.Wherein EV1, EV2, EV3 are the biology repeat samples three times of empty vector control group；T1, T2, T3 are overexpression
Brachyury biology repeat samples three times；
Fig. 3：Hsa-miR-3200-5p is detected in 10 random patients with lung cancer, 10 healthy volunteers using the kit
With the content of miR-3200-5p in 10 chronic obstructive pneumonia (COPD) peripheral blood in patients, with Δ Δ CT values, (Δ Δ circulates
Number) trend expression, it can be seen that compared to healthy population, the miR-3200-5p expressions of COPD patient do not have and had
The change of statistical significance, and then occur the differentiation of miR-3200-5p expressions in patients with lung cancer, some patientss miR-
3200-5p expression is substantially increased；
Fig. 4：SABC detection is carried out to the tissue specimen of above-mentioned 10 random patients with lung cancer, wherein figure A is
Brachyury height expression groups and the level of miR-3200-5p in Brachyury low expression group peripheral blood in patients；Figure B is immune group
Change the Brachyury expression differences detected, left figure is Brachyury negative, and nucleus is blue to be contaminated, and right figure is
Brachyury is positive, nuclear area palm fibre dye (Brachyury is transcription factor, and Subcellular Localization is nucleus).It was found that 3
The high patient of peripheral blood miR-3200-5p expressions is all Brachyury positive expressions, the miR- of remaining 6 Patients with Peripheral blood
3200-5p expressions have no that its tissue of elevated patient shows as Brachyury feminine genders 6, and Brachyury is positive 1；
Fig. 5：Expression of the Brachyury expression and hsa-miR-3200-5p in peripheral blood in patients is in just
Pertinent trends；
Fig. 6：Hsa-miR-3200-5p is in healthy population, Brachyury in the total microRNAs of kit amplification peripheral blood
The embryonic period, embryonic phase notochord residual tumor chordoma (Chordoma) of specific positive expression, Brachyury positive patients with lung cancer,
Expression in Brachyury feminine genders patients with lung cancer and COPD patient, with the standard items in kit as normal control,
It is corrected by outer ginseng gene, obtained result shows that hsa-miR-3200- is presented in the positive patients with lung cancer of Brachyury
Statistically significant 5p up-regulation (show that hsa-miR-3200-5p is not only relevant with Brachyury expressions, also with tissue
Specificity is relevant)；
Embodiment
In conjunction with embodiment and accompanying drawing, the invention will be further described, but the implementation of the present invention is not limited to that.
Embodiment 1：The preparation of kit of the present invention
To find the microRNAs regulated and controled by tumour-specific transcription factor Brachyury, the present inventor is in one plant of lung cancer
Cell line H1299 and it is transferred to exogenous Brachyury's using slow-virus infection as in the 293T of normal human's control cell
Cds sequences be allowed to be overexpressed after reapply microRNA chip technologies filter out regulated and controled by Brachyury after occur significantly up-regulation
Some microRNAs (see Fig. 1, Fig. 2).
Verify that these microRNAs expression change is consistent with chip results by Real-Time PCR.Then to facing
Found on bed in patients with lung cancer, the sampled plasma of chronic obstructive pneumonia patient and normal population and detection, microRNAs groups
Significantly high expression is presented in middle hsa-miR-3200-5p in patients with lung cancer, and in other lung's solid lesion patients and normally
The notable exception of expression is then had no in crowd.
Embodiment 2：The preparation of kit of the present invention
Kit forms composition of the present invention is：
A. specific reverse transcription primer 2 pipe 10uM concentration, 200uL；
B.Real-Time PCR specific amplifications sense primer 1 manages (A) 10uM concentration, 200uL/ pipes；Real-Time
PCR amplification anti-sense primer 1 pipe 10uM concentration 2mL/ pipes；
C. the standard items 1 containing quantitative microRNAs are managed；(this kit does not include outer ginseng gene)
This group of microRNAs specific reverse transcriptions primer is to add fixed Loop (ring knots according to ripe microRNAs sequences
Structure) fragment, then synthesized by invitrogen companies of the U.S., purity is PAGE levels, the primer DEPC H after synthesis2O is molten
Solution, final concentration of 10 μM.
Specific microRNAs upstream and downstream primers：Experience sequence is added simultaneously according to ripe microRNAs specific sequences
Make Tm values consistent with anti-sense primer by software adjustment G/C content.Anti-sense primer be reverse transcription primer on fixed sequence program, primer
All synthesized by invitrogen companies of the U.S., purity is PAGE levels, the primer DEPC H after synthesis2O dissolves, final concentration of
10μM。
Standard items are the reversion for meeting healthy this group of microRNAs expression of normal human peripheral blood authenticated after testing
Record sample mixes, and wherein miR-3200-5p content is fixed on healthy population average level.Carry out per a batch of tested
During crowd monitoring, it is both needed to while PCR expands the standard items to carry out result comparison.
Embodiment 3：The detection method of this kit
(1) plasma sample, extracting microRNAs and reverse transcription, are gathered：
Collection peripheral blood, which carries out detection, has the advantages that hurtless measure, collection are convenient, therefore, by gathering and detecting peripheral blood
In a series of examination of microRNAs molecular marked compounds to carry out lung cancer early stage not only easily popularize, and there is accuracy
The advantages of high, the Brachyury positive lung cancers of early stage can be found in time, early treatment, raising patient's life are found so as to reach early
Deposit the purpose of rate.
Checking plasma sample gathers from inpatient department of Shanghai Long March Hospital and outpatient service, and 30 primary lung cancers or lung cancer bone turn
Move sample (choosing the patient 10 wherein through the authenticated Brachyury expressions of SABC), 30 healthy volunteer's marks
This (randomly selecting wherein 10) and 30 chronic pulmonary substance inflammation (COPD) patient samples (randomly selecting wherein 10)
Compare.A series of microRNAs that up-regulation is prompted in chip results is detected after the total microRNAs of extraction peripheral blood in patients, its
In, hsa-miR-3200-5p shows obvious lung cancer specificity trend, i.e., the expression in lung cancer is obvious compared with normal population
Increasing, the CT values shown as in patients with lung cancer are less than normal control population, and compared with normal person in chronic obstructive pneumonia patient
Group but has no notable expression change (Fig. 3).Detected Brachyury by SABC after Brachyury expressions
Its miR-3200-5p expression is presented in negative and Brachyury positive patients respectively, it can be seen that Brachyury is negative
7 patients, its miR-3200-5p expression 3 patients positive significantly lower than Brachyury, there is not false sun
The expression (Fig. 4) of property or false negative.Prompt this microRNA as lung cancer specific marker thing to have further to test
The value of card.
Inclusive criteria：
1st, in May, 2012 in October, 2014 is in the patient that this hospital diagnosis is primary lung cancer and bone metastases of lung cancer,
On condition that from medical records, all historical datas related to tumour can be obtained and tumor tissues SABC is detected as
Brachyury positive expressions；
2nd, patient and the detection of tumor tissues SABC of primary lung cancer or bone metastases of lung cancer are newly diagnosed as in the court
For Brachyury positive expressions；
3rd, primary or pulmonary metastasis are diagnosed as in the court or other medical institutions and SABC is detected as
Brachyury radiolucent tables are up to as a control group；
4th, chronic obstructive pneumonia, the pulmonary parenchyma venereal disease of pulmonary fibrosis newly diagnosed in the court or other medical institutions becomes
Patient is as a control group；
5th, normal population is as a control group；
Exclusion standard：
1st, other organization system tumor patients are excluded；
2nd, testis and colon site tumour or patients with chronic diseases are excluded；
3rd, the Pulmonary Disease patients that other non-pulmonary parenchyma venereal diseases become are excluded.
Blood specimen collection is carried out to the patient for meeting above-mentioned standard, peripheral blood 4-5mL is extracted, is placed in EDTA anticoagulant tubes, two
Supernatant is taken after secondary centrifugation, takes 400uL to carry out total microRNAs extractings.
Total small fragment in the standard test step extraction blood plasma provided using QIAGEN Blood microRNA kit
RNA。
The small fragment RNA extracted is inverted to cDNA：
After 37 DEG C of insulation 60min make reverse transcription reaction complete in the type PCR instruments of ABI 9700,95 DEG C of 5min terminating reactions.
(2), the Real-Time PCR amplifications of target gene：
Using TaKaRa SYBR Premix Ex TaqTMReagent and Applied Biosystems'：Real-time quantitative PCR
Instrument, enter performing PCR reaction：
Main experimental conditions are：60 DEG C of annealing temperature, 40 cycles (circulation)
This kit is located at the total of the crowd of median using miR-3200-5p expressions in normal population
The cDNA that microRNAs using miR-3200-5p specific reverse transcription primer amplification are inverted to is used as standard items, each reaction
Simultaneously standard items are entered with performing PCR amplification during progress, and detection sample is compared according to the amplification CT values of standard items, it is each
Individual sample carries out 3 multiple holes repetitions, joins ce-miR-39 in addition and is proofreaded, passes through 2-△△CtMethod calculates known in detection sample
The relative quantification value of one group of microRNAs expression.And one group in the detection sample is calculated by the T methods examined
MicroRNAs whether there is unconventionality expression.
Embodiment 4：This group of microRNAs expressions detection of primary lung cancer or pulmonary metastasis peripheral blood in patients
According to previous experiments method, choose 10 primary/pulmonary metastasis patient and (clearly go out by SABC detection
3 Brachyury positive patients and 7 Brachyury negative patients) the progress qPCR amplifications of peripheral blood plasma specimen, with standard
Product (being set to 1) find the miR-3200-5p expressions in the positive peripheral blood from patients with lung cancer of Brachyury after being compared
There occurs statistically significant up-regulation, P<0.05.Brachyury positive patients miR-3200-5p is averagely raised respectively
16.78 times, 10.25 times, 12.37 times.And the hsa-miR-3200-5p of Brachyury feminine gender patients with lung cancer then has no up-regulation (figure
4).Brachyury expressions are proportionate (Fig. 5) with miR-3200-5p expressions.
Embodiment 5：Other Brachyury positive tumors peripheral blood in patients miR-3200-5p expressions detections
Also according to previous experiments method, 10 chordoma (Chordoma) peripheral blood in patients plasma specimens of selection are carried out
QPCR is expanded, compared with standard items after find expressions of the miR-3200-5p in chordoma peripheral blood in patients not
Statistically significant up-regulation occurs.The miR-3200-5p up-regulation times in the peripheral blood that these randomly select patients with COPD
Count the up-regulation (Fig. 6) that most one are about 1.5 times.It is positive that the highest up-regulation multiple of chordoma group is also not up to Brachyury
The upper level-off of patient (Fig. 6).
Infer accordingly, miR-3200-5p is marked as lung cancer specific diagnosis and detected with this kit, by with kit
In normal reference sample, i.e. standard items most compare, and can clearly distinguish the positive patients with lung cancer of Brachyury, and with this
Diagnostic clue is provided for clinic.
General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the simply explanation described in above-described embodiment and specification is originally
The principle of invention, various changes and modifications of the present invention are possible without departing from the spirit and scope of the present invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent defines.
Claims (8)
- Applications of the 1.miR-3200-5p in preparing early screening or diagnosing Brachyury positive tumors reagent or kit, its It is characterised by, described Brachyury positive tumors refer to lung cancer.
- 2. miR-3200-5p according to claim 1 is preparing early screening or diagnosis Brachyury positive tumor reagents Or the application in kit, it is characterised in that described Brachyury positive tumors refer to that Brachyury is presented in the tumour Go out high-caliber expression.
- 3. miR-3200-5p according to any one of claims 1 to 2 is preparing early screening or the diagnosis Brachyury positives Application in tumor reagent or kit, it is characterised in that described reagent refers to detect described microRNAs expression quantity Oligonucleotide；Described kit refers to the oligonucleotide for including the described microRNAs expression quantity of detection.
- 4. miR-3200-5p according to claim 3 is preparing early screening or diagnosis Brachyury positive tumor reagents Or the application in kit, it is characterised in that the oligonucleotide for detecting described microRNAs expression quantity draws including reverse transcription Thing, PCR specific primers.
- 5. miR-3200-5p according to claim 3 is preparing early screening or diagnosis Brachyury positive tumor reagents Or the application in kit, it is characterised in that the oligonucleotide sequences for detecting described microRNAs expression quantity include such as SEQ ID NO:2 sequence.
- 6. the miR-3200-5p according to claim 4 or 5 is preparing early screening or diagnosis Brachyury positive tumors Application in reagent or kit, it is characterised in that the kit includes following components：A.Real-Time PCR specific amplification sense primers, such as SEQ ID NO:Shown in 2,1 pipe, 10 μM of concentration, 100 μ L/ Pipe；B.Real-Time PCR expand general reverse anti-sense primer, such as SEQ ID NO:Shown in 3,1 pipe, 10 μM of concentration, 100 μ L/ Pipe；C. arm's length standard product, 1 pipe, 10 μM of concentration, 100 μ L/ pipes.
- 7. detect miR-3200-5p expression quantity oligonucleotide sequences prepare diagnosis Brachyury positive tumors reagent or Application in kit, it is characterised in that described oligonucleotide sequences include such as SEQID NO:2 sequence, it is described Brachyury positive tumors refer to lung cancer.
- 8. the oligonucleotide sequences of detection miR-3200-5p expression quantity according to claim 7 are preparing diagnosis Application in Brachyury positive tumors reagent or kit, it is characterised in that utilize described oligonucleotide to detect miR- The method of 3200-5p expression quantity comprises the following steps：Total serum IgE in sampling originally, add reverse transcription primer, 5 × PrimeScript Buffer, PrimeScript RT Enzyme Mix I、RNase Free dH2O reverse transcriptions dilute normal in kit into cDNA using EASY Dilution Standard items, PCR specific primers are added into reaction system as template using the cDNA of institute's reverse transcription, pass through reverse transcription association aggregation PCR detects miR-3200-5p expression quantity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510266985.7A CN104878012B (en) | 2015-05-22 | 2015-05-22 | Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510266985.7A CN104878012B (en) | 2015-05-22 | 2015-05-22 | Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104878012A CN104878012A (en) | 2015-09-02 |
| CN104878012B true CN104878012B (en) | 2018-03-09 |
Family
ID=53945688
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510266985.7A Expired - Fee Related CN104878012B (en) | 2015-05-22 | 2015-05-22 | Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104878012B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106815481B (en) * | 2017-01-19 | 2020-07-17 | 中国科学院深圳先进技术研究院 | Lifetime prediction method and device based on image omics |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357566A (en) * | 2014-11-04 | 2015-02-18 | 中国科学院北京基因组研究所 | Liver cancer detection kit |
| CN104498606A (en) * | 2014-12-16 | 2015-04-08 | 中国人民解放军第二军医大学 | Application of microRNAs in preparation of reagent or kit for early screening or diagnosing Brachyury positive tumors |
-
2015
- 2015-05-22 CN CN201510266985.7A patent/CN104878012B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357566A (en) * | 2014-11-04 | 2015-02-18 | 中国科学院北京基因组研究所 | Liver cancer detection kit |
| CN104498606A (en) * | 2014-12-16 | 2015-04-08 | 中国人民解放军第二军医大学 | Application of microRNAs in preparation of reagent or kit for early screening or diagnosing Brachyury positive tumors |
Non-Patent Citations (3)
| Title |
|---|
| T-Box转录因子brachyury调控脊索瘤细胞凋亡的作用与分子机制;矫健;《中国优秀硕士论文全文数据库（医药卫生科技辑）》;20121015(第10期);第1-79页 * |
| Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls;Daniela Witten等;《BMC Biology》;20100511;第8卷;Additional File 4 * |
| What makes a blood cell based miRNA expression pattern disease specific? - A miRNome analysis of blood cell subsets in lung cancer patients and healthy controls;Petra Leidinger等;《Oncotarget》;20140919;第5卷(第19期);第9484-9496页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104878012A (en) | 2015-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kutwin et al. | Urine miRNA as a potential biomarker for bladder cancer detection–a meta-analysis | |
| CN104152452B (en) | A kind of blood miRNA marker relevant to hepatocarcinoma and application thereof | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| US20190185944A1 (en) | Methods for diagnosing and treating esophageal cancer | |
| CN104498606B (en) | Application of microRNAs in preparation of reagent or kit for early screening or diagnosing Brachyury positive tumors | |
| CN104152567B (en) | MiRNA-199a is preparing the purposes in diagnostic kit | |
| CN107881239B (en) | miRNA marker related to colorectal cancer metastasis in plasma and application thereof | |
| CN106191055A (en) | A kind of non-small cell lung carcinoma marker, detectable and test kit | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| Ren et al. | Exploration of differentially-expressed exosomal mRNAs, lncRNAs and circRNAs from serum samples of gallbladder cancer and xantho-granulomatous cholecystitis patients | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| CN108004323B (en) | miRNA marker related to colorectal cancer metastasis in tissue and application thereof | |
| CN104878012B (en) | Applications of the 5p of Hsa miR 3200 in preparing early screening or diagnosing Brachyury positive tumors reagent or kit | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN102021169A (en) | Serum/plasma miRNA composition and use thereof | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CA2939343A1 (en) | Mir-320e and colorectal cancer | |
| CN107746887A (en) | LncRNA compositions and the purposes for preparing diagnosis indication Luminal A type Bone of Breast Cancer transfering reagent boxes | |
| CN107916291A (en) | LncRNA compositions and the purposes for preparing diagnosis three negative type breast cancers Bone tumour kits of indication | |
| CN106939354A (en) | MiRNA 4530 as pulmonary cancer diagnosis mark application | |
| CN109563548A (en) | For identifying the in-vitro method of cancer of pancreas or pancreatic intraductal papillary mucinous tumor | |
| CN104878013B (en) | Applications of the Hsa-miR-489-3p in preparing early screening or diagnosing Brachyury positive tumors reagent or kit | |
| CN104152566B (en) | The purposes of miRNA-26a | |
| CN108004318A (en) | The combination of serum miRNA marker and its application for early-stage breast cancer examination |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180309 |