CN105985415A - Polypeptide for improving absorption and utilization capability of plants on nitrogen, encoding nucleic acid thereof and application thereof - Google Patents
Polypeptide for improving absorption and utilization capability of plants on nitrogen, encoding nucleic acid thereof and application thereof Download PDFInfo
- Publication number
- CN105985415A CN105985415A CN201510046674.XA CN201510046674A CN105985415A CN 105985415 A CN105985415 A CN 105985415A CN 201510046674 A CN201510046674 A CN 201510046674A CN 105985415 A CN105985415 A CN 105985415A
- Authority
- CN
- China
- Prior art keywords
- plant
- polypeptide
- seq
- aminoacid sequence
- increase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a polypeptide for improving absorption and utilization capability of plants on nitrogen, an encoding nucleic acid thereof and an application thereof, and for the first time, discloses a gene which can effectively improve the absorption and utilization efficiency of plants on nitrogen and increase the biomass and yield of the plants. The invention provides a valuable gene resource for developing high-nitrogen-effect new variety of the plants.
Description
Technical field
The invention belongs to biotechnology and botany field, plant more particularly it relates to an improve
Thing absorbs the polypeptide of ability, its code nucleic acid and application thereof to nitrogen.
Background technology
Nitrogen is most important nutrient in plant growing, and being applied with of nitrogenous fertilizer helps increases in grain production, but plant
The low problem become increasingly conspicuous become during world agriculture produces of the utilization rate of nitrogen fertilizer of thing.China at present
The average utilization of nitrogen fertilizer for paddy rice is only between 30-40%, and remaining unemployed nitrogenous fertilizer causes serious ring
Environment pollution and the wasting of resources, cause the economic loss of peasant.
The harm lowly brought in the face of Total Nitrogen utilization rate, a kind of active and effective measure is exactly selection-breeding nitrogen
High-efficiency plant kind, efficient absorption utilizes the nitrogen in soil, obtains higher under certain nitrogenous fertilizer puts into
Yield, thus increase economic benefit and ecological environment benefit.Therefore, the selection-breeding of efficient kind is to improve
Nitrogen utilization efficiency, the minimizing wasting of resources, the fundamental way of development sustainable agriculture, research is excavated and utilizes nitrogen
Efficient or resistance to low nitrogen plant germplasm resource has highly important theory and practice meaning.
But, in the art, the key theory problem that utilization efficient for nitrogen relates to, i.e. in plant
The mechanism of Nitrogen Absorption transport is also known little about it, and the especially molecular mechanism research of the long-distance transhipment of nitrogen is less.
Therefore, this area also needs to further investigate the nitrogen using mechanism of plant, and cultivates nitrogen and efficiently utilize
Plant variety.
Summary of the invention
It is an object of the invention to provide a kind of improve plant nitrogen is absorbed ability polypeptide, its coding
Nucleic acid and application thereof；This polypeptide is polypeptide or its conservative with SEQ ID NO:3 aminoacid sequence
Variant polypeptides or its active fragment or its reactive derivative.
In a first aspect of the present invention, it is provided that a kind of method improveing plant, described method includes: planting
In thing, process LAN is selected from the polypeptide of lower group:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more (such as 1-20, preferably 1-10
Individual, more preferably 1-5, most preferably 1-3) amino acid residue replacement, lack or add and formed,
And there is the polypeptide derivative by (a) with the aminoacid sequence identical function shown in SEQ ID NO:3；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% (preferably at least 90%；The most extremely
Few 95%, such as 98%, 99%) homogeny, and have and the aminoacid sequence phase shown in SEQ ID NO:3
The polypeptide derivative by (a) of congenerous.
In a preference, described plant includes: plant of Solanaceae, crucifer.
In another preference, described plant of Solanaceae includes, but is not limited to: Nicotiana, such as Nicotiana tabacum L.；Kind
Solanum, such as Fructus Lycopersici esculenti；Capsicum, such as Fructus Capsici；Solanum, such as Rhizoma Solani tuber osi；Lycium, such as Fructus Lycii；Atropa,
Such as Semen daturae.
In another preference, described crucifer includes: Mus ear mustard, such as arabidopsis；
Or brassica plant, such as Chinese cabbage, Plantula Brassicae chinensis.
In another preference, described method includes: turned by the nucleic acid of coding (a)～(c) arbitrary described polypeptide
Enter in plant, thus process LAN (a)～(c) arbitrary described polypeptide.
In another preference, described method includes:
(1) providing construction, described construction includes: the expression cassette of (a)～(c) arbitrary described polypeptide；
(2) described construction is proceeded to plant, thus process LAN (a)～(c) arbitrary described polypeptide.
In another preference, step (2) including:
I described construction is converted Agrobacterium by (), it is thus achieved that carry the Agrobacterium of described construction；With
(ii) plant tissue or organ are contacted with the Agrobacterium carrying described construction in step (i), thus
Described construction is made to proceed to plant.
In another preference, described improvement plant includes:
Improve plant and nitrogen (such as containing the nitrate anion of nitrogen) absorbed ability；
Increase the nitrate radical content of plant interior (including overground part, underground part)；
Promote that plant of Solanaceae (such as Fructus Lycopersici esculenti) internal nitrate anion is allocated in overground part more；
Increase the Biomass of plant；
Increase fruit weight；Or
Increase the yield of plant.
In another preference, the nucleic acid of polypeptide of coding (a) has a SEQ ID NO:1 or SEQ ID NO:
Nucleotide sequence shown in 2.
In another aspect of this invention, it is provided that selected from the polypeptide of lower group or its code nucleic acid in improvement plant
Purposes:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more (such as 1-20, preferably 1-10
Individual, more preferably 1-5, most preferably 1-3) amino acid residue replacement, lack or add and formed,
And there is the polypeptide derivative by (a) with the aminoacid sequence identical function shown in SEQ ID NO:3；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% (preferably at least 90%；The most extremely
Few 95%, such as 98%, 99%) homogeny, and have and the aminoacid sequence phase shown in SEQ ID NO:3
The polypeptide derivative by (a) of congenerous.
In a preference, described plant includes: plant of Solanaceae, crucifer.
In another preference, described described improvement plant includes:
Improve the plant absorption and transport ability to nitrogen；
Increase the nitrate radical content of plant interior (including overground part, underground part)；
Promote that plant of Solanaceae (such as Fructus Lycopersici esculenti) internal nitrate anion is allocated in overground part more；Or
Increase the Biomass of plant；
Increase fruit weight；
Increase the yield of plant.
In another aspect of this invention, it is provided that a kind of plant cell or tissue, it comprises under being selected from of external source
The code nucleic acid of the polypeptide of group:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more (such as 1-20, preferably 1-10
Individual, more preferably 1-5, most preferably 1-3) amino acid residue replacement, lack or add and formed,
And there is the polypeptide derivative by (a) with the aminoacid sequence identical function shown in SEQ ID NO:3；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% (preferably at least 90%；The most extremely
Few 95%, such as 98%, 99%) homogeny, and have and the aminoacid sequence phase shown in SEQ ID NO:3
The polypeptide derivative by (a) of congenerous.
In a preference, described plant cell or be organized as non-plant propagating materials or for cannot be direct
The material of regeneration plant.
The other side of the present invention due to this disclosure, be to those skilled in the art aobvious and
It is clear to.
Accompanying drawing explanation
In Fig. 1, real-time fluorescence quantitative PCR analysis Fructus Lycopersici esculenti, the rna transcription of SEQ ID NO:1 gene is originally
Transcriptional level.Within 24 days, (after cultivating 24 days) Fructus Lycopersici esculenti root is through 0, and 0.5,5mM nitrate anion processes 4 days.
Fig. 2, the expression pattern analysis in Fructus Lycopersici esculenti different tissues of gene of the present invention.
Fig. 3, the nitrate radical content of process LAN tomato plant all increase in underground and aerial parts；But relatively
For wild type, in process LAN plant portion on the ground, the distribution of increase is more (relative to wild type, turns base
Because the ratio of the overground part/underground part nitrate radical content of plant increases).Wherein, in bar diagram above cylindricality
What numeral represented is the ratio of the nitrate radical content in overground part and the nitrate radical content in underground part.
Under the conditions of the low nitrate anion of Fig. 4,5mM, the Biomass of the Fructus Lycopersici esculenti of the gene of the process LAN present invention is higher than open country
Raw type.
Fig. 5, the process LAN present invention gene tomato plant single fruit weight increase.
Fig. 6, the process LAN present invention gene Arabidopsis plant in aerial parts and the nitrate anion of under ground portion
Content significantly rises.
Detailed description of the invention
The present inventor disclose a kind of can be excellently used for plant variety improvement, improve plant to nitrogen
The gene of absorption and use efficiency, the present invention provides valuable base for the exploitation efficient new variety of plant of nitrogen
Because of resource.
As used herein, described " overground part " is also referred to as " aerial parts " and refers to the part of plant
Tissue, when plant is planted in soil or when being incubated in culture fluid, and this portion of tissue is positioned at the ground of plant
Part more than face or cultivation liquid level.
As used herein, described " underground part " is also referred to as " under ground portion " and refers to the part of plant
Tissue, when plant is planted in soil or when being incubated in culture fluid, and this portion of tissue is positioned at the ground of plant
Part below face or cultivation liquid level.
As used herein, described " plant " can be such as (being not limited to): dicotyledon, list
Leaf plant or gymnosperm.More specifically, described plant includes, but is not limited to: Semen Tritici aestivi, Fructus Hordei Vulgaris,
Rye (Secale cereale L.), Oryza sativa L., Semen Maydis, Sorghum vulgare Pers., Radix Betae, Fructus Mali pumilae, pears, Lee, Fructus Persicae, Fructus Pruni, Fructus Pruni pseudocerasi, Fructus Fragariae Ananssae, wood
The certain kind of berries, blackberry, bean, Seem Lablab Album, Semen Pisi sativi, Semen sojae atricolor, Brassica campestris L, mustard, Semen Papaveris, Herba Artemisiae Annuae, olive, Xiang
Certain herbaceous plants with big flowers, Cortex cocois radicis, castor oil plant, cacao bean, Semen arachidis hypogaeae, calabash, Nicotiana tabacum L., Elaeis guineensis Jacq., Fructus Cucumidis sativi, Citrullus vulgaris,
Cotton Gossypii, Caulis et Folium Lini, Fructus Cannabis, Corchorus olitorius L., mandarin orange, Fructus Citri Limoniae, grapefruit, Herba Spinaciae, piemarker lettuce, Germinatus Phragmitis, ocean are in vain
Dish, Chinese cabbage, Plantula Brassicae chinensis, Radix Dauci Sativae, Bulbus Allii Cepae, Rhizoma Solani tuber osi, Fructus Lycopersici esculenti, Capsicum annuum L., American Avocado Tree, Cortex cinnamomi japonici (Ramulus Cinnamomi),
Camphora, Nicotiana tabacum L., nut, coffee, Fructus Solani melongenae, Caulis Sacchari sinensis, Folium Camelliae sinensis, Fructus Piperis, vine, oyster fiber crops are careless, fragrant
Any of several broadleaf plants, willow, willow, pine, China fir, Eucalyptus, Euphorbia lathyris, pencil tree, sago palm, simmondsia,
Natural rubber tree and ornamental plant etc..The present invention is for being applicable to the plant (or crop) of the present invention the most especially
Restriction, as long as it is appropriate to the conversion operation of gene, or be suitable for carrying out the operation of gene knockout,
Such as various crops, flower plant or forestry plant etc..
As the optimal way of the present invention, described " plant " includes but not limited to: plant of Solanaceae, cross
Flower section plant.Such as, described " plant " includes but not limited to: the Nicotiana of plant of Solanaceae, such as Nicotiana tabacum L.；
Fructus Lycopersici esculenti belongs to, such as Fructus Lycopersici esculenti；Capsicum, such as Fructus Capsici；Solanum, such as Rhizoma Solani tuber osi；Lycium, such as Fructus Lycii；Semen daturae
Belong to, such as Semen daturae etc.；Or the Mus ear mustard of crucifer, such as arabidopsis；Brassica plant, as
Chinese cabbage, Plantula Brassicae chinensis.
As used herein, term " improves ", " improvement " or " enhancing " be mutually can exchange and
Application implication on should mean compared with check plant defined herein as, at least 2%, 3%, 4%,
5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%
Higher N uptake and utilization ability or higher Biomass, yield or fruit weight.
About " check plant ", selecting suitable check plant is the customary part of experimental design, can wrap
Include corresponding wild-type plant or the corresponding transgenic plant without genes of interest.Check plant is the most identical
Plant species or even identical with plant to be assessed kind.Check plant can also be because of separation
Lose the individuality of transgenic plant.Check plant refers not only to full plants as used herein, also refers to plant
Part, including seed and seed fraction.
As used herein, " external source " or " allos " refers to the two or more pieces core from separate sources
Relation between acid or protein sequence.Such as, if genes of interest is usual with the combination of a certain genome
Be not naturally-occurring, then this genes of interest is external source for this genome.Particular sequence for
It is " external source " for its cell inserted or organism.
As used herein, described " expression cassette " refers to include expression desired polypeptides (for SEQ in the present invention
ID NO:3 polypeptide or its conservative variation's polypeptide, active fragment or reactive derivative) needed for be necessary
The gene expression system of element, generally it includes element: promoter, the gene order of coded polypeptide,
Terminator.Additionally, be also optionally included with resistance element, screening (selection) element or reporter element,
Such as GUS, Bar, these elements are operatively connected.
Such as non-other explanation, " polypeptide (albumen) of the present invention ", " desired polypeptides (albumen) ", " described
Polypeptide (albumen) " refer to SEQ ID NO:3 polypeptide or its conservative variation's polypeptide, active fragment or work
Property derivant.
The polypeptide of the present invention also includes its fragment, variant, derivant and analog.As used herein, term
" fragment ", " derivant " refer to be kept substantially the life that the polypeptide of the present invention is identical with " analog "
Thing function or the polypeptide of activity.Described polypeptide fragment, derivant or the like can be (i) have one or
The polypeptide that multiple conservative or non-conservative amino acid residue (preferably conservative amino acid) is replaced, and this
The substituted amino acid residue of sample can may not be and be encoded by genetic code, or (ii) at one or
Multiple amino acid residues have the polypeptide of substituted radical, or (iii) mature polypeptide is with another compound (such as
Extend the compound of polypeptide half-life, such as Polyethylene Glycol) merge the polypeptide formed, or the ammonia that (iv) is additional
Polypeptide that base acid sequence is fused to this peptide sequence and is formed is (such as targeting sequencing or secretion sequence or be used for purification
The sequence of this polypeptide or proprotein sequence, or fusion protein).According to these fragments of definition herein, derive
Thing and analog belong to scope known to those skilled in the art.
The bioactive fragment of the polypeptide of the present invention can be applied in the present invention.Here, described polypeptide
Bioactive fragment be meant that referring to as is a peptide species, it still can keep the present invention of total length many
All or part of function of peptide.Under normal circumstances, described bioactive fragment at least keep 50% complete
The activity of long polypeptide.Under still more preferential conditions, described active fragment can keep full-length polypeptide 60%,
70%, the activity of 80%, 90%, 95%, 99% or 100%.
In the present invention, term " polypeptide of the present invention " refers to the polypeptide of SEQ ID NO:3 sequence.This art
Language also includes having and the variant form (variant) of SEQ ID NO:3 identical function.These variant form bags
Include (but being not limited to): several (usually 1-50, preferably 1-30, more preferably 1-20,
Most preferably 1-10, the most more preferably as 1-8,1-5 individual) amino acid whose disappearance, insert and/or replace, with
And C-terminal and/or N-terminal add or disappearance one or several (usually within 20, preferably
Within 10, within being more preferably 5) aminoacid.Such as, in the art, by similar nature or phase
As aminoacid when replacing, generally will not change the function of protein.The most such as, C-terminal and/
Or N-terminal adds or disappearance one or several aminoacid generally also will not change the function of protein.
The variant form of polypeptide includes: homologous sequence, conservative variant, allelic variant, natural mutation
Body, induced mutants, can be with the DNA hybridization of the polypeptide of the present invention under the conditions of high or low stringency
Polypeptide coded by DNA.
Any peptides homologous with the present invention is high (such as with the homology of the sequence shown in SEQ ID NO:3
It is 80% or higher；Preferably, homology is 90% or higher；It is furthermore preferred that homology be 95% or
Higher, such as homology 96%, 98% or 99%) and have raising plant nitrogen is absorbed ability
Polypeptide be also included in the present invention.
" conservative variation's polypeptide " of the polypeptide of the present invention refers to and the aminoacid sequence phase of SEQ ID NO:3
Ratio, has at most 20, the most at most 10, the most at most 5, the most at most 3 ammonia
Base acid is replaced by the aminoacid that character is similar or close and is formed polypeptide.These conservative variation's polypeptide are
Carry out aminoacid replacement according to table 1 and produce well.
Table 1
| Amino acid residue | Representational replacement | Preferably replace |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
The invention still further relates to polypeptide or the polynucleotide sequence of its conservative variation's polypeptide of code book invention.Institute
The polynucleotide stated can be DNA form or rna form.DNA form includes cDNA, genome
DNA or the DNA of synthetic.DNA can be strand or double-strand.DNA can be coding
Chain or noncoding strand.The coding region sequence of encoding mature polypeptide can be with the gene shown in SEQ ID NO:1
Shown in group sequence or SEQ ID NO:2 coding region sequence is identical or the variant of degeneracy.As herein
Used, " variant of degeneracy " refers to encode the polypeptide with SEQ ID NO:3 sequence in the present invention,
But there is difference with the genome sequence shown in SEQ ID NO:1 or the coding region sequence shown in SEQ ID NO:2
Other nucleotide sequence.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:3 include: the coding of an encoding mature polypeptide
Sequence；The coded sequence of mature polypeptide and various additional coding sequence；The coded sequence of mature polypeptide (with appoint
The additional coding sequence of choosing) and non-coding sequence.
The invention still further relates to the variant (variant) of above-mentioned polynucleotide, its coding has identical ammonia with the present invention
The polypeptide of base acid sequence or the fragment of polypeptide, sum analogous to general Dedekind sum.The variant of these polynucleotide is permissible
It is allelic variant or the variant of non-natural generation of natural generation.These nucleotide variants include taking
For variant, Deletion variants and insertion variant.As known in the art, allelic variant is one
The alternative forms of polynucleotide, it is probably the replacement of one or more nucleotide, lacks or insert, but
Will not be from the function of the polypeptide substantially changing its coding.
The invention still further relates to have at least 50%, preferably between above-mentioned sequence hybridization and two sequences
At least 70%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, the most extremely
The polynucleotide of few 95% homogeny.The present invention be more particularly directed under strict conditions with multinuclear of the present invention
The interfertile polynucleotide of thuja acid.In the present invention, " stringent condition " refers to: (1) is strong at relatively low ion
Hybridization under degree and higher temperature and eluting, such as 0.2 × SSC, 0.1%SDS, 60 DEG C；Or during (2) hybridization
Added with denaturant, such as 50% (v/v) Methanamide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.；Or (3)
Only the homogeny between two sequences is at least more than 90%, just hybridizes when more preferably more than 95%.
Further, the polypeptide of interfertile polynucleotide encoding has identical with the mature polypeptide shown in SEQ ID NO:3
Biological function and activity.
The full length nucleotide sequence of the code nucleic acid of the polypeptide of the present invention or its fragment generally can expand with PCR
The method of increasing method, recombination method or synthetic obtains.For PCR TRAP, can be public according to present invention institute
The relevant nucleotide sequence opened, especially open reading frame sequence design primer, and with commercially available cDNA
Storehouse or the cDNA storehouse as prepared by conventional method well known by persons skilled in the art as template, amplification and
Obtain relevant sequence.
The present invention also relates to comprise the carrier of described polynucleotide, and with described carrier or peptide coding
The host cell that nucleic acid produces through genetic engineering.
In the present invention, the polynucleotide sequence of the polypeptide of code book invention can be plugged in recombinant expression carrier.
Term " recombinant expression carrier " refers to bacterial plasmid well known in the art, phage, yeast plasmid, plant
Cell virus, mammalian cell virus or other carriers.In a word, if can replicate in host and
Stable, any plasmid and carrier can be used.One key character of expression vector is to usually contain duplication
Starting point, promoter, marker gene and translation control element.It is preferred that described expression vector is the most optional
Property ground add resistance element, screening (selection) element or reporter element, such as Bar, GUS.
When described polynucleotide are expressed in higher eucaryotic cells, if inserting enhancer sequence in the carrier
Time will make to transcribe to be strengthened.Enhancer is the cis-acting factors of DNA, generally about has 10 to arrive
300 base pairs, act on promoter transcribing with enhancing gene.
Persons skilled in the art are aware that how to select suitable carrier, promoter, enhancer and host
Cell.
Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.Turn
Change plant and can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as spraying, leaf disk method, Oryza sativa L.
Rataria conversion method etc..
The invention provides a kind of method improveing plant, the method includes improving the present invention in described plant
The expression of polypeptide.Described improvement plant includes: improve plant and nitrogen is absorbed ability；Increase is planted
Nitrate radical content in object；Promote that plant of Solanaceae (such as Fructus Lycopersici esculenti) internal nitrate anion is allocated on the ground more
Portion；Increase the Biomass of plant；Increase fruit weight；Or increase the yield of plant.
After knowing the purposes of polypeptide of the present invention, multiple method well known in the art can be used
The expression of the polypeptide described in regulation.Base is expressed than will be carried it such as by approach known to those skilled in the art
The ceneme of cause is delivered on target spot, and is allowed to the polypeptide of expression activity.
As one embodiment of the present invention, by the polynucleotide of coding said polypeptide by conventional method
It is cloned in suitable carrier, imports to express by the described recombinant vector with exogenous polynucleotide
In the plant cell of described polypeptide, make the described polypeptide described in plant cell expression.
Preferably, it is provided that a kind of method preparing transgenic plant, including:
(1) code nucleic acid of the polypeptide of the present invention of external source is proceeded to plant organ or tissue, it is thus achieved that be transformed into
The plant tissue of the code nucleic acid of described polypeptide or organ；With
(2) plant tissue of the code nucleic acid of the polypeptide of the present invention having proceeded to external source that step (1) is obtained
Or neomorph becomes plant.
As the preferred example of one, described method includes step:
(s1) Agrobacterium of expression vector is carried in offer, and described expression vector contains the polypeptide of the present invention
Code nucleic acid；
(s2) plant tissue or organ are contacted with the Agrobacterium in step (s1), so that the volume of described polypeptide
Code nucleic acid proceeds to and is incorporated on the chromosome of plant cell；
(s3) plant tissue or the organ of the code nucleic acid proceeding to described polypeptide are selected；And
(s4) plant tissue in step (s3) or neomorph are become plant.
Present invention additionally comprises the plant utilizing any one method aforementioned to obtain, described plant includes: proceed to
The transgenic plant of the code nucleic acid of described polypeptide.
Any suitable conventional means can be used, implement described including reagent, temperature, pressure condition etc.
Method.
Moreover, it relates to utilize the polypeptide of the present invention or its code nucleic acid to plant as a kind of gene transformation
The tracking labelling of strain offspring.The invention still further relates to utilize the polypeptide of the present invention or its code nucleic acid as one
Molecular marker, by detecting the expression of the polypeptide of the present invention in plant, the character of plant identification, as
N uptake and utilization ability, Biomass, yield or fruit weight.
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are only used for
The bright present invention rather than restriction the scope of the present invention.The experiment of unreceipted actual conditions in the following example
Method, generally writes according to normal condition such as J. Pehanorm Brooker etc., Molecular Cloning: A Laboratory guide, the third edition,
Science Press, the condition described in 2002, or according to the condition proposed by manufacturer.
Culture medium prescription
(1) 1/2MS fluid medium
KOH is adjusted to pH5.7.
(2) 1/2MS solid medium
1/2MS fluid medium；
1% agar powder.
The fluid medium (1/2 × MS culture fluid) of (3) 0,0.5 or 5mM nitrate anion
1/2MS fluid medium deducts KNO3, is 0 nitrate anion culture medium.
0 nitrate anion culture medium adds 0.5mM KNO3, is 0.5mM nitrate anion culture medium.
0 nitrate anion culture medium adds 5mM KNO3, is 5mM nitrate anion culture medium.
Embodiment 1, the polypeptide of the present invention and gene order thereof
The sequence of the gene of the present invention is as shown in SEQ ID NO:1.Wherein coding region sequence such as SEQ ID
Shown in NO:2.
GCCTAAAATGGGTGATATTGAAGGATCACCAGGAAGTTCAATGCATGGTG TTACTGGTAGAGAACCAGTTCTTGCATTTTCAGTTGCTTCACCAATTGTACCAA CTGATACATCAGCCAATTTCAAAGTCCCTGTTGATTCTGAACATAAAGCTAAAG TTTTTAAATTTTATTCGTTTTCGAAACCTCATGGACTAACGTTTCAACTCTCATG GATTTCATTTTGTACTTGTTTCGTATCGACTTTTGCTGCAGCCCCTTTAGTCCCT ATTATTAGGGACAATCTTAATTTAACTAAAATGGATGTTGGTAATGCTGGAGTT GCCTCTGTTTCGGGTAGTATCTTGTCTAGGCTAGCTATGGGCGCGATATGTGAC ATGTTAGGTCCTAGATATGGTTGCGCGTTCCTTATAATGTTATCAGCCCCAACT GTTTTTTGTATGTCATTTGTGTCATCGGCTGGAGGGTACGTTGCTGTGAGGTTT ATGATTGGGTTTTCACTAGCAACGTTTGTGTCATGTCAGTATTGGATGAGTACG ATGTTTAATAGTCAAATCATTGGACTTGTGAATGGTACAGCTGCTGGATGGGGT AATATGGGTGGTGGTGCTACTCAACTTATTATGCCTTTGCTCTACGATATAATA CGTAGAGCAGGGGCAACCCCGTTCACTGCTTGGAGAATCGCATTTTTTATTCCT GGATGGCTTCATGTTATTATGGGAATTTTAGTTTTAACTCTTGGACAAGATTTA CCTGATGGTAACCTCGCTTCTTTACAGAAGAAAGGCGATGTTTCTAAAGATAA ATTCTCAAAGgtcagtgacattcagtaccatatcaaaattaacgtttacgtttagctaacatttgttatctgcattagATA TTATGGTATGCTGCAACAAATTACAGAACATGGATCTTTGTTCTGCTCTATGGA TACTCAATGGGAGTTGAATTAACTACAGATAACGTGATTGCTGAGTATTTCTTC GATAGgttagatttgatttgtttccctatagtacttaaaacattatacgaacataaagaaattgagtcaatttttgtatgtagATT TGATTTGAAGCTTCATACAGCTGGAATCATCGCTGCAACATTTGGCATGGCTAA CTTATTAGCGCGACCATTTGGAGGATGGTCATCAGATGTTGCAGCTAAACATTT CGGGATGAGAGGCAGATTATGGAATTTATGGATTTTACAAACACTTGGTGGTG TGTTCTGTTTACTACTTGGAAGGGCTACTACACTTCCTCTGGCTATTACTTGGAT GATCATATTCTCAATAGGTGCACAAGCAGCATGTGGTGCAACGTTTGGAATTA TTCCCTTTATTTCGCGAAGATCATTAGGTATAATATCAGGTATGACAGGAGCTG GAGGCAATTTTGGTTCCGGATTGACACAACTACTGTTTTTCACGAGCACAAAGT ACTCGACAGGAACAGGACTAACGTATATGGGGATGATGATCATCGCGTGTACA CTTCCAGTAATGTTAGTTCATTTTCCACAGTGGGGTAGTATGTTTTTGCCTCCAT CTAAAGATCCTATTAAGGGTACTGAAGAACATTATTTTGGTTCTGAGTATACTG AGGATGAGAAACAAAAGGGAATGCACCAGAACAGCATCAAGTTCGCGGAAAA CAGCAGGACAGAGCGTGGGAAGAAGCGCGTTGGTTCAGCACCTACTCCGCCTA ATGTAACACCAAATCGCGTCTGATGGGGAAAAAATTAAAATACTTACTCGCAG
TTCATGCT(SEQ ID NO:1)
In SEQ ID NO:1, starting coding from ATG, what underscore indicated is coding region.This gene is compiled
The aminoacid sequence of the polypeptide of code is as shown in SEQ ID NO:3.
Embodiment 2, the response of gene pairs environment nitrate radical content of the present invention
Fructus Lycopersici esculenti (Solanum lycopersicum) seed is at the upper cultivation of 1/2MS culture medium (solid), condition of culture
Be 16 hours illumination/8 hour dark, 22 DEG C, go to after cultivating 1 week 1/2MS liquid medium is trained
Support 17 days；Go to the liquid medium (1/2 × MS of restriction potassium nitrate of 0,0.5 or 5mM nitrate anion the most again
Culture fluid) middle cultivation.After cultivating 4 days in containing variable concentrations nitrate anion 1/2MS culture fluid, obtain whole
Strain plant, uses real-time fluorescence quantitative RT-PCR to analyze the transcriptional expression situation of gene described in plant.
Design real-time quantitative fluorescence RT-PCR primer sequence, for measuring the primer of the gene of the present invention
For:
Forward primer: 5 '-ggtacccagacgcgatttggtgtt-3 ' (SEQ ID NO:4)；
Downstream primer: 5 '-tgtacacttccagtaatgttagtt-3 ' (SEQ ID NO:5)；
GAPDH is the crt gene of a constitutive expression, as the purposes of homogenization.For measuring
The primer of GAPDH is as follows:
GAPDH+:5 '-ctgctctctcagtagccaacac-3 ' (SEQ ID NO:6)；
GAPDH-:5 '-cttcctccaatagcagaggttt-3 ' (SEQ ID NO:7)；
Primer entrusts Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's synthesis.
Real time fluorescence quantifying PCR method:
Whole plant, through liquid nitrogen grinding, uses Trizol test kit (Invitrogen) to extract total serum IgE.Specifically
Extracting method is with reference to Trizol test kit description.
Total serum IgE through DNaseI process, 37 DEG C, 30 minutes.Through equal-volume phenol, chloroform, 0.1 body
Long-pending 3M sodium acetate (pH5.2) and 2 times of volume dehydrated alcohol precipitations ,-20 DEG C, 30 minutes.12000g,
4 DEG C, 15 minutes.1mL 70% ethanol washes precipitation once, air-dries 5 minutes, with 30 μ L DEPC process
The water dissolution precipitation crossed, obtains the total serum IgE without DNA.
Total serum IgE sample takes 3 μ g, uses the reverse transcription system of M_MLV (Promega) to invert respectively
Record, concrete grammar is with reference to Promega company M_MLV test kit description.
The reaction system of real-time quantitative fluorescence PCR is following (cumulative volume 25 μ L):
Premix Ex TaqTM(2 ×) (Takara): 12.5 μ L,
10 μMs of Primer (+): 0.5 μ L,
10 μMs of Primer (-): 0.5 μ L,
CDNA template: 5 μ L,
Sterile deionized water: 6.5 μ L.
The reaction condition of real-time quantitative fluorescence PCR:
First, 95 DEG C, 2 minutes (denaturation)；
Then, 95 DEG C, 15 seconds；58 DEG C, 15 seconds；72 DEG C, 20 seconds；Carry out 40 circulations altogether.
Real-time quantitative fluorescence PCR instrument uses Eppendorf Mastercycler realplex2。
The result of real-time quantitative fluorescence PCR is as it is shown in figure 1, have in Fructus Lycopersici esculenti shown in SEQ ID NO:1
The transcriptional level of the gene of genome sequence is risen by nitrate induction.
Embodiment 3, the gene of the present invention have expression at root, stem, leaf and in spending
Tomato seeds is in the upper cultivation of 1/2MS culture medium (solid), and condition of culture is 16 hours illumination/8 hour
Dark, 22 DEG C, go to 0 after cultivating 1 week, the fluid medium of 0.5 or 5mM nitrate anion (limits nitric acid
1/2 × MS culture fluid of potassium) middle cultivation, it is further cultured for 21 days, obtains the root of tomato plant, stem, leaf respectively
And flower, use real-time quantitative fluorescence PCR method to detect the gene of present invention table in Fructus Lycopersici esculenti different tissues
Reach situation, PCR experiment condition such as embodiment 2.
Result as in figure 2 it is shown, have the gene of genome sequence shown in SEQ ID NO:1 Fructus Lycopersici esculenti root,
Stem, leaf and have expression in spending, but express the strongest in spending, minimum in stem in leaf and root secondly.
Embodiment 4, the process LAN present invention gene for the regulation effect of nitrate anion
The structure of the tomato plant of the gene of the process LAN present invention:
Design and synthesize following primer:
5′-ggatccatgggtgatattgaaggat-3′(SEQ ID NO:8)；
5′-actagtcagacgcgatttggtgtta-3′(SEQ ID NO:9)；
With above-mentioned as primer, with the cDNA of Fructus Lycopersici esculenti Micro-Tom as template, with KOD-PLUS system
(Toyobo company) carries out PCR.PCR primer reclaims rear clone and enters in pGEM-T easy carrier, and sequence is surveyed
Surely checking sequence is correct.Carry out the double digestion of BamHI and SpeI, connect into expression vector pCambia1301
BamHI/SpeI in (pCambia1301 is available from U.S. UCSD).The correct recombinant vector connected proceeds to
In Agrobacterium Soup3101 (available from U.S. UCSD).
The seed of Fructus Lycopersici esculenti Micro-Tom carries out disinfection, the soak with ethanol of 70% 90 seconds, uses aseptic water washing 3-4
Secondary, then soak 15 minutes with 20% sodium hypochlorite, with aseptic water washing 7-8 time, afterwards seed is transferred to
Grow in 1/2MS culture medium.Treat the fully deployed cotyledon cutting tomato seedling of cotyledon, be placed in and co-culture cultivation
(MS culture medium, containing 200 μ g/ml inositols, 200 μMs of acetosyringones (AS), 0.8 μ g/ml indole second for base
Acid (IAA), 0.8 μ g/ml 6-benzyl aminopurine (6-BA)), 24 DEG C of illumination cultivation 24 hours.
Inoculation has proceeded to the mono-bacterium colony of Agrobacterium Soup3101 of purpose plasmid and has contained kanamycin in 10ml
(50mg/L) and rifampicin (20mg/L) liquid YEP medium in.28 DEG C of quick oscillation are cultivated 24 hours；
Then take during wherein 1ml forwards the 20ml liquid YEP medium containing identical antibiotic to, 28 DEG C of quick oscillation trainings
Support 24 hours.Co-culture and treat that Agrobacterium grows to OD600Time between 0.6 to 0.8, by Agrobacterium 4000rpm from
The heart 5 minutes, and with the resuspended Agrobacterium of liquid MS medium containing 200 μMs of acetosyringones (AS), make
Last OD600Value reaches about 0.7.
The cotyledon scaled off is placed in the Agrobacterium bacterium solution diluted, contaminates 10 minutes.Outer implant is turned
Move on to previous co-culture on base, co-culture 2 days, first day 25 DEG C of light culture, within second day, train at 25 DEG C of light
Support.
The selection of outer implant and plant regeneration forward outer implant to Selective agar medium, i.e. contain in MS culture medium
200 μ g/ml inositols, 1.5 μ g/ml 6-benzyl aminopurine (6-BA), 0.1 μ g/ml heteroauxing and be used for
The antibiotic kanamycin 50 μ g/ml of transformation and selection.25 DEG C of 16 hours illumination cultivation.
When regeneration bud 3cm height, they are gone to root media, i.e. MS culture medium contains 200 μ g/ml fleshes
Alcohol, 0.1 μ g/ml heteroauxing, 200 μ g/ml Carbenicillins, 50 μ g/ml kanamycin.
By seedling replanting to greenhouse, obtain transfer-gen plant.
Determination of Nitrate Content: tomato plant is water planting 4 weeks in 1/2 × MS culture fluid, with 0.5,5,20
mM KNO3(99.15%N15 abundance, pH=6.0, purchased from Shanghai Chemical Research Inst) labelling 180min,
0.1mM CaSO4Washing 1min, point ground, underground part are drawn materials, and 80 DEG C are dried 3 days, with elementary analysis
Instrument-isotope mass spectrometry combination (Vario EL III/Isoprime, Germany) measures N15 content.
For the gene of the clear and definite present invention concrete physiological action in plant, to this gene overexpression
In tomato plant, the distribution of overground part and underground part nitrate anion is analyzed.Result shows, 0.5, and 5,
In the culture fluid containing nitrate anion of 20mM, the overground part (Shoot) of process LAN Fructus Lycopersici esculenti and underground part (Root)
Middle nitrate radical content all rises so that overground part obtains greater proportion of distribution (i.e. for wild type
Relative to wild type, the ratio of the overground part of transgenic plant/underground part nitrate radical content increases), such as Fig. 3,
The gene action of the prompting present invention is in the redistribution process of nitrate anion.
Therefore, the process LAN of the gene of the present invention can increase the overground part of Fructus Lycopersici esculenti and containing of underground part nitrate anion
Amount, and the allocation proportion of overground part and underground part can be changed.
The Biomass impact of the gene pairs Fructus Lycopersici esculenti of the process LAN present invention under the conditions of embodiment 5, low nitrate anion
The Fructus Lycopersici esculenti of the gene of the process LAN present invention of aforementioned preparation and the seed of wild-type tomatoes are at 1/2 × MS
Culture medium (solid) is cultivated 1 week, transplants seedlings to fluid medium (the restriction potassium nitrate containing 5mM nitrate anion
1/2 × MS culture fluid) in water planting 3 weeks, measure Biomass.
Result shows, under the conditions of the low nitrate anion of 5mM, and the overground part of process LAN tomato plant and underground part
Biomass higher than comparison wild type, such as Fig. 4.
Tomato seeds kind is illumination cultivation 1 week in 1/2MS solid medium, moves to 5mM nitrate anion
In fluid medium 1/2 × MS culture fluid of potassium nitrate (limit), illumination cultivation to fruit reddens (about 2.5 completely
Individual month), measure the weight of the fruit obtained.Under the conditions of the low nitrate anion of 5mM, process LAN tomato plant
Single fruit weight is higher than comparison wild type, such as Fig. 5.
Therefore, under the condition of culture containing nitrate anion, the overexpression of the gene of the present invention can be the most aobvious
Write ground and increase the overground part of Fructus Lycopersici esculenti and underground part Biomass and yield.
As fully visible, the gene of the present invention is risen by nitrate induction expression, has in scape blade root
Expressing, the overground part of process LAN tomato plant and underground part nitrate radical content increase, and part is joined on the ground
More nitrate anions, process LAN Fructus Lycopersici esculenti overground part under the conditions of low nitrate anion and the Biomass of underground part and single fruit
Heavily it is significantly higher than wild type.
Embodiment 6, the process LAN present invention gene pairs arabidopsis in nitrate anion distribution impact
The Agrobacterium Soup3101 preparation utilizing the gene having proceeded to the present invention prepared by previous embodiment 4 turns
Gene arabidopsis, method is as follows: arabidopsis (Col-0) is pinched when rachis is 3-4cm, and main inflorescence is beaten
Push up conversion in latter 4 days.Convert first 1 hour and water sufficient water, spray again after finally using immersion process during conversion.
Conventional method screening obtains the arabidopsis of the gene of the process LAN present invention.
Arabidopsis (Cruciferae) and the wildtype Arabidopsis thaliana of the gene of the process LAN present invention are cultivated at 1/2 × MS
Base (solid) is cultivated 1 week, water planting 3 weeks of transplanting seedlings to 1/2 × MS culture fluid, measure on the ground and underground part
The nitrate radical content divided.
Result shows, the overground part of process LAN Arabidopsis plant and the nitrate radical content of underground part are significantly higher than
Comparison wild type, such as Fig. 6.
Therefore, under the condition of culture containing nitrate anion, the overexpression of the gene of the present invention can be the most aobvious
Nitrate radical content in the overground part of work ground increase arabidopsis and underground part.
As fully visible, the gene of the present invention not only can improve plant nitrogen in the Fructus Lycopersici esculenti of Solanaceae after process LAN
Absorption and distribution, can also improve plant nitrogen in the arabidopsis of the Cruciferae of another species after process LAN
Absorption and distribution.
The all documents mentioned in the present invention are incorporated as reference the most in this application, just as each literary composition
Offer and be individually recited as with reference to like that.In addition, it is to be understood that reading the above-mentioned teachings of the present invention
Afterwards, the present invention can be made various changes or modifications by those skilled in the art, and these equivalent form of values are same
Fall within the application appended claims limited range.
Claims (10)
1. the method improveing plant, it is characterised in that described method includes: process LAN in plant
Polypeptide selected from lower group:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more amino acid residues replacement, lack
Lose or add and formed, and have with the aminoacid sequence identical function shown in SEQ ID NO:3 by
A polypeptide that () is derivative；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% homogeny, and have and SEQ ID NO:
The polypeptide derivative by (a) of the aminoacid sequence identical function shown in 3.
2. the method for claim 1, it is characterised in that described plant includes: plant of Solanaceae,
Crucifer.
3. the method for claim 1, it is characterised in that described method includes: will coding (a)～
C the nucleic acid of () arbitrary described polypeptide proceeds in plant, thus process LAN (a)～(c) arbitrary described polypeptide.
4. method as claimed in claim 3, it is characterised in that described method includes:
(1) providing construction, described construction includes: the expression cassette of (a)～(c) arbitrary described polypeptide；
(2) described construction is proceeded to plant, thus process LAN (a)～(c) arbitrary described polypeptide.
5. method as claimed in claim 4, it is characterised in that step (2) including:
I described construction is converted Agrobacterium by (), it is thus achieved that carry the Agrobacterium of described construction；With
(ii) plant tissue or organ are contacted with the Agrobacterium carrying described construction in step (i), thus
Described construction is made to proceed to plant.
6. the method for claim 1, it is characterised in that described improvement plant includes:
Improve plant and nitrogen is absorbed ability；
Increase the nitrate radical content in plant；
In promoting plant of Solanaceae body, nitrate anion is allocated in overground part more；
Increase the Biomass of plant；
Increase fruit weight；Or
Increase the yield of plant.
7. selected from polypeptide or its code nucleic acid purposes in improvement plant of lower group:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more amino acid residues replacement, lack
Lose or add and formed, and have with the aminoacid sequence identical function shown in SEQ ID NO:3 by
A polypeptide that () is derivative；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% homogeny, and have and SEQ ID NO:
The polypeptide derivative by (a) of the aminoacid sequence identical function shown in 3.
8. purposes as claimed in claim 7, it is characterised in that described plant includes: plant of Solanaceae,
Crucifer.
9. purposes as claimed in claim 7, it is characterised in that described described improvement plant includes:
Improve the plant absorption and transport ability to nitrogen；
Increase the nitrate radical content in plant；
In promoting plant of Solanaceae body, nitrate anion is allocated in overground part more；Or
Increase the Biomass of plant；
Increase fruit weight；
Increase the yield of plant.
10. a plant cell or tissue, it is characterised in that its comprise external source selected from the polypeptide of lower group
Code nucleic acid:
The polypeptide of (a) SEQ ID NO:3 aminoacid sequence；Or
(b) by SEQ ID NO:3 aminoacid sequence through one or more amino acid residues replacement, lack
Lose or add and formed, and have with the aminoacid sequence identical function shown in SEQ ID NO:3 by
A polypeptide that () is derivative；Or
C () and SEQ ID NO:3 aminoacid sequence have at least 80% homogeny, and have and SEQ ID NO:
The polypeptide derivative by (a) of the aminoacid sequence identical function shown in 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510046674.XA CN105985415A (en) | 2015-01-29 | 2015-01-29 | Polypeptide for improving absorption and utilization capability of plants on nitrogen, encoding nucleic acid thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510046674.XA CN105985415A (en) | 2015-01-29 | 2015-01-29 | Polypeptide for improving absorption and utilization capability of plants on nitrogen, encoding nucleic acid thereof and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105985415A true CN105985415A (en) | 2016-10-05 |
Family
ID=57034404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510046674.XA Pending CN105985415A (en) | 2015-01-29 | 2015-01-29 | Polypeptide for improving absorption and utilization capability of plants on nitrogen, encoding nucleic acid thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105985415A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| CN102711445A (en) * | 2009-11-04 | 2012-10-03 | 爱荷华谷类推广协会 | Plants with improved nitrogen utilization and stress tolerance |
| CN102925455A (en) * | 2005-11-07 | 2013-02-13 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and a method for making the same |
-
2015
- 2015-01-29 CN CN201510046674.XA patent/CN105985415A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925455A (en) * | 2005-11-07 | 2013-02-13 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and a method for making the same |
| CN102711445A (en) * | 2009-11-04 | 2012-10-03 | 爱荷华谷类推广协会 | Plants with improved nitrogen utilization and stress tolerance |
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GENBANK: "NM_001247198.1", 《GENBANK》 * |
| ULRICH HILDEBRANDT等: "Expression of nitrate transporter genes in tomato colonized by an arbuscular mycorrhizal fungus", 《PHYSIOLOGIA PLANTARUM》 * |
| 米国华等: "《作物养分高效的生理基础与遗传改良》", 30 June 2012, 中国农业大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105949295B (en) | With the albumen and its encoding gene of flowering of plant time correlation and application | |
| CN103966254B (en) | A kind of transcription factor that can be applicable to regulate plant trait | |
| CN105420248A (en) | Anthocyanin controlling gene PyMYB10.2 and application thereof | |
| CN107383179B (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN102791729A (en) | Molecular engineering of a floral inducer for crop improvement | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN105624188A (en) | Application of SPL18 gene in enhancing plant yield | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN107474123A (en) | A kind of transcription factor ZmCOL3 of domain containing CCT and its encoding gene, carrier, Host Strains and application | |
| CN110066774A (en) | Corn receptoroid kinase gene ZmRLK7 and its application | |
| CN109536516A (en) | The clone of drought-resistant maize gene ZmDSR and its application | |
| CN109762795A (en) | A kind of relevant Sesame SiGolS2 of drought resisting and its application | |
| CN106148390A (en) | CHY zinc finger protein transcriptional activation cofactor and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN102477435A (en) | Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF | |
| CN104278053B (en) | A kind of method for improving drought tolerance in plants ability | |
| CN110257401A (en) | Comospore poplar PtrMYB119 gene is improving the application in tobacco drought tolerance | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN114395023B (en) | Jatropha curcas early flowering gene JcRR1B and application thereof | |
| CN109354620A (en) | Rice transcription factor Os07g05010 gene and its application | |
| CN110157713A (en) | Drought-resistant maize related gene ZmDi19-7 and its application | |
| CN105524930B (en) | Arabidopsis disease-resistant related gene AtIAA17 and its preparation method and application | |
| CN107573411A (en) | Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled | |
| CN114703199A (en) | Plant drought resistance related gene TaCML46 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161005 |
|
| RJ01 | Rejection of invention patent application after publication |