CN105950722B - One kind SNP site relevant to rice brown planthopper resistant and application - Google Patents

One kind SNP site relevant to rice brown planthopper resistant and application Download PDF

Info

Publication number
CN105950722B
CN105950722B CN201610289724.1A CN201610289724A CN105950722B CN 105950722 B CN105950722 B CN 105950722B CN 201610289724 A CN201610289724 A CN 201610289724A CN 105950722 B CN105950722 B CN 105950722B
Authority
CN
China
Prior art keywords
rice
gene
gene promoter
promoter upstream
resistant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610289724.1A
Other languages
Chinese (zh)
Other versions
CN105950722A (en
Inventor
李怡峰
肖汉祥
张振飞
李燕芳
张扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Original Assignee
Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Protection Research Institute Guangdong Academy of Agricultural Sciences filed Critical Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Priority to CN201610289724.1A priority Critical patent/CN105950722B/en
Publication of CN105950722A publication Critical patent/CN105950722A/en
Application granted granted Critical
Publication of CN105950722B publication Critical patent/CN105950722B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of SNP site relevant to rice brown planthopper resistant and applications.The rice single nucleotide polymorphism SNP site, it is respectively positioned in the position of rice BGIOSGA015836 gene promoter upstream -641bp, -140bp and -43bp, wherein the base mutation of BGIOSGA015836 gene promoter upstream -641bp is T, the base mutation of gene promoter upstream -140bp is G, and the base mutation of gene promoter upstream -43bp is G.Present invention discover that there are tight associations with near-isogenic rice lines phenotype for three polymorphic sites of rice BGIOSGA015836 upstream region of gene, pass through the mutation of this 3 polymorphic sites, the high expression that can cause rice brown planthopper resistant BGIOSGA015836 gene, so that rice shows the effect of brown planthopper resistant.

Description

One kind SNP site relevant to rice brown planthopper resistant and application
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of SNP site relevant to rice brown planthopper resistant And application.
Background technique
As the mankind enter the genome times afterwards comprehensively, before development functional genome research has become life science comprehensively Along field.There is synteny since the transgenic technology of rice is relatively easy, and with other gramineous crop genomes, thus By depending on doing model plant.Currently, rice genome deliberate genetic figure and physical map are completed, further to rice functional gene It is studied, is of great significance to socio-economic development and biological study.
The people of half is had more than in the world using rice as staple food at present.Food Security is that the people of the world faces Challenge.The hybrid rice in 20th century 50, the breeding wheat for semidwarfness of the sixties and the seventies, which cultivates scientific and technological revolution twice, keeps rice yield big Amplitude improves.But rice is endangered by the disease pest of large area in recent decades, and Rice Production is made to be on the hazard.Brown paddy plant hopper is China Primary pest in Rice Production, adult and nymph cause yellow leaf or withered with lancet piercing and sucking rice juice, cause the underproduction or Total crop failure.It is recorded according to Chinese agriculture yearbook, brown paddy plant hopper insect pest is national big in 1966,1969,1973,1977,1983 and 2003 Occur, national especially big generation in 1987,1991,2005,2006 and 2007, hazard area reach the 50% of the rice gross area with On, serious loss is caused to China's Rice Production.And the harm of brown paddy plant hopper mostly occurs in the rice mature pustulation period, at this time greatly Amount uses insecticide, and the pollution to paddy is also problem very serious.
Cultivating insect-proof rice kind using brown planthopper resistant gene is method the most cost-effective in brown paddy plant hopper integrated control, And genetic marking method is to cultivate the important technology of resistant variety.With the development of molecular biology and science of heredity, emerge A variety of genetic markers, such as AFLP, RAPD, SSR, SNP label, wherein SNP marker is because having widely distributed, suitable high pass The features such as measuring automated analysis, inheritance stability, has become genetic marker preferred in genetic breeding research.If these heredity marks Note related to the production traits can be linked togather, and be can be realized and carried out selection and use from DNA level, be overcome artificial in conventional method The interference of subjective factor improves the accuracy of selection, and can identify in early days the individual with merit, filters out excellent Good standby parent accelerates breeding process so as to shorten breeding cycle.It is thus found that gene related with rice brown planthopper resistant and Its SNP site, greatly improves screening effect.
Summary of the invention
The purpose of the present invention is to provide a kind of SNP site relevant to rice brown planthopper resistant and its applications.
The technical solution used in the present invention is:
Rice single nucleotide polymorphism SNP site is respectively positioned in rice BGIOSGA015836 gene promoter upstream sequence At Lie -641, -140 and -43 bases, wherein the -641st base of BGIOSGA015836 gene promoter upstream is prominent Become T, the -140th base mutation of gene promoter upstream is G, and the -43rd base mutation of gene promoter upstream is G.
Preferably, application of the rice single nucleotide polymorphism SNP site in screening BPH-resistant rice varieties.
A method of rice brown planthopper resistant being improved, by rice BGIOSGA015836 gene promoter upstream the -641st Base mutation is T, and/or being located at the -140th base mutation of gene promoter upstream is G, and/or is located on gene promoter The -43rd base mutation of trip is G.
A kind of identification method of BPH-resistant rice varieties includes the following steps: to extract oryza sativa genomic dna, to extract Obtained DNA is template, carries out PCR amplification using primer, PCR product sequencing identification will be obtained, if containing list described above Nucleotide polymorphisms SNP site, then be determined as BPH-resistant rice varieties.
Preferably, the primer, nucleotide sequence are as follows:
SNP-f:CAGTTCAACAGGCTGACT (SEQ ID NO:1),
SNP-r:GGGATCAGAGAGGAAGAAATC (SEQ ID NO:2).
Because starting base corresponding to first nucleotide of RNA chain synthesis in gene order is denoted as+1, in this base The sequence of trip is denoted as negative, and the sequence in downstream is denoted as positive number.The BGIOSGA015836 gene of insect-proof rice kind BG1222 it is upper The sequence of -750~-1bp is swum as shown in SEQ ID NO:3, feels the upstream-of the BGIOSGA015836 gene of worm rice varieties TN1 The sequence of 750~-1bp is as shown in SEQ ID NO:4.
The beneficial effects of the present invention are:
Present invention discover that three polymorphic sites of rice BGIOSGA015836 upstream region of gene are deposited with near-isogenic rice lines phenotype Rice brown planthopper resistant BGIOSGA015836 gene can be caused by the mutation of this 3 polymorphic sites in tight association Height expression, so that rice shows the effect of brown planthopper resistant.
The invention also discloses the identification methods of BPH-resistant rice varieties, by extracting oryza sativa genomic dna, to extract Obtained DNA is template, carries out PCR amplification using primer, PCR product sequencing identification will be obtained, if containing above-mentioned monokaryon glycosides Sour polymorphic SNP site, then be determined as BPH-resistant rice varieties.
Detailed description of the invention
The BGIOSGA015836 expression quantity time sequence that Fig. 1 is the rice varieties BG1222 and TN1 after being sucked by brown paddy plant hopper Column variation；
Fig. 2 is hybridization F2The relationship of the expression quantity of BGIOSGA015836 and near-isogenic rice lines fractional value in offspring.
Specific embodiment
Brown paddy plant hopper is the primary pest of hazard rice production, in recent years since Biotypes of The Brown Planthopper Nilaparvata Lugens Stal morphs and it is anti-to generate The reasons such as pharmacological property, brown paddy plant hopper disaster are on the rise.Production practices prove, using resistant variety are most economical, safety and have The measure of effect.The seedling stage pest-resistant rank detection for having carried out many years to BG1222 according to " standard seed plate identification method ", finds it to brown Plant hopper, which has, stablizes resistance, and BG1222 is to bacterial leaf-blight also resistance with higher, therefore with higher in breeding Utility value.
TN1 is the internationally recognized sense worm rice varieties without any anti insect gene.
Inventor is by having the research of the rice varieties BG1222 of stable resistance and sense worm rice varieties TN1 to brown paddy plant hopper Find brown planthopper resistant gene in rice BGIOSGA015836.Pest-resistant cultivar is compared with feeling worm kind, the gene of BGIOSGA015836 There are significant differences for expression quantity.In pest-resistant cultivar BG1222, the expression quantity of BGIOSGA015836 is than sense worm rice varieties TN1 High ten times of expression quantity or more.Regardless of whether the expression quantity for being sucked the BGIOSGA015836 in BG1222 by brown paddy plant hopper is all remote Expression quantity higher than TN1.
Furthermore inventor is also to brown planthopper resistant gene in pest-resistant rice varieties BG1222 and sense worm rice varieties TN1 The upstream sequence of BGIOSGA015836 is analyzed, and finds 3 polymorphic SNP sites.
Rice varieties BG1222 used in R&D process of the present invention and sense worm rice varieties TN1 is homozygote.
Below with reference to embodiment, the present invention is further illustrated, and however, it is not limited to this.
There are significant differences for the gene expression amount of 1 pest-resistant cultivar of embodiment BGIOSGA015836 compared with feeling worm kind
One, paddy gene RNA is extracted
1) sample is divided into tissue and cell: cell is directly collected；Liquid nitrogen grinding tissue samples are added 500ul and contain 4% β- The CTAB extracting solution of mercaptoethanol, 65 degree of water-bath 30min；
2) isometric chloroform/isoamyl alcohol (24:1) then is added, 10,000g is centrifuged 10min after mixing；
3) isometric isopropanol is added, -20 degree place 1h, and 12,000g centrifugation 10min abandon supernatant；
4) 1000ul Trizol is added and precipitating is resuspended, 200 μ l chloroforms are then added, are shaken vigorously by hand for 15 seconds, room temperature is quiet Set 5min；
5) at 4 DEG C, 10,000g centrifugation 3min, solution is divided into three layers, and RNA is dissolved in water phase, transfer water phase to another New RNase free EP pipe；
6) 0.5 times of volume isopropanol is added, vortex mixes well；
7) at 4 DEG C, 12,000g centrifugation 10min, there is RNA precipitate in tube bottom after centrifugation, removes supernatant；
8) 75% ethyl alcohol of 1ml is added, is gently overturned with hand, 12,000g centrifugation 5min remove supernatant；
9) room temperature is dried or is dried in vacuo, and 60 μ l DEPC water dissolution precipitating is added.
Two, remove genome
Using the DNase I of RNase-free, by following system configurations reaction solution:
37 DEG C of digestion 30min, 65 DEG C of inactivation 10min.
Then it operates according to the following steps:
1) isometric phenol is added, 10,000rpm after mixing of turning upside down, is centrifuged 5min, takes supernatant；
2) isometric chloroform is added, 10,000rpm after mixing of turning upside down, is centrifuged 10min, takes supernatant；
3) isometric isopropanol is added, gently mixes well, -20 DEG C of standing 15min；
4) at 4 DEG C, 10,000g centrifugation 10min collect RNA precipitate, remove supernatant；
5) twice with 75% ethanol washing, super-clean bench air-dries；
6) 10 μ l DEPC water dissolution precipitating is added.
Three, purity detectings and electrophoresis detection
Purity detecting: 60 times of 2 μ l RNA sample dilutions are taken, are measured in micro-spectrophotometer k2800 (the triumphant Austria in Beijing) OD value, OD260/OD280Ratio be greater than 1.8, illustrate preparation RNA it is purer, no protein contamination.
Four, reverse transcriptions
1) template ribonucleic acid, primer mixture, total amount 12ul are added in PCR pipe.Reaction system is as follows:
Cool down 2min after 70 DEG C of heat preservation 10min on ice rapidly.
2) following reagent is added in the PCR pipe
By 42 DEG C of heat preservation 60min of above-mentioned 20 μ l reaction solution；72 DEG C of heat preservation 15mn；- 20 DEG C save backup.
Five, are quantitative
The analysis of the gene expression amount of BGIOSGA015836 is carried out using following primer pair, base sequence is as follows.
RE-f:CCAACAGCTCTGCGCTCATC (SEQ ID NO:5),
RE-r:ACTCCAGCCAAAAGAAACCCA (SEQ ID NO:6).
1) reaction system: cDNA dilutes 3 times
2) reaction condition: ViiA7software is used
95℃30S；
95 DEG C of 3S, 60 DEG C of 34S (collecting fluorescence signal)；45 circulations.
Melt curve analysis analysis: it -95 DEG C of temperature 60 C, reads 1 time per minute.
The result is shown in Figure 1.
Abscissa is the hourage that rice is sucked by brown paddy plant hopper in Fig. 1, and ordinate is the opposite table of BGIOSGA015836 Up to amount: being standardized as numerical value 1, other time and material with the expression quantity of the gene BGIOSGA015836 in 0 hour (h), TN1 Gene expression amount be all based on this, since the difference value of expression quantity has as many as tens times, thus by expression numerical quantity take with 10 Final relative expression quantity is obtained for the logarithm at bottom.
In the case where being sucked as can be seen from Figure 1 by brown paddy plant hopper, plant by external irritant, BGIOSGA015836's Expression quantity can improve, and illustrate that both there is the gene composing type (not by environmental stimuli or to have expression poor in BG1222 and TN1 It is different) differential expression, it may have induction type (being caused differential expression by environmental stimuli) differential expression.In different time points, BGIOSGA015836 gene can all be significantly higher than the expression quantity of TN1 in the expression quantity of BG1222.
Fig. 1 is the result shows that the expression quantity of BGIOSGA015836 is than sense worm rice varieties TN1's in pest-resistant cultivar BG1222 High ten times of expression quantity or more.Regardless of whether being sucked by brown paddy plant hopper, the expression quantity of the BGIOSGA015836 in BG1222 is all remote high In the expression quantity of TN1.
The clone of the gene of embodiment 2BGIOSGA015836 and polypeptide analysis
The BGIOSGA015836 gene of pest-resistant cultivar BG1222 and sense worm kind TN1 are cloned respectively, divided Analysis.
The wherein BGIOSGA015836 gene in pest-resistant cultivar BG1222, nucleotide sequence is as shown in SEQ ID NO:7 (including exon and introne) feels the BGIOSGA015836 gene in worm kind TN1, nucleotide sequence such as SEQ ID (including exon and introne) shown in NO:8.
Wherein in pest-resistant cultivar BG1222 the cDNA sequence of BGIOSGA015836 gene as shown in SEQ ID NO:9；And feel The cDNA sequence of BGIOSGA015836 gene is as shown in SEQ ID NO:10 in worm kind TN1.Above-mentioned cDNA has base at 5 to have Institute is different, but the polypeptide sequence for encoding obtained rice brown planthopper resistant is identical, amino acid sequence such as SEQ ID NO: Shown in 11.
The detection of 3 pest-resistant cultivar of the embodiment upstream BGIOSGA015836 polymorphic site compared with feeling worm kind
One, oryza sativa genomic dna is extracted using CTAB extraction process, or extracts paddy gene using the kit of commercialization Group.
Two, PCR
The detection of the upstream BGIOSGA015836 polymorphic site, the following institute of base sequence are carried out using following primer pair Show.
SNP-f CAGTTCAACAGGCTGACT (SEQ ID NO:1),
SNP-r GGGATCAGAGAGGAAGAAATC (SEQ ID NO:2).
Reaction system is as follows:
PCR response procedures are as follows: 94 DEG C of 4min；94 DEG C of 50sec, 55 DEG C of 30sec, 72 DEG C of 50ec, 35 circulations.72℃ 10min.PCR reaction product is sequenced after purification, its gene polymorphism sites type is judged according to the sequence of sequencing result.
Because starting base corresponding to first nucleotide of RNA chain synthesis in gene order is denoted as+1, in this base The sequence of trip is denoted as negative, and the sequence in downstream is denoted as positive number.
Post analysis discovery is sequenced: in pest-resistant cultivar BG1222 and sense worm kind TN1 in the upstream sequence of BGIOSGA015836 There are 3 SNP polymorphic sites, and there are tight associations with near-isogenic rice lines phenotype, the results are shown in Table 1.
The distribution of 1 SNP of table
Upstream position TN1 BG1222
-641 C T
-140 T G
-43 A G
In table 1, pest-resistant cultivar BG1222 is located at BGIOSGA015836 gene promoter upstream compared with feeling worm kind TN1 The base C of -641bp (namely at the -641st bases) sports T, is located on BGIOSGA015836 gene promoter The base T of trip -140bp (namely at the -140th base) is mutated into G, and is located at BGIOSGA015836 gene promoter The base A of sub- upstream -43bp (namely at the -43rd base) is mutated into G.
Upstream -750~-1bp sequence of the BGIOSGA015836 gene of insect-proof rice kind BG1222 such as SEQ ID Shown in NO:3, upstream -750~-1bp sequence such as SEQ ID NO of the BGIOSGA015836 gene of worm rice varieties TN1 is felt: Shown in 4.
Although the upstream sequence of above-mentioned two kind BGIOSGA015836 gene there is also the difference of other bases, With the presence of and only this 3 SNP polymorphic sites and near-isogenic rice lines phenotype tight association.And this 3 SNP sites are to be located at The upstream regulatory region of BGIOSGA015836 gene promoter.
4 pest-resistant cultivar of embodiment carries out hybridizing F with sense worm kind2Generation
F is established with hybridizing for TN1 by BG12222Progeny population, F2The sample n=512 of progeny population.Therefrom have chosen The individual detection of 60 different resistance fractional values, and to the F of different resistance rank phenotypes2Offspring individuals detect it respectively The expression quantity of BGIOSGA015836, with determine BGIOSGA015836 expression quantity and upstream polymorphic site and rice it is pest-resistant The correlation of phenotype.
As a result see Fig. 2.
Fig. 2 the result shows that: hybridization F2The expression quantity and near-isogenic rice lines that offspring's verifying shows BGIOSGA015836 are at positive It closes (expression quantity is higher, and insect resistace is stronger).Insect resistace is stronger in offspring, and resistance fractional value (Grade) is smaller, corresponding The expression quantity of BGIOSGA015836 is higher.Resistance fractional value (Grade) is divided into 0,1,3,5,7,9；Fractional value is smaller, and to represent it anti- Worm property is stronger.
In F2Progeny population, to the F of different resistance rank phenotypes2Offspring individuals detect BGIOSGA015836 upstream sequence Polymorphic site.It the results are shown in Table 2.
The degree of association of table 2 SNP and near-isogenic rice lines phenotype
Upstream position TN1(S) BG1222(R) SNP index_RF2 SNP index_SF2 Delta_SNP index(SF2-RF2)
-641 C T 0.13 1 0.87
-140 T G 0.12 1 0.88
-43 A G 0.13 1 0.87
In table 2, SNP index indicate the base type in the site compared with reference sequences, the alkali different from reference sequences The sequence quantity of base type divided by sequence quantity in total ratio；If SNP index is the 0 base type for showing the site It is just the same with reference sequences, if SNP index is 1 to show that the base type in the site and reference sequences are completely different.
Table 2 is using the sequence of BG1222 as reference sequences, RF2(F2In show the individual of insect resistace) SNP substantially with BG1222 is identical, SF2(F2In show the individual of susceptibility) SNP and BG1222 it is entirely different.Delta_SNP index is anti- Should site and phenotype relevance, show the site and phenotype non-correlation if it is 0, if showing the site closer to 1 It is stronger with the correlation of phenotype.
As known from Table 2: hybridization F2In offspring, said gene upstream polymorphic site (SNP) is deposited with near-isogenic rice lines phenotype In tight association.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.
<110>Inst. of Plant Protection, Guangdong Prov. Academy of Agricultural Sciences
<120>a kind of site SNP relevant to rice brown planthopper resistant and application
<130>
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<400> 1
cagttcaaca ggctgact 18
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
gggatcagag aggaagaaat c 21
<210> 3
<211> 750
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 3
agatattttg acctctcaac tattaaaacc ggtgtaattt gattctctaa gcggttttag 60
agtacggttt tgctgacatg gggctttgac ccagttcaac aggctgactt agcatgtggg 120
acccacatct taaaaaaaga agtcaaatta catcgatttc aatagttggg aggtctaaat 180
atccagtatt gcgattcagg gatatacata ttaaagatga gctatatttt gagggagcca 240
aagtggactt attccacagc agcacaaggg ccaactcatg ggccgttttt tctggccctt 300
acactctgtg ctgcctctgc ctgtaccaat cctctttttg attttctttt aacgagttgt 360
ctttttcgac gcacagtcgt attaatacac caactgaaat acgagtacaa tttctgtaca 420
atacatacgt acatacatac acgtattctt tagaagtaca tacatatacg aagcctttca 480
gtttcaggtg ggacccaccc cgcacaccac gacaccgtct cgatcccccc cctcctctcc 540
tcctctcgcc ggcgacccct ccgccgcttc cttcgccgga atcgatcgat cccatcctgc 600
ccaagccgcc gccgatttca cctcaccttg gtcgtaagta ctactatctc tgatccggtc 660
ccgatccaga tcggaattct tccgaccccc taccataatc gcacgcggtt tcttgatttc 720
ttcctctctg atcccaagct aggaggtcgc 750
<210> 4
<211> 750
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 4
agatattttg acctctcagc tattaaaacc ggtgtaattt gattctctaa gcggttttag 60
agtacggttt tgctgacatg gggctttgac ccagttcaac aggctgactc agcatgtggg 120
acccacatct taaaaaaaga agtcaaatta catcgatttc aatagttggg gggtctaaat 180
atccagtatt gcgattcagg gatatacata ttaaagatga gctatatttt gagggagcca 240
aagtggactt attccacagc agcacaaggg ccaactcatg ggccgttttt tctggccctt 300
acactctgtg ctgcctctgc ctgtaccaat cctctttttg attttctttt aacgagttgt 360
ctttttcgac gcacagtcgt attaatacac caactgaaat acgagtacaa tttctgtaca 420
atacatgcgt acatacatac acgtattctt tagaagtaca tacatatacg aagcctttca 480
gtttcaggtg ggacccaccc cgcacaccac gacaccgtct cgatcccccc cctcctctcc 540
tcctctcgcc ggcgacccct ccgccgcttc cttcgccgga atcgatcgat cccatcctgc 600
ccaagccgcc tccgatttca cctcaccttg gtcgtaagta ctactatctc tgatccggtc 660
ccgatccaga tcggaattct tccgaccccc taccctaatc gcacgcgatt tcttgatttc 720
ttcctctctg atcccaagct aggaggtcgc 750
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ccaacagctc tgcgctcatc 20
<210> 6
<211> 21
<212> DNA
<213>artificial sequence
<400> 6
actccagcca aaagaaaccc a 21
<210> 7
<211> 2779
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 7
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccaccca ccacctcctg ccctttccgc cttcctcttt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tcccctgtgt ttgcaggaca cagtgactgg gtttcttttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaac 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaattgcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca caaggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttgtaatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatccaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttctg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 8
<211> 2779
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 8
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccacccc ccacctcctc ccctttccgc cttgctcgtt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tgccctgtgt ttgcaggaca cggtgactgg gtttttgttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaat 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaatttcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca cacggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttataatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatcgaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttccg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 9
<211> 393
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 9
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacag tgactgggtt tcttttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcc 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tctgctgaat cagtggcgtc agataggcga tga 393
<210> 10
<211> 393
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 10
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacgg tgactgggtt tttgttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcg 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tccgctgaat cagtggcgtc agataggcga tga 393
<210> 11
<211> 130
<212> PRT
<213>rice (Oryza.sativa L.)
<400> 11
Met Ala Gly Arg Pro Ser Ile Pro Thr Asn Ser Ser Ala Leu Ile Ala
1 5 10 15
Ile Ile Ala Asp Glu Asp Thr Val Thr Gly Phe Leu Leu Ala Gly Val
20 25 30
Gly Asn Val Asp Leu Arg Lys Lys Thr Asn Tyr Leu Ile Val Asp Asn
35 40 45
Lys Thr Thr Val Lys Gln Ile Glu Asp Ala Phe Lys Glu Phe Thr Thr
50 55 60
Arg Glu Asp Ile Ala Ile Val Leu Ile Ser Gln Tyr Val Ala Asn Met
65 70 75 80
Ile Arg Phe Leu Val Asp Ser Tyr Asn Arg Pro Val Pro Ala Ile Leu
85 90 95
Glu Ile Pro Ser Lys Asp His Pro Tyr Asp Pro Ala His Asp Ser Val
100 105 110
Leu Ser Arg Val Lys Tyr Leu Phe Ser Ala Glu Ser Val Ala Ser Asp
115 120 125
Arg Arg
130

Claims (4)

1. application of the rice single nucleotide polymorphism SNP site in screening BPH-resistant rice varieties, the SNP site difference It is positioned at rice BGIOSGA015836 gene promoter upstream sequence the -641st, -140 and -43 bases, wherein The -641st base mutation of BGIOSGA015836 gene promoter upstream is T, the -140th base mutation of gene promoter upstream For G, the -43rd base mutation of gene promoter upstream is G, and the nucleotides sequence of rice BGIOSGA015836 gene is classified as SEQ ID NO:7.
2. a kind of method for improving rice brown planthopper resistant, it is characterised in that: by rice BGIOSGA015836 gene promoter upstream - 641st base mutation is T, and being located at the -140th base mutation of gene promoter upstream is G, and is located on gene promoter The -43rd base mutation of trip is G, and the nucleotides sequence of rice BGIOSGA015836 gene is classified as SEQ ID NO:7.
3. a kind of identification method of BPH-resistant rice varieties, which comprises the steps of: extract rice genome DNA carries out PCR amplification using primer, includes SNP site in amplified production, will obtain to extract obtained DNA as template The sequencing identification of PCR product, if the -641st base of SNP site is T, the -140th base is G, and the -43rd base is G, then sentences It is set to BPH-resistant rice varieties；
The SNP site is respectively positioned in rice BGIOSGA015836 gene promoter upstream sequence the -641st, -140 At -43 bases, wherein the -641st base mutation of BGIOSGA015836 gene promoter upstream is T, on gene promoter The -140th base mutation of trip is G, and the -43rd base mutation of gene promoter upstream is G, rice BGIOSGA015836 gene Nucleotides sequence be classified as SEQ ID NO:7.
4. the identification method according to claim 3, it is characterised in that: the primer, nucleotide sequence are as follows:
SNP-f:CAGTTCAACAGGCTGACT(SEQ ID NO:1),
SNP-r:GGGATCAGAGAGGAAGAAATC(SEQ ID NO:2).
CN201610289724.1A 2016-05-03 2016-05-03 One kind SNP site relevant to rice brown planthopper resistant and application Active CN105950722B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610289724.1A CN105950722B (en) 2016-05-03 2016-05-03 One kind SNP site relevant to rice brown planthopper resistant and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610289724.1A CN105950722B (en) 2016-05-03 2016-05-03 One kind SNP site relevant to rice brown planthopper resistant and application

Publications (2)

Publication Number Publication Date
CN105950722A CN105950722A (en) 2016-09-21
CN105950722B true CN105950722B (en) 2019-09-03

Family

ID=56913563

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610289724.1A Active CN105950722B (en) 2016-05-03 2016-05-03 One kind SNP site relevant to rice brown planthopper resistant and application

Country Status (1)

Country Link
CN (1) CN105950722B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1896281A (en) * 2006-06-13 2007-01-17 南京农业大学 Molecular mark method for rice variety anti-brownspot gene site
CN102181440A (en) * 2011-04-13 2011-09-14 武汉大学 Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof
CN103215237B (en) * 2013-03-25 2015-06-24 南京农业大学 Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof
CN103509791B (en) * 2013-07-31 2016-03-16 江西省农业科学院水稻研究所 The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1896281A (en) * 2006-06-13 2007-01-17 南京农业大学 Molecular mark method for rice variety anti-brownspot gene site
CN102181440A (en) * 2011-04-13 2011-09-14 武汉大学 Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof
CN103215237B (en) * 2013-03-25 2015-06-24 南京农业大学 Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof
CN103509791B (en) * 2013-07-31 2016-03-16 江西省农业科学院水稻研究所 The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof

Also Published As

Publication number Publication date
CN105950722A (en) 2016-09-21

Similar Documents

Publication Publication Date Title
Liu et al. Combined use of bulked segregant analysis and microarrays reveals SNP markers pinpointing a major QTL for resistance to Phytophthora capsici in pepper
Yakubov et al. Combination of SCAR primers and Touchdown-PCR for sex identification in Pistacia vera L.
CN110183525A (en) The relevant TXR albumen of wheat stripe rust resisting disease and its encoding gene and application
CN115927720B (en) Soy saponin related KASP (KASP) mark and application thereof
CN102395678A (en) Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof
CN106434944A (en) Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica
Miyatake et al. Fine mapping of a major locus representing the lack of prickles in eggplant revealed the availability of a 0.5-kb insertion/deletion for marker-assisted selection
CN108456740B (en) Rice blast resistance site &#39;Pi-jx&#39;, Indel marker primer and breeding application thereof
CN107201395A (en) Paddy rice brown planthopper resistant major gene resistance Bph30 molecular labeling and its application
CN108384879A (en) A kind of SSR primers and method for watermelon hybrid object innovation
Shen et al. Analysis of genetic diversity of Brassica rapa var. chinensis using ISSR markers and development of SCAR marker specific for Fragrant Bok Choy, a product of geographic indication
Katoh et al. Genetic diversity within cultivated teas based on nucleotide sequence comparison of ribosomal RNA maturase in chloroplast DNA
CN105820222B (en) Brown planthopper resistant gene in rice and its application
CN105950722B (en) One kind SNP site relevant to rice brown planthopper resistant and application
CN103882032B (en) Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application
CN110358861A (en) R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule
CN112746123B (en) Molecular marker closely linked with wheat root rot vermicular spore black embryo disease resistance QTL and application thereof
CN109825604A (en) With the molecular labeling of peach aphid resistance shape close linkage, for detecting the primer, kit, method and its application of peach aphid resistance shape
CN111334597B (en) SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof
CN105506152B (en) A kind of specific primer, molecular labeling and its detection method of efficient detection Resistance genes of vice Pita
CN112813180B (en) Molecular marker and primer pair for identifying cabbage leaf wax powder character and application thereof
Chen et al. Marker-assisted development and evaluation of monogenic lines of rice cv. Kaohsiung 145 carrying blast resistance genes
CN113943732A (en) SNP (Single nucleotide polymorphism) marker related to heat resistance of cucumber in adult stage, primer group, kit and application
CN110499388B (en) Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof
CN111733273A (en) DNA barcode sequence and method for identifying lycium species by using same

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant