CN106860879B - The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer - Google Patents
The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer Download PDFInfo
- Publication number
- CN106860879B CN106860879B CN201710126405.3A CN201710126405A CN106860879B CN 106860879 B CN106860879 B CN 106860879B CN 201710126405 A CN201710126405 A CN 201710126405A CN 106860879 B CN106860879 B CN 106860879B
- Authority
- CN
- China
- Prior art keywords
- gbp1
- mir
- expression
- cell
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4748—Quinolines; Isoquinolines forming part of bridged ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/58—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses the application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer.MiR-335-3p can obviously lower the expression of GBP1 gene in lung squamous cancer NCI-H520 cell, and luciferase reporter gene testing result shows that miR-335-3p can be with direct regulation and control GBP1 gene.Cell Proliferation viability examination the result shows that, miR-335-3p significantly inhibits the in-vitro multiplication of lung squamous cancer NCI-H520 cell by lowering GBP1 gene expression, and miR-335-3p is the inhibitor of GBP1 gene expression.Imperialine, Cycleanine and buxine significantly inhibit the growth of lung squamous cancer NCI-H520 transplantable tumor, GBP1 mRNA and protein expression level are significantly lowered in tumor tissues after imperialine, Cycleanine and buxine drug treatment, show that the expression of GBP1 gene can promote the growing multiplication of lung squamous cancer, imperialine, Cycleanine and buxine realize in vivo antitumor effect by lowering the expression of GBP1 gene.
Description
Technical field
The invention belongs to gene therapy medicament fields, and in particular to GBP1 gene and its inhibitor are in preparation treatment lung squamous cancer
Drug in application.
Background technique
Lung cancer is the most common malignant tumour in the whole world, and the death rate occupies first of malignant tumour.China's lung cancer morbidity rate present by
Year ascendant trend, average annual growth rate nearly 2%.There are many organization type, cancerous lung tissues according to the difference of Pathologic Characteristics for lung cancer
Type is different, and remedy measures are also different.Classified according to 2004 editions WHO, common cancerous lung tissue histological typing is divided into non-small thin
Born of the same parents' cancer (NSCLC) and small cell carcinoma (SCLC).Non-small cell carcinoma is divided into squamous cell carcinoma (SCC), gland cancer (AC) and maxicell again
Cancer (LCC).Different lung cancer clinical therapeutic schemes are different, and outcome is also different.Therefore, in order to improve therapeutic effect, lung cancer
Treatment mode of the therapeutic strategy from traditional based on by stages is changed into histological type and gene mutation as guidance
Individuation, accurately multimodality therapy mode.Individualized treatment improves treatment and the outcome of lung cancer.
About 80%-85% is non-small cell lung cancer in the patients with lung cancer of diagnosis, and wherein lung squamous cancer accounts for about 20%-30%, is belonged to
In a kind of common lung cancer histological type.Lung squamous cancer is treated in addition to traditional operation and chemicotherapy, and targeted therapy becomes it and controls at present
The important means for the treatment of.With epidermal growth factor recipient tyrosine kinase acceptor inhibitor (epidermal growth factor
Receptor tyrosine kinase inhibitor, EGFR-TKI) it comes out, after bringing huge benefit to patients with lung adenocarcinoma,
The various targeted drugs of adenocarcinoma of lung have also subsequently entered clinic, therapeutic effect, life cycle be improved significantly.Compared to lung gland
The research of cancer, lung squamous cancer relatively lags, and still instructs clinical practice without effective targeted drug, and reason may be to give birth to due to lacking to it
The understanding of object feature.As the further investigation to genetics provides possibility for understanding lung squamous cancer molecular biological characteristics.?
During lung squamous cancer occurrence and development, relevant molecule target spot EGF-R ELISA (epidermal growth factor
Receptor, EGFR), phosphatidylinositol-3-kinase catalytic subunit α (phosphoin-3-kinase catalytic
Alphapolypeptide, PIK3CA), (the fibroblast growth factor of fibroblast growth factor acceptor 1
Receptor 1, FGFR1), chronic angle-closune glaucoma (discoidin domain receptor 2, DDR2), No. 10 dye
Homologous gene (the phosphatase and tensin homolog deleted of the phosphatase and tensin of colour solid missing
On chromosome ten, PTEN), BRAF, MET, type-1 insulin like growth factor receptor (insulin-like growth
Factor 1receptor, IGF-1R) etc. play an important role.
GBP1 (guanylate-bindingprotein 1) is that one kind by the monomer that 593 amino acid form starts egg
It is white, it is under the jurisdiction of interferon-induced GTPase superfamily.The expression of GBP1 is not present in normal human subject skin histology, but works as skin
The expression for being invaded GBP1 by inflammation is obviously increased, and inhibits the aggravation of diseases associated with inflammation, and GBP1 may be potential inflammation
Pre-warning signal.In endothelial cell, GBP1 can by the inflammatory factors induced strong such as IFN-γ, IFN-α, IFN-β, TNF-α, ILs,
And inhibit endothelial cell proliferation in diseases associated with inflammation, invasion.In recent years, the antitumor action of GBP1 becomes the hot spot of concern, more
A inside and outside experiment is it has been confirmed that GBP1 can inhibit the formation and development of the kinds of tumors such as colon cancer, breast cancer, prostate cancer.
It is found in applicant's early-stage study, compared with normal lung tissue, GBP1 gene expression is aobvious in lung squamous cancer pathological tissue
It writes and increases, but there has been no the relationships between research confirmation GBP1 and lung squamous cancer so far.
Summary of the invention
The purpose of the present invention is to provide the application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer.
Above-mentioned purpose is achieved by the following technical solution：
Application of the GBP1 gene as drug targets in the drug that screening prepares treatment lung squamous cancer.
Application of the inhibitor of GBP1 gene in the drug of preparation treatment lung squamous cancer.
Preferably, the inhibitor is selected from siRNA, shRNA, dsRNA, miRNA, cDNA or its expression vector, or is selected from
Small molecule compound.
Preferably, the inhibitor is the expression vector for including miR-335-3p genetic fragment.
Preferably, the small molecule compound is imperialine.
Preferably, the small molecule compound is Cycleanine.
Preferably, the small molecule compound is buxine.
It is a kind of for treating the drug of adenocarcinoma of lung, contain above-mentioned inhibitor.
Beneficial effects of the present invention：
Present invention discover that miR-335-3p can obviously lower the expression water of GBP1 gene in lung squamous cancer NCI-H520 cell
Flat, luciferase reporter gene testing result shows that miR-335-3p can be with direct regulation and control GBP1 gene.Cell Proliferation vigor
Testing result shows that miR-335-3p significantly inhibits the external increasing of lung squamous cancer NCI-H520 cell by lowering GBP1 gene expression
It grows, miR-335-3p is the inhibitor of GBP1 gene expression.Imperialine, Cycleanine and buxine are to lung squamous cancer NCI-H520
The growth of transplantable tumor significantly inhibits, the tumor tissues after imperialine, Cycleanine and buxine drug treatment
Middle GBP1 mRNA and protein expression level are significantly lowered, and show that the expression of GBP1 gene can promote the growing multiplication of lung squamous cancer,
Imperialine, Cycleanine and buxine realize in vivo antitumor effect by lowering the expression of GBP1 gene.
Detailed description of the invention
Fig. 1 is the variation of each group miR-335-3p expression quantity and each group GBP1 mRNA and protein expression level variation after transfection；
Fig. 2 is each transfection group adenocarcinoma of lung NCI-H520 cell Proliferation vigour.
Specific embodiment
Technical solution of the present invention and technical effect is discussed in detail with attached drawing combined with specific embodiments below.It is not specified specific
The experimental method of condition, usually according to normal condition, such as condition described in textbook and experiment guide, or according to manufactory
Condition proposed by quotient is well known within the skill of those ordinarily skilled or is easy to know.
GBP1 gene expression is lowered in 1 miR-335-3p of embodiment targeting
One, experimental material
MiR-335-3p analogies miR-335-3p mimics, repressor miR-335-3p inhibitor, miR-335-
3p analogies negative control miR-335-3p mimics negative control and repressor negative control miR-335-3p
Inhibitor negative control is purchased from Guangzhou Ribo Bio Co., Ltd..
PCR primer entrusts Guangzhou Ribo Bio Co., Ltd.'s design synthesis.
TRIzol reagent and transfection reagent Lipofectamine 2000 are purchased from Invitrogen company.
Lung squamous cancer NCI-H520 cell strain is our company's Long-term Cryopreservation, and the Hela cell strain for transfected plasmids carrier is purchased from
Shanghai Inst. of Cytobiology, Chinese Academy of Sciences's cell bank.RPMI1640 culture medium and fetal calf serum are purchased from Gibco company.Lung
Squamous carcinoma NCI-H520 cell strain and Hela cell strain are trained according to a conventional method with the RPMI1640 culture medium containing 10% fetal calf serum
It supports.
BCA determination of protein concentration kit is purchased from Xi'an He Te Bioisystech Co., Ltd.
GBP1 primary antibody is purchased from Abnova company, and β-actin primary antibody is purchased from Abcam company, and the secondary antibody of HRP label is purchased from Beijing
Biotechnology Co., Ltd of Zhong Shan Golden Bridge.Dual luciferase reporter gene detection kit is purchased from Promega company of the U.S..CCK-
8 kits are purchased from Co., Ltd of Nanjing Keygen Biotech.MiRcute miRNA extracts separating kit and is purchased from Tiangeng biochemical technology
(Beijing) Co., Ltd, RNeasy Mini Kit total RNA extraction reagent box are purchased from Hangzhou Watson Bioisystech Co., Ltd, RNA
Reverse Transcriptase kit is purchased from TaKaRa company, and Real-time PCR kit is purchased from TaKaRa company.
Two, experimental method
1, cell culture and transfection
Lung squamous cancer NCI-H520 cell strain is cultivated according to a conventional method with the RPMI1640 culture medium containing 10% fetal calf serum.
NCI-H520 cell is divided into 5 groups, i.e. miR-335-3p analogies transfection group, repressor transfection group, analogies negative control turns
Dye group, repressor negative control transfection group and the blank control group for only adding transfection reagent.Transfection in six porocyte culture plates, to
It is carried out when cell combination degree about 60%-70%, the analogies or repressor or negative control of every orifice plate addition 25pmol and 10 μ L
Transfection reagent, make the final concentration of 10pmol/mL of analogies or repressor or negative control, 5h changes liquid after transfection.
Transfection process is carried out in strict accordance with the operating instruction of transfection reagent Lipofectamine 2000.
2, RT-PCR method detects miR-335-3p expression
48h harvests cell after transfection, extracts step provided by separating kit according to miRcute miRNA and extracts
miRNA.The concentration and purity that extracted RNA is measured with UV detector, later according to TaKaRa Reverse Transcriptase kit institute
Its reverse transcription is cDNA, reaction condition by the step of offer：25 DEG C × 30min, 42 DEG C × 30min, 85 DEG C × 5min.With cDNA
For template, related reagent and miR-335-3p primer is added according to the step of TaKaRa RT-PCR kit offer, is interior with U6
Ginseng, carries out PCR amplification on ABI-7300 real time fluorescent quantitative instrument.Reaction condition：95 DEG C × 3min, (95 DEG C × 12s, 62 DEG C
× 40s) × 40 circulations.Experimental result uses 2-ΔΔCtMethod carries out expression quantity relative quantitative assay.
MiR-335-3p sequence：5'-UUUUUCAUUAUUGCUCCUGACC-3'
MiR-335-3p reverse transcriptase primer：5'-
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGTCAGGA-3'
MiR-335-3p RT-PCR upstream primer：5'-ACACTCCAGCTGGGTTTTTCATTATTGCTCC-3'
MiR-335-3p RT-PCR downstream primer：5'-CGCCGCAGTGCGTGTCGTGGAGT-3'
3, RT-PCR method detects GBP1 mRNA expression
48h harvests cell after transfection, extracts total serum IgE using Trizol method, is extracted with UV detector measurement
The concentration and purity of RNA, as a result concentration is more than 300ng/ μ L, and OD260/OD280 ratio is 1.8 or so.According to
Its reverse transcription is cDNA, reaction condition by step provided by TaKaRa Reverse Transcriptase kit：25 DEG C × 30min, 42 DEG C ×
30min, 85 DEG C × 5min.Using cDNA as template, according to TaKaRa RT-PCR kit provide the step of be added related reagent and
Primer carries out PCR amplification on ABI-7300 real time fluorescent quantitative instrument using GAPDH as internal reference.Reaction condition：95 DEG C × 3min,
(95 DEG C × 12s, 62 DEG C × 40s) × 40 recycle.Experimental result uses 2-ΔΔCtMethod carries out expression quantity relative quantitative assay.
RT-PCR primer sequence design is as follows：
GBP1 RT-PCR upstream primer：5'-TGGAACGTGTGAAAGCTGAG-3'；
GBP1 RT-PCR downstream primer：5'-TGACAGGAAGGTCTGGTCT-3'
GAPDH RT-PCR upstream primer：5'-GCACCGTCAAGGCTGAGAAC-3'；
GAPDH RT-PCR downstream primer：5'-TGGTGAAGACGCCAGTGGA-3'
4, Western blot method detects GBP1 protein expression level
48h harvests cell after transfection, and using β-actin as internal reference, steps are as follows：Group of cells is cracked with lysate, it is even
Centrifuging and taking supernatant after slurry surveys protein content using BCA kit.By 50 μ g albumen loading row SDS-PAGE electrophoresis.Wet transfer printing
Protein is transferred to pvdf membrane；50g/L skimmed milk power solution room temperature closes 2h, and GBP1 primary antibody dilution and β-actin is added
Primary antibody dilution, room temperature shaker jog are stayed overnight；TBST washes film, and the secondary antibody of HRP label, room temperature shaker jog 1.5h is added；TBST
ECL developing solution, automatic gel analysis instrument photograph, with corresponding protein band gray value divided by internal reference β-actin is added in sufficiently rinsing
Gray level correction obtains the relative expression quantity of corresponding albumen.
5, luciferase reporter gene detects
The area the 3'UTR overall length of clonal expansion GBP1 gene, by primer recombination to psiCHECK-2 plasmid, bioinformatics is pre-
The target binding site of miR-335-3p and GBP1 gene are surveyed, and carries out rite-directed mutagenesis for the point, expresses renilla luciferase
PRL-TK plasmid is used as the difference of internal reference adjustment cell quantity and transfection efficiency, miR-335-3p analogies and its feminine gender
Control and miR-335-3p repressor and its negative control respectively with firefly luciferase reporter vector cotransfection into Hela cell,
Dual-Luciferase Activity determination is operated by kit specification.The part Experiment is contracted out to the triumphant limited public affairs of base biotechnology in Jiangsu
Department.
6, cell Proliferation viability examination
The proliferation activity of transfection cell is detected using CCK-8 method, is detected in transfection 1d-6d respectively.Cell inoculation exists
In 96 orifice plates, 5000 cells, 100 μ L culture solutions and 10 μ L detection reagents are added in every hole.On after adding CCK-8 reagent 2h
Microplate reader detects each hole OD value at 450nm, and every group is repeated 4 times.
Opposite proliferation activity (%)=transfection group OD value/blank control group OD value × 100%.
Three, experimental result
1, each group miR-335-3p expression compares after transfecting
With blank control group ratio, miR-335-3p analogies transfection group cell miR-335-3p expression significantly raises (P
< 0.05), miR-335-3p repressor transfection group cell miR-335-3p expression significantly lowers (P < 0.05), analogies
Negative control transfection group and repressor negative control transfection group cell miR-335-3p expression are without significant changes (P >
0.05)。
As a result as shown in table 1 and Fig. 1.
Each group miR-335-3p expression compares after table 1 transfects
2, each group GBP1 mRNA expression compares after transfecting
With blank control group ratio, miR-335-3p analogies transfection group cell GBP1 mRNA expression significantly lowers (P
< 0.05), miR-335-3p repressor transfection group cell GBP1 mRNA expression significantly raises (P < 0.05), analogies yin
Property control transfection group and repressor negative control transfection group cell GBP1 mRNA expression without significant changes (P > 0.05).
As a result as shown in Table 2 and Fig. 1.
Each group GBP1 mRNA expression compares after table 2 transfects
3, each group GBP1 protein expression level compares after transfecting
With blank control group ratio, miR-335-3p analogies transfection group cell GBP1 protein expression level significantly lowers (P <
0.05), miR-335-3p repressor transfection group cell GBP1 protein expression level significantly raises (P < 0.05), and analogies are negative
Transfection group and repressor negative control transfection group cell GBP1 protein expression level are compareed without significant changes (P > 0.05).As a result
Such as Fig. 1.
4, luciferase reporter gene testing result
Rite-directed mutagenesis is carried out to the wild type binding site of miR-335-3p and GBP1.MiR-335-3p analogies and wild
The Hela cell fluorescence element enzymatic activity decline 55% of type GBP1 cotransfection group, and uciferase activity is without bright in saltant type transfection group
Variation is shown, while also not observing the change of uciferase activity in miR-335-3p repressor and negative control group.On
It states the result shows that miR-335-3p can be with direct regulation and control GBP1 gene.
5, cell Proliferation viability examination result
With blank control group ratio, miR-335-3p analogies transfection group cell Proliferation is slow, and miR-335-3p repressor turns
The enhancing of dye group cell Proliferation vigor, analogies negative control transfection group and repressor negative control transfection group cell Proliferation vigor without
Significant changes.
As a result as shown in Figure 2.
The above results show that miR-335-3p can obviously lower the expression of GBP1 gene in lung squamous cancer NCI-H520 cell
Level, luciferase reporter gene testing result show that miR-335-3p can be with direct regulation and control GBP1 gene.Cell Proliferation is living
Power testing result shows that miR-335-3p significantly inhibits the external of lung squamous cancer NCI-H520 cell by lowering GBP1 gene expression
Proliferation, miR-335-3p is the inhibitor of GBP1 gene expression.
The discovery of the small molecule compound of GBP1 gene expression is lowered in the targeting of embodiment 2
One, experimental material
Imperialine (CAS number：61825-98-7), Cycleanine (CAS number：518-94-5) (CAS is compiled with buxine
Number：860-79-7) the compound to be stored in our company's standard items library.Imperialine, Cycleanine and buxine are used respectively
Dmso solution is made into the mother liquor that concentration is 1mg/mL, is diluted to required concentration with culture medium when use.
Other experimental materials are the same as embodiment 1.
Two, experimental method
1, cell culture and compound drug treatment
Lung squamous cancer NCI-H520 cell strain is cultivated according to a conventional method with the RPMI1640 culture medium containing 10% fetal calf serum.
NCI-H520 cell is divided into 7 groups, i.e. imperialine low dose group and high dose group, Cycleanine low dose group and high dose
Group, buxine low dose group and high dose group and the blank control group for only adding equivalent solvent.The cell of logarithmic growth phase, is passed to
In 24 orifice plates, adhere-wall culture is overnight.Culture medium is sucked, pastille culture medium is added and continues culture for 24 hours, wherein low dose group drug containing
Culture medium drug concentration is 5 μM, and high dose group pastille culture medium drug concentration is 10 μM.
2, RT-PCR method detects GBP1 mRNA expression
Administration culture harvests cell for 24 hours, extracts total serum IgE using Trizol method, is extracted with UV detector measurement
The concentration and purity of RNA, as a result concentration is more than 300ng/ μ L, and OD260/OD280 ratio is 1.8 or so.According to
Its reverse transcription is cDNA, reaction condition by step provided by TaKaRa Reverse Transcriptase kit：25 DEG C × 30min, 42 DEG C ×
30min, 85 DEG C × 5min.Using cDNA as template, according to TaKaRa RT-PCR kit provide the step of be added related reagent and
Primer carries out PCR amplification on ABI-7300 real time fluorescent quantitative instrument using GAPDH as internal reference.Reaction condition：95 DEG C × 3min,
(95 DEG C × 12s, 62 DEG C × 40s) × 40 recycle.Experimental result uses 2-ΔΔCtMethod carries out expression quantity relative quantitative assay.
RT-PCR primer sequence design is as follows：
GBP1 RT-PCR upstream primer：5'-TGGAACGTGTGAAAGCTGAG-3'；
GBP1 RT-PCR downstream primer：5'-TGACAGGAAGGTCTGGTCT-3'
GAPDH RT-PCR upstream primer：5'-GCACCGTCAAGGCTGAGAAC-3'；
GAPDH RT-PCR downstream primer：5'-TGGTGAAGACGCCAGTGGA-3'
3, Western blot method detects GBP1 protein expression level
Administration culture harvests cell for 24 hours, and using β-actin as internal reference, steps are as follows：Group of cells is cracked with lysate, it is even
Centrifuging and taking supernatant after slurry surveys protein content using BCA kit.By 50 μ g albumen loading row SDS-PAGE electrophoresis.Wet transfer printing
Protein is transferred to pvdf membrane；50g/L skimmed milk power solution room temperature closes 2h, and GBP1 primary antibody dilution and β-actin is added
Primary antibody dilution, room temperature shaker jog are stayed overnight；TBST washes film, and the secondary antibody of HRP label, room temperature shaker jog 1.5h is added；TBST
ECL developing solution, automatic gel analysis instrument photograph, with corresponding protein band gray value divided by internal reference β-actin is added in sufficiently rinsing
Gray level correction obtains the relative expression quantity of corresponding albumen.
4, cell Proliferation viability examination
Administration culture harvests cell for 24 hours, using the proliferation activity of CCK-8 method detection group of cells.Cell inoculation is 96
In orifice plate, 5000 cells, 100 μ L culture solutions and 10 μ L detection reagents are added in every hole.The upper enzyme after adding CCK-8 reagent 2h
Mark instrument detects each hole OD value at 450nm, and every group is repeated 4 times.
Opposite proliferation activity (%)=administration group OD value/blank control group OD value × 100%.
Three, experimental result
1, each group GBP1 mRNA expression compares after drug treatment
With blank control group ratio, each drug low dosage and high dose group cell GBP1 mRNA expression significantly lower (P
< 0.05), and be in certain concentration-dependent relation.The results are shown in Table 3.
Each group GBP1 mRNA expression compares after 3 drug treatment of table
2, each group GBP1 protein expression level compares after drug treatment
With blank control group ratio, each drug low dosage and high dose group cell GBP1 protein expression level significantly lower (P <
It 0.05), and is in certain concentration-dependent relation.The results are shown in Table 4.
Each group GBP1 protein expression level compares after 4 drug treatment of table
3, cell Proliferation viability examination result
With blank control group ratio, each drug low dosage and high dose group cell Proliferation vigor are significantly reduced, and are in certain
Concentration-dependent relation.The results are shown in Table 5.
The influence of 5 imperialine of table, Cycleanine and Chinese littleleaf box alkali process to adenocarcinoma of lung NCI-H520 cell Proliferation vigor
The above results show that imperialine, Cycleanine and buxine can obviously lower lung squamous cancer NCI-H520 cell
The expression of middle GBP1 gene.Cell Proliferation viability examination the result shows that, under imperialine, Cycleanine and buxine pass through
GBP1 gene expression is adjusted to significantly inhibit the in-vitro multiplication of lung squamous cancer NCI-H520 cell, imperialine, Cycleanine and buxine
It is effective inhibitor of GBP1 gene expression.
In vivo antitumor effect of the small molecule compound to lung squamous cancer of GBP1 gene expression is lowered in the targeting of embodiment 3
One, experimental material
SPF grades of BALB/c nude mices are purchased from Shanghai Slac Experimental Animal Co., Ltd., 7 week old, 19.5~22.5g of weight.
All mouse are placed in temperature (22 ± 2) DEG C, humidity (60 ± 5) DEG C, raise in 12h light and shade alternate environment.
Two, experimental method
1, the foundation, grouping and administration of animal model
Single cell suspension is made with 0.25% trypsin digestion in logarithmic growth phase lung squamous cancer NCI-H520 cell, and platform is expected
Indigo plant refuses dye method numeration viable count and accounts for 95% or more, and cell density is adjusted to 1 × 107/ ml, every nude mice take 0.2ml cell outstanding
Liquid is inoculated in right thigh dorsal subcutaneous, preoperative measurement weight.It observes after inoculation, after the visible transplantable tumor of naked eyes to appear, uses daily
Vernier caliper measurement transplantable tumor reaches 100mm to transplantable tumor volume3Left and right is by nude mice by knurl product and mice with tumor weight homeostatic principle
It is randomly divided into blank control group, imperialine group, Cycleanine group and buxine group, blank control group gives isometric physiology salt
Water, administration group dosage are 10mg/kg/d, and subcutaneous injection is administered, once every other day, continuous ten times.After drug-treated
One day, cervical dislocation put to death nude mice, and photograph observes and records nude mice mass form size, lump is stripped out, is weighed, -80 DEG C cold
It hides spare.
The measurement of tumour inhibiting rate：
Diameter (a) and maximum transverse diameter (b) 1 time, gross tumor volume=0.5 × a × b are indulged with the maximum of vernier caliper measurement tumour2,
The internal tumour inhibiting rate of each compound is calculated according to following formula：
Tumour inhibiting rate (%)=(control group gross tumor volume-administration group gross tumor volume)/control group gross tumor volume × 100%.
2, GBP1 mRNA expression in RT-PCR method detection tumor tissues
Liquid nitrogen grinds tissue extraction RNA, takes 100mg tissue that 1mL Trizol is added, extracts total serum IgE.Ultraviolet specrophotometer
A260 and A280 is measured, RNA purity is analyzed and adjusts concentration.It is according to step provided by TaKaRa Reverse Transcriptase kit that its is inverse
It is transcribed into cDNA, reaction condition：25 DEG C × 30min, 42 DEG C × 30min, 85 DEG C × 5min.Using cDNA as template, according to
Related reagent and primer is added in the step of TaKaRaRT-PCR kit provides, glimmering in real time in ABI-7300 using GAPDH as internal reference
PCR amplification is carried out on light quantitative instrument.Reaction condition：95 DEG C × 3min, (95 DEG C × 12s, 62 DEG C × 40s) × 40 recycle.Experiment
As a result 2 are used-ΔΔCtMethod carries out expression quantity relative quantitative assay.
RT-PCR primer sequence design is as follows：
GBP1 RT-PCR upstream primer：5'-TGGAACGTGTGAAAGCTGAG-3'；
GBP1 RT-PCR downstream primer：5'-TGACAGGAAGGTCTGGTCT-3'
GAPDH RT-PCR upstream primer：5'-GCACCGTCAAGGCTGAGAAC-3'；
GAPDH RT-PCR downstream primer：5'-TGGTGAAGACGCCAGTGGA-3'
3, GBP1 protein expression level in Western blot method detection tumor tissues
Liquid nitrogen grinds tissue extraction protein, takes 100mg tissue that 0.75mL cell pyrolysis liquid is added, extracts total protein.With
BCA method measures protein content.Every takes 50 μ g, loading row SDS-PAGE electrophoresis.Protein is transferred to pvdf membrane by wet transfer printing；
50g/L skimmed milk power solution room temperature closes 2h, and GBP1 primary antibody dilution is added and β-actin primary antibody dilution, room temperature shaker are light
It shakes overnight；TBST washes film, and the secondary antibody of HRP label, room temperature shaker jog 1.5h is added；TBST is sufficiently rinsed, and ECL colour developing is added
Liquid, automatic gel analysis instrument photograph, obtains corresponding egg divided by internal reference β-actin gray level correction with corresponding protein band gray value
White relative expression quantity.
Three, experimental result
1, the influence of each compound on tumor growth
Compared with blank control group, imperialine group, Cycleanine group and buxine group gross tumor volume are significantly smaller, show
Imperialine, Cycleanine and buxine have in vivo antitumor effect, and each group tumour inhibiting rate is as shown in table 6.
The influence of each compound on tumor growth of table 6
2, GBP1 mRNA and protein expression level influence in each compound on tumor tissue
Compared with blank control group, in imperialine group, Cycleanine group and buxine group tumor tissues GBP1 mRNA and
Protein expression level significantly lowers (P < 0.05).The results are shown in Table 7.
GBP1 mRNA and protein expression level influence in each compound on tumor tissue of table 7
The above results show that imperialine, Cycleanine and buxine have the growth of lung squamous cancer NCI-H520 transplantable tumor
There are apparent inhibiting effect, GBP1 mRNA and egg in the tumor tissues after imperialine, Cycleanine and buxine drug treatment
White expression is significantly lowered, and shows that the expression of GBP1 gene can promote the growing multiplication of lung squamous cancer, imperialine, Cyclea racemosa Oliv
The expression realization in vivo antitumor effect that alkali and buxine pass through downward GBP1 gene.
Claims (1)
- Application of the 1.GBP1 gene inhibitor in the drug of preparation treatment lung squamous cancer, it is characterised in that：The GBP1 gene suppression Preparation is imperialine or Cycleanine or buxine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710126405.3A CN106860879B (en) | 2017-03-06 | 2017-03-06 | The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710126405.3A CN106860879B (en) | 2017-03-06 | 2017-03-06 | The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106860879A CN106860879A (en) | 2017-06-20 |
| CN106860879B true CN106860879B (en) | 2018-11-16 |
Family
ID=59170083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710126405.3A Active CN106860879B (en) | 2017-03-06 | 2017-03-06 | The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106860879B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021254537A1 (en) * | 2020-06-17 | 2021-12-23 | 西南大学 | Use of cyclovirobuxine |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970789A (en) * | 2005-11-21 | 2007-05-30 | 林远 | Flow cytometry and micro-carrier gene chip |
-
2017
- 2017-03-06 CN CN201710126405.3A patent/CN106860879B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1970789A (en) * | 2005-11-21 | 2007-05-30 | 林远 | Flow cytometry and micro-carrier gene chip |
Non-Patent Citations (3)
| Title |
|---|
| Epithelial-to-mesenchymal transition and c-myc expression are the determinants of cetuximab-induced enhancement of squamous cell carcinoma radioresponse;Ira Skvortsova等;《Radiotherapy and Oncology》;20101231;第96卷;108-115 * |
| 应用抑制性消减杂交方法和cDNA微阵列技术筛选肺癌相关差别表达基因;孙文越;《中国优秀博硕士学位论文全文数据库（博士） 医药卫生科技辑》;20061115(第11期);E072-238 * |
| 非小细胞肺癌中miR-335的表达及对生长、侵袭和凋亡的影响;王华启;《中国博士学位论文全文数据库 医药卫生科技辑》;20151015(第10期);E072-26 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106860879A (en) | 2017-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ge et al. | AntagomiR-27a targets FOXO3a in glioblastoma and suppresses U87 cell growth in vitro and in vivo | |
| CN113476618B (en) | Application of miR-199a-3p in preparation of medicine for treating nasopharyngeal carcinoma | |
| Yi et al. | SPAG9 is overexpressed in human astrocytoma and promotes cell proliferation and invasion | |
| CN114042072B (en) | New application of STM2457 | |
| Zhang et al. | Thymidine phosphorylase promotes metastasis and serves as a marker of poor prognosis in hepatocellular carcinoma | |
| Zhang et al. | Long non-coding RNA CASC15 promotes intrahepatic cholangiocarcinoma possibly through inducing PRDX2/PI3K/AKT axis | |
| Tang et al. | Upregulation of SKA3 enhances cell proliferation and correlates with poor prognosis in hepatocellular carcinoma | |
| CN106860879B (en) | The application of GBP1 gene and its inhibitor in the drug of preparation treatment lung squamous cancer | |
| CN109321656A (en) | Purposes of the protein D EPDC1 as the marker of the negative breast cancer of diagnosis three | |
| Feng et al. | [Retracted] AIM2 Promotes Gastric Cancer Cell Proliferation via the MAPK Signaling Pathway | |
| CN107739759A (en) | A kind of application of RDH10 genes in treating brain glioma disease | |
| CN104083368B (en) | G-1 application in terms of preparing three negative breast cancer targeted drugs based on g protein coupled receptor 30 | |
| CN108660212B (en) | Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products | |
| CN109966479A (en) | Application of the EZH2 in preparation prevention or treatment polycystic kidney disease drug | |
| CN107488735B (en) | MiR-339-5p is inhibiting the application in prostate cancer with osseous metastasis and TGF-β signal path | |
| CN105420194B (en) | The alpha mediated progesterone of mPR adjusts lung adenocarcinoma cell to the method for EGFR-TKIs sensibility | |
| CN115282282A (en) | Application of PDK 1-targeted glucose metabolism regulation reprogramming combined with metformin in treatment of patients with endometrial cancer complicated with diabetes | |
| CN107893115A (en) | The purposes of ALKBH1 genes and its expression product in the kit for diagnosing tumour is prepared, treat the medicine of tumour | |
| CN106880843A (en) | A kind of application of microRNA and its micromolecular inhibitor in lung adenocarcinoma stem cell characteristic is suppressed | |
| CN111110676A (en) | Application of apatinib and combined CCI-779 in preparation of lung cancer drugs | |
| CN106039312B (en) | Application of the ZNF367 gene in preparation treatment breast cancer medicines, diagnosis and prognosis evaluation reagent | |
| CN106822898B (en) | Application of the STAT3 gene expressions in terms of improving adenocarcinoma of lung chemosensitivity is lowered in targeting | |
| CN110283825A (en) | SiRNA and its application of low SRC-1 gene expression can be struck | |
| CN112725449B (en) | Application of siRNA inhibitor of circ0058792 in preparation of medicine for treating renal clear cell carcinoma | |
| CN102649978A (en) | Application of CCDC158 gene in preparation of drugs for treating or diagnosing liver cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180717 Address after: 211198 18 Jiangning Science Park, Nanjing, Jiangsu. Applicant after: Nanjing cover Seef Pharmaceutical Technology Co. Ltd. Address before: 210008 room 322, F7 9, Weir Road, Xianlin University Town, Qixia District, Nanjing, Jiangsu. Applicant before: Nanjing jiushoutang Medical Technology Co Ltd |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20181008 Address after: 221000 Pizhou High-tech Industrial Development Zone, Xuzhou City, Jiangsu Province (150 meters north of the intersection of Sanxian Avenue and Pixin Road) Applicant after: Jiangsu Tian Fang Health Technology Co., Ltd. Address before: 211198 18 Jiangning Science Park, Nanjing, Jiangsu. Applicant before: Nanjing cover Seef Pharmaceutical Technology Co. Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |