CN103882032B - Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application - Google Patents
Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application Download PDFInfo
- Publication number
- CN103882032B CN103882032B CN201410114320.XA CN201410114320A CN103882032B CN 103882032 B CN103882032 B CN 103882032B CN 201410114320 A CN201410114320 A CN 201410114320A CN 103882032 B CN103882032 B CN 103882032B
- Authority
- CN
- China
- Prior art keywords
- disease
- foc
- cucumber
- gene
- resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application.The gene is SEQ ID NO in sequence table:Nucleotide sequence shown in 1.The disease-resistant gene Foc 4 that the present invention is provided has important using value, the molecular labeling or its close linkage that specificity can be produced according to the gene sequence information is marked, the genotype of cucumber and Progeny plants can be identified with these marks, for molecular marker assisted selection breeding, so as to improve breeding efficiency；In addition, the cucumber fusarium axysporum disease-resistant gene Foc 4 of the present invention can be also used for seed selection scab of cucumber disease-resistant variety.
Description
Technical field
The invention belongs to gene order and application, and in particular to cucumber fusarium axysporum disease-resistant gene Foc-4 and its coding
Albumen and application.
Background technology
Cucumber (Cucumis Sativus.L) is extensively cultivated in the world, China be in the world cucumber cultivation area it is maximum,
Total output highest country.
Cucumber fusarium axysporum (Fusarium Wilt), also known as wilt disease, dead arm, dead seedling disease, be one kind by soil infection,
Invade from root or root neck, in the entozoic systemic disease (conduit type droop) of vascular bundle, be more difficult anti-on cucumber production
One of three major diseases controlled, often result in greater loss, are current cucumber, particularly greenhouse all over the world and other dependent territory cucumbers
Main soil-borne disease, the germ is in soil, diseased plant residuum and the farm manure not become thoroughly decomposed or is attached on seed and survives the winter, and becomes
Next year primary source of infection, can carry out long-distance communications by rainwater, irrigation water etc., and the general time can make cucumber yield loss 25%-
35%, cucumber can be made to have no harvest during serious morbidity.Droop using chemopreventive effects it is undesirable, not only make Productive statistics increase and
Environmental security hidden danger can be caused, though rotation of crops grafting is usually used in prevention and control add-on technology difficulty and labour cost.Therefore seed selection is disease-resistant
Kind is the optimal path for solving droop harm.
The pathogen of cucumber fusarium axysporum is Fusarium oxysporum cucumber specialized form (Fusarium
Oxysporum.sp.cucumebrium Owen.), belong to Fungi Imperfecti fungi.Germ produces size two types conidium,
Macroconidium spindle or sickleshaped, water white transparency, terminal cell cone, what is had is micro- in hook-shaped, base portion inverted cone section shape
Or sertoli cell, have 1～3, barrier film.Being born in microconidia in aerial hyphae, oval or sausage shape, water white transparency, nothing more
Barrier film.Chlamydospore surface is smooth, yellowish-brown.Because of pathogenic difference between the bacterial strain of various places, different biological strains, state can be distinguished
Have outward a biological strain No. 1, No. 2 and No. 3, China's cucumber fusarium axysporum it is pathogenic different from foreign countries, be named as biological strain 4
Number.
Clone gene is to find one of application most important with the chain molecular labeling of objective trait.Map based cloning (Map-
Based cloning) it is to utilize molecular genetic linkage map, objective trait and molecular labeling are contacted by genetic linkage mapping
Come, target gene is positioned at therewith between chain flanking marker closely；Separation of group analytic approach (BSA can also be used
Method) or NIL method obtain the molecular labeling chain with target gene, then using mapping population the molecular labeling fixed
Position is on collection of illustrative plates.So as to go to screen large fragment DNA library by these marks, the clone relevant with mark is identified, Asia is followed by
Clone and chromosome walking (Chromosome walking) form obtain the cloned sequence containing genes of interest, finally again it is auxiliary it
With convert and complementation test verified (Wang Yongfei, 2001).At present, arrived a large amount of with based on map-based cloning is separated
Plant gene, especially with disease-resistant relevant gene (Zeng ZB, 1994；Easily wheat, 1998), but has no that relevant cucumber is withered
The disease-resistant gene of physiological pathology microspecies 4 of withering is successfully separated the report of clone.
The content of the invention
For the defect of prior art, an object of the present invention is to provide a kind of cucumber fusarium axysporum disease-resistant gene Foc-
4。
The second object of the present invention is to provide a kind of genetic marker of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
The third object of the present invention is that a pair provided for expanding above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 draw
Thing.
The fourth object of the present invention is to provide a kind of cDNA sequence of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
The fifth object of the present invention is to provide a kind of encoding proteins of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
The sixth object of the present invention be a kind of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 and genetic marker be provided should
With.
To achieve these goals, present invention employs technical scheme below：
Cucumber fusarium axysporum disease-resistant gene Foc-4, is (a) SEQ ID NO in sequence table:Nucleotide sequence shown in 1, (b)
It is and SEQ ID NO in sequence table:The homology of sequence more than 90% shown in 1 and with SEQ ID NO in sequence table:Shown in 1
The nucleotide sequence of sequence identical function.
Cucumber fusarium axysporum disease-resistant gene Foc-4 according to the present invention is to carry out finely positioning clone using anti-sense genetic group
Obtain.The present invention selects classical disease-resistant material WI2757 and the susceptible material Tianjin of important backbone parent to grind No. two, builds RILs-
F8、F2：3And F2Genetic group, carries out Primary Location and finely positioning to disease-resistant gene, and anti-blight gene finely positioning is at No. 2
In the 25kb interval ranges of chromosome, the interval only exists 2 genes, compares analysis (http online through NCBI Blast://
Blast.ncbi.nlm.nih.gov/), the 1st gene is TIR NB-ARC disease-resistant genes, and the 2nd gene is bHLH96-like
Transcription factor related gene.It is well known that it is that typical NBS-LRR classes are disease-resistant that TIR NB-ARC genes have conserved domain
Gene, therefore speculate that the TIR NB-ARC genes are the important candidate gene Foc-4 of anti-blight, its DNA sequence dna is by right
Gene order in finely positioning interval carries out acquisition is sequenced.
Above-mentioned SEQ ID NO:The genetic marker of the cucumber fusarium axysporum disease-resistant gene Foc-4 shown in 1, the of susceptible gene
The bases G of 3530 sports base A.
For expanding above-mentioned SEQ ID NO:The pair of primers of the Foc-4 of cucumber fusarium axysporum disease-resistant gene shown in 1, has respectively
SEQ ID NO in sequence table:7 and SEQ ID NO:Nucleotide sequence shown in 8.
The present invention is combined with Softberry online according to the Cucumber germplasm 9930 and GY14 sequence informations announced
Forecasting software FGENESH (http://sunl.softberry.com/) predicted gene structure, and according to the starting for predicting the outcome
With termination coded sequence, design full length gene amplimer and be respectively for a pair：SEQ ID NO in sequence table:7 and SEQ ID NO:
Nucleotide sequence shown in 8, is utilized respectively anti-/ sense material genomic DNA and enters performing PCR amplification, resisted/felt gene in material
The DNA full length sequence SEQ ID NO of Foc-4:1 (disease-resistant material) and SEQ ID NO:2 (susceptible materials), total length 4677bp, and
Two gene DNA sequences in antagonism sense material are contrasted and are analyzed, and Foc-4DNA sequences have one in anti-/ sense material
SNP site, i.e., at the 3530th of the gene, the base of susceptible material is G, and the base of disease-resistant material is A, and which can apply to
Exploitation anti-blight molecular labeling.
Above-mentioned SEQ ID NO:The cDNA sequence of the Foc-4 of cucumber fusarium axysporum disease-resistant gene shown in 1 is SEQ ID in sequence table
NO:Nucleotide sequence shown in 3.
Cucumber fusarium axysporum disease-resistant gene Foc-4cDNA (mRNA) sequence according to the present invention is using total length primer SEQ ID
NO:7 and SEQ ID NO:8 are carried out as template using the first chain after the total serum IgE reverse transcription of anti-/ sense material as upstream and downstream primer
The cDNA of the cucumber fusarium axysporum disease-resistant gene Foc-4 in anti-/ sense material that PCR amplifications are obtained, the gene in anti-/ sense material
CDNA (mRNA) sequence of Foc-4 is respectively SEQ ID NO:3 and SEQ ID NO:4, using Softberry on-line predictions
Foc-4 sequences, obtain cDNA structures, and draw the structural representation (referring to Fig. 1) of Foc-4 genes.By SEQ ID NO:3 Hes
SEQ ID NO:The contrast of 4 sequences, the cDNA (mRNA) of cucumber anti-blight gene Foc-4 exist variable in anti-/ sense material
Shearing difference, causes the cDNA of the Foc-4 big 270bp in disease-resistant material of the 5th extron ratio in susceptible material, thus it is speculated that due to
The presence of the variable sheer causes gene important feature domain to change, so as to the disease resistance for causing TIR NB-ARC genes occurs
Change.
Above-mentioned SEQ ID NO:The encoding proteins of the Foc-4 of cucumber fusarium axysporum disease-resistant gene shown in 1 are the SEQ in sequence table
ID NO:Amino acid sequence shown in 5.
Cucumber fusarium axysporum disease-resistant gene amino acid sequence according to the present invention is being resisted/is being felt in material using Foc-4 genes
CDNA (mRNA) sequence SEQ ID NO:3 and SEQ ID NO:4, obtain respectively through softberry on-line prediction software translations
Must resist/feel FOC-4 amino acid (albumen) sequence SEQ ID NO in material:5 and SEQ ID NO:6, and resist/feel in material
FOC-4 amino acid sequences compare, and FOC-4 has the difference of 90aa in anti-/ susceptible material, thus it is speculated that the difference causes
Disease-resistant domain changes, so as to the disease resistance for causing TIR NB-ARC genes changes.
Applications of the above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 in seed selection cucumber fusarium axysporum disease-resistant variety.
Application of the above-mentioned genetic marker in seed selection cucumber fusarium axysporum disease-resistant variety.
Applications of the above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 in seed selection scab of cucumber disease-resistant variety.
Application of the above-mentioned genetic marker in seed selection scab of cucumber disease-resistant variety.
The present invention has the advantages that：
The present invention utilizes map based cloning and forward genetics method, the disease-resistant gene to cucumber fusarium axysporum biological strain 4
Foc-4 carries out finely positioning and clone, obtains cucumber fusarium axysporum disease-resistant gene Foc-4, and studies the gene in anti-/ susceptible material
In nucleotide sequence and amino acid sequence be analyzed and compare, obtain cucumber anti-blight gene Foc-4 in anti-/ susceptible material
Middle difference and polymorphism analysis, and demonstrate the function of droop disease-resistant gene Foc-4.The disease-resistant gene that the present invention is provided
Foc-4 has important using value, can produce specific molecular labeling according to the gene sequence information or which closely connects
Lock mark, including but not limited to SNP (mononucleotide polymorphic), InDel (insertion and deletion is polymorphic), (restriction enzyme is long for RFLP
Degree is polymorphic), CAP (cutting amplified fragments polymorphic), the genotype of cucumber and Progeny plants can be identified with these marks, for molecule
Marker assisted selection breeding, so as to improve breeding efficiency；In addition, the cucumber fusarium axysporum disease-resistant gene Foc-4 of the present invention can be with
For seed selection scab of cucumber disease-resistant variety.
Description of the drawings
Fig. 1 is cucumber fusarium axysporum gene finely positioning interval gene Foc-4 structural representations.Fig. 1 (A) and Fig. 1 (B) is respectively
To resist/feeling the structural representation of gene Foc-4 in material, disease-resistant Foc-4 genes are resisting/are feeling the big of the 5th extron in material
It is little to have differences.(Foc-4 genes are reversely to insert in DNA sequence, therefore the 3rd extron reality shown in figure
For the 5th extron of Foc-4 genes).
Fig. 2 is that cucumber fusarium axysporum disease-resistant gene Foc-4 positions linkage map, and wherein left figure is fixed at the beginning of being cucumber fusarium axysporum gene
Position schematic diagram, middle figure are droop disease-resistant gene finely positioning schematic diagram, and right figure is gene distribution situation in 25kb interval ranges
And gene annotation.
Fig. 3 is Foc-4 gene SNP molecular labeling digestion verification result schematic diagrams.
Specific embodiment
Below by specific embodiment, the present invention is described in detail, but the present invention is not limited to this.
Embodiment 1：The acquisition of cucumber fusarium axysporum disease-resistant gene Foc-4
First, the disease-resistant gene Foc-4 Primary Locations and finely positioning of cucumber fusarium axysporum biological strain 4
Specific localization method is comprised the following steps：
A, cucumber fusarium axysporum localization of disease resistance genes research parent and genetic group：
WI2757 (male parent) and Tianjin is selected to grind No. two (female parents) respectively for anti-sense parent, 90 RIL-F of structure8Strain, 130
The F of strain2:3Colony and the F more than 2000 plants2Big colony.Wherein, male parent WI2757 and maternal Tianjin grind No. two purchased from Beijing's farming
Thing germplasm resource bank.
B, the research disease index investigation of cucumber fusarium axysporum localization of disease resistance genes：
By the seed gauze wrapped of parent and each colony, hot water treatment of seeds, be sowed at after 28 DEG C of constant temperature vernalization in 50 hole disks,
Nurse young plants in hothouses in air-conditioning, seedling medium is the perlite or Nutrition Soil of sterilizing.
It is little for trying bacterial classification cucumber fusarium axysporum (Fusarium oxysporum f.sp.cucumerinum Owen.) physiology
Kind 4 is the Chinese cucumber fusarium axysporum Race Identification by Huang Zhongsheng etc. and preventing and treating document (Chinese cucumber fusarium axysporum
Race Identification and preventing and treating, North China agronomy report, 1994,9 (4)：Method described in 81-86) is separated and is obtained.Using Weng Zuxin
Method Deng (cucumber fusarium axysporum method of resistance identification research-radicle inocalation method, China's Vegetable, 02 phase in 1985) prepares Huang
Cucurbit wilt bacterium solution, blood counting chamber determine spore concentration.Using leaching root inocalation method:When cucumber seedlings are flattened, extract
Seedling, washes root, 1 × 106～5 × 106Root is soaked in the inoculation liquid of individual spore/mL, then plant into equipped with bactericidal nurishing
In the plastic nutrition bowl (specification 6.5cm × 6.5cm) of soil, cultivate in greenhouse.Maintain 24～28 DEG C daytime, night 16～
20℃.3 repetitions, repeat 30 plants every time.
After being inoculated with as stated above, 7～10d carries out Disease investigation.Severity Scaling standard is：0 grade：It is asymptomatic；1 grade：1
Cotyledon yellow；2 grades：2 cotyledon yellows or wilting；3 grades：1 true leaf is slightly wilted；4 grades：1～2 true leaf is substantially wilted；5
Level：Complete stool is seriously wilted or withered.Wherein less than 2 is disease-resistant, and more than 3 is susceptible type.
Accurate count is carried out to the state of an illness of parent and each colony.
The Primary Location of C, cucumber fusarium axysporum disease-resistant gene Foc-4：
Using (the Genome-wide characterization of simple sequence such as Cavagnaro
Repeats in cucumber, BMC Genomics, the cucumber dense genetic map primer information 2010) delivered, with reference to 90
RIL-F8The F of strain and 130 plants2:3The accurate count of colony's disease index, carries out molecular marker analysis to parent and RIL colonies,
Coding collection parent and each individual plant genotype data of RILs colonies.Female genotype is designated as A, and the genotype of male parent is designated as B, F1It is miscellaneous
Close genotype and be designated as H, fuzzy or missing data is designated as U.Use χ2Test carries out ratio comptibility test analysis to data, adopts
JoinMap 4.0 software (Stam 1993；2001) Van Ooijen build linkage map (referring to Fig. 2), arrange software LOD valves
Be worth for 4.0 and choose Kosambi formula (Kosambi 1944), by cucumber anti-blight gene Primary Location No. 2 dye
In 160kb between the molecular labeling UW017820 and UW084909 of body is interval (referring to Fig. 2), according to (RNA-Seq such as Li
improves annotation of protein-coding genes in the cucumber genome,BMC
Genomics, 2011) annotation to Cucumber germplasm is predicted by Softberry online softwares, and the interval has one
The individual NBS-LRR being made up of multiple NBS-LRR disease-resistant genes connects, and (NBS-LRR is disease-resistant gene conserved structure to disease-resistant gene
Domain), it is difficult to prediction and candidate gene is selected, so need further to expand colony carrying out finely positioning research.
The finely positioning of D, cucumber fusarium axysporum disease-resistant gene Foc-4：
Through building the F more than 2000 plants2Big colony continues to carry out finely positioning to anti-blight gene, meanwhile, this reality
Test room genome has been carried out to anti-sense parent used and resurvey sequence, compare through biological information and analyze, 79560 are developed between parents
Individual Indel and 108727 SNP marker, in the range of the interval 160kb of just positioning selects to devise 14 pairs of Indel molecules
Mark carries out population analysis (referring to table 1), after checking has carried out essence to anti-blight gene using this 14 pairs of Indel marks
Fine positioning is studied, and the synthesis of wherein primer is completed by Sangon Biotech (Shanghai) Co., Ltd., also with JoinMap
4.0 softwares carry out genetic linkage mapping analysis, finally in 2000 plants of F2Big colony is by anti-blight gene finely positioning to dividing
In the range of the 25kb of son mark UW017805 and Indel2027634, nearly 2300 plants of the test material in finely positioning is interval
It is middle to there is 1 exchange individual plant.
Each PCR reaction systems (10 μ L) when finely positioning is carried out using above-mentioned 14 pairs of Indel molecular labelings are as follows：25ng
Template DNA, 0.5 μM of upstream primer, 0.5 μM of downstream primer, the dNTP mix of 0.2mM；0.5U Taq archaeal dna polymerases, 1 × PCR
2 μ L of Buffer (Fermentas), ddH2O supply 10 μ L.
PCR response procedures are：Stage 1：95 DEG C of denaturations 3min；Stage 2：94 DEG C of 30s, 60 DEG C of 1min, 72 DEG C of 1min, move back
1 DEG C of fiery temperature each cycle down, totally 8 circulations；Stage 3：94 DEG C of 30s, 53 DEG C of 30s, 72 DEG C of 1min, totally 32 circulations；Stage
4：72 DEG C of extension 5min；Stage 5:4 DEG C of preservations；Wherein, PCR instrument is the Veriti purchased from Applied Biosystems companies
96well Thermal Cycler。
Table 1 is used for 14 pairs of Indel molecular labeling primer information of finely positioning
E, the analysis of anti-blight predictive genes：
In the 25kb of finely positioning is interval, there are 2 genes, analysis, the 1st gene are compared online through NCBI Blast
For TIR NB-ARC disease-resistant genes, transcription factor related gene of the 2nd gene for bHLH96-like.TIRNB-ARC is NBS-
Common conserved domain in LRR class disease-resistant genes, therefore position the important candidate that the TIR NB-ARC genes are anti-blights
Gene Foc-4.The result of finely positioning eliminates the interference of NBS-LRR series connection disease-resistant genes in just positioning interval.Foc-4 genes
There is a SNP in anti-/ sense storeroom, at the 3530th of gene, disease-resistant gene base is A, and susceptible gene base is G.
Speculate that the SNP may cause the change of premunition, can be used to develop anti-blight compact linkage molecule mark, the TIR NB-ARC
Resistant candidate genes of the gene for droop.
2nd, the acquisition of cucumber fusarium axysporum disease-resistant gene Foc-4 full length DNA sequences
A, material to be tested：
Described material to be tested is disease-resistant material WI2757, grinds No. two as control using susceptible material Tianjin.
The amplification of B, the DNA total lengths of cucumber fusarium axysporum disease-resistant gene Foc-4：
The extraction of Cucumber germplasm DNA adopts CTAB methods, is template so that examination resists/feel material genomic DNA, using Foc-
4 full length genes expand upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 carry out full length gene PCR amplifications, spell through sequence
Meet the full length gene SEQ ID NO for Foc-4 genes being respectively obtained on anti-/ sense material:1 and SEQ ID NO:2, total length is counted
4677bp.Compared using the Foc-4 full length genes of DNAMAN software counterworks/sense material, found in anti-/ sense storeroom
3530th presence, one SNP of Foc-4 genes, in disease-resistant material, base is A, and base is G in susceptible material.The SNP can
As the molecular labeling of anti-blight close linkage, worldwide cucumber fusarium axysporum breeding for disease resistance is applied to.
Contain in the reaction system (20 μ L) of described pcr amplification reaction：25ng template DNAs, 0.5 μM of upstream primer, 0.5
μM downstream primer, the dNTP mix of 0.2mM；0.5U Taq archaeal dna polymerases, 1 × PCR Buffer (Fermentas), 2 μ L,
ddH2O supplies 20 μ L.
Described PCR response procedures are：95 DEG C of denaturations 3min；94 DEG C of 30s, 60 DEG C of 1min, 72 DEG C of 4min, totally 42 are followed
Ring；72 DEG C of extension 10min；PCR instrument is the Veriti 96wellThermal purchased from Applied Biosystems companies
Cycler。
The deionized water of described amplified production sterilizing is diluted to 80 μ L, is put into Caliper nucleic acid automatic analyzers and enters
Row analysis.
Upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:The PCR primer sequencing of 8, DNA full length sequences and sequence assembly
Synthesized and analyzed in Shanghai Sheng Gong companies.Sequencing result shows the full length DNA sequence of cucumber fusarium axysporum disease-resistant gene Foc-4
SEQ ID NO in row such as sequence table:Shown in 1, common 4677bp.
Embodiment 2：Cucumber fusarium axysporum disease-resistant gene Foc-4cDNA and protein sequence identification and analysis
First, cDNA (mRNA) the total length amplification of cucumber fusarium axysporum disease-resistant gene Foc-4：
No. two are ground using anti-sense parent material WI2757 and Tianjin, young leaflet tablet tissue extraction total serum IgE is chosen respectively, is carried out anti-
First chain (cDNA) of transcription synthesis mRNA, expands upstream and downstream using the total length of Foc-4 genes by template of first chains of mRNA
Primer SEQ ID NO:7 and SEQ ID NO:8 enter performing PCR amplification, and cDNA (mRNA) sequence for being obtained in anti-/ sense material respectively is complete
Long SEQ ID NO:3 and SEQ ID NO:4.Compared point using the Foc-4 full length genes of DNAMAN software counterworks/sense material
Analyse, find that variable sheer occurs in anti-/ sense storeroom Foc-4 gene cDNA sequences, show as the presence on the 5th extron
The difference in size of 270bp, referring to Fig. 1.Compared with susceptible material, the cDNA sequence of disease-resistant material is showed between 1915-2184bp
For disappearance.Speculate as the presence of the variable sheer causes gene important feature domain to change, so as to cause TIR NB-ARC
The disease resistance of gene changes.
Described RNA is extracted, reverse transcription reagent box is purchased from Fermentas companies.
Contain in the reaction system (50 μ L) of described pcr amplification reaction：25ng template DNAs, 0.5 μM of upstream primer, 0.5
μM downstream primer, the dNTP mix of 0.2mM；0.5U Taq archaeal dna polymerases, 1 × PCR Buffer (Fermentas), 5 μ l,
ddH2O supplies 50 μ l.
Described PCR response procedures are：95 DEG C of denaturations 3min；94 DEG C of 30s, 60 DEG C of 1min, 72 DEG C of 2min, totally 40 are followed
Ring；72 DEG C of extension 7min；PCR instrument is the Veriti 96well Thermal purchased from Applied Biosystems companies
Cycler。
The PCR primer sequencing of described Foc-4 gene cDNA sequences and sequence assembly are carried out point in Shanghai Sheng Gong companies
Analysis, wherein the cDNA sequence of the Foc-4 genes in disease-resistant material such as SEQ ID NO:Foc-4 genes shown in 3, in susceptible material
CDNA sequence such as SEQ ID NO:4.
2nd, the sequence analysis of the encoding proteins of cucumber fusarium axysporum disease-resistant gene Foc-4：
Cucumber fusarium axysporum disease-resistant gene amino acid sequence according to the present invention is being resisted/is being felt in material using Foc-4 genes
CDNA (mRNA) sequence SEQ ID NO:3 and SEQ ID NO:4, respectively through softberry on-line predictions software translation
Obtain, in resisting/feeling material, FOC-4 amino acid (albumen) sequence is respectively such as SEQ ID NO:5 and SEQ ID NO:Shown in 6, and
Compared in anti-/ sense material using DNAMAN softwares amino acid sequence, find FOC-4 albumen in anti-/ susceptible material
The middle difference that there is 90aa, the relatively susceptible material of FOC-4 amino acid sequences of disease-resistant material, between 638-727aa shows as lacking
Lose.Therefore speculate that the difference causes disease-resistant domain to change, so as to the disease resistance for causing TIRNB-ARC genes occurs to become
Change.
Embodiment 3：The functional verification of disease-resistant gene Foc-4 and apply in seed selection cucumber fusarium axysporum disease-resistant variety
First, the functional verification of cucumber fusarium axysporum disease-resistant gene Foc-4
1st, detected materials：With WI2757 and GY 14 as parent, F is built2Genetic group, therefrom randomly selects 100 individual plants
Carry out droop anti-disease enzyme and sequencing.Wherein, male parent WI2757 and female parent GY 14 are purchased from Crops in Beijing Germplasm Bank.
2nd, by the seed gauze wrapped of above-mentioned detected materials, water seed soaking is sowed at 50 hole disks after 28 DEG C of constant temperature vernalization
In, to nurse young plants in hothouses in air-conditioning, seedling medium is the perlite or Nutrition Soil of sterilizing, is then extracted from seedling respectively using CTAB methods
The genomic DNA of detected materials, and with each genomic DNA as template, using upstream and downstream primer SEQ ID NO:7 and SEQ ID
NO:8 carry out Foc-4 full length genes PCR amplifications, and then PCR primer is sequenced and sequence assembly is carried out, above-mentioned 100 are finally confirmed
There are 27 plants of seedling that there is SEQ ID NO in part detected materials:Foc-4 genes shown in 1.PCR amplification is referring to embodiment 1 the
Two parts.
3rd, to SEQ ID NO:The seedling of the Foc-4 genes shown in 1 carries out fusarium wilt disease resistance detection
There is SEQ ID NO to above-mentioned 30 plants using the method for 1 Part I step B of embodiment:Foc-4 bases shown in 1
The cucumber material of cause carries out field fusarium wilt disease resistance detection.
Found by state of an illness statistical analysis, it is above-mentioned with SEQ ID NO:In the cucumber seedling of the Foc-4 genes shown in 1, disease
Feelings wherein 9 plants 0 grade, 10 plants 1 grade, 8 plants 2 grades, thus illustrate that below 2 grades the presence of fox-4 genes is anti-with cucumber withered
Characteristic of disease shape has uniformity.
2nd, genetic marker is applied in seed selection cucumber fusarium axysporum disease-resistant variety
The present invention utilizes SNP site of the Foc-4 genes that embodiment 1 is obtained in anti-sense material, exists according to dCAPs primers
Line designs website http://helix.wustl.edu/dcaps/dcaps.html, exploitation design are closely connected with anti-/ sense droop
The dCAPs molecular labelings of lock, wherein forward and reverse amplimer are respectively：SEQ ID NO:9
And SEQ ID NO (GATATGTTACAGTACTGTACCCAGTCGA):10(CTAGTAGTGTTAAGGGCTTTGAGCAGTT).It is logical
Cross primer pair parents' material (disease-resistant material WI2757 and susceptible material Tianjin grind No. two) and enter performing PCR amplification, and with reference in SalI
Enzyme cutting is resisted/susceptible specific band respectively to PCR primer digestion, wherein disease-resistant band is 164bp, and susceptible band is
134bp。
The PCR reaction systems of this part and program D with reference to the step of 1 Part I of embodiment；In digestion system (20 μ L)
Contain：10 × NEB buffer solutions, 2 μ l, 10 μ l of pcr amplification product, 100 × BSA, 0.2 μ L, 0.5 μ L of restriction endonuclease SalI, sterilizing are double
Steam water and supply 20 μ L.Endonuclease reaction program is：Stage 1：37 DEG C of incubation 10h；Stage 2：65 DEG C of 20min inactivations；Stage 3：4℃
Preserve.
Using 90 RIL-Fs of the dCAPs molecular labelings to embodiment 18Strain, 130 plants of F2:3Colony's strain and 2000 plants
F2Cucumber material in genetic group enters performing PCR and SalI restriction analysis, and investigates digestion result with disease-resistant phenotype (disease-resistant phenotype
Detect referring to embodiment 1 Part I step B) relation, find Foc-4 genes in dCAPs molecular labelings and 2220 plants
The disease-resistant phenotype close linkage of cucumber material, uniformity reach the level for isolating up to 100%, and its cleavage map is referring to Fig. 3.
The above fully confirms Foc-4 genes and can be applied to according to the dCAPs molecular labelings of its SNP exploitation withered
Disease of withering is anti-/ and susceptible screening and marker assisted selection study.
Embodiment 4：Different genetic background cucumber materials resist/feel the applied analysis of droop Foc-4 gene
First, in order to fully verify contribution rate of the molecular labeling of Foc-4 genes and its SNP in different genetic backgrounds, this
Invention have selected 10 materials, and through No. 4 anti-disease enzymes of field droop biological strain, (anti-disease enzyme method is referring to embodiment 1
Part I step B), find 5 anti-blights, (susceptible material has 5 sense droops：Susceptible parent Tianjin grinds No. two,
COOLGREEN MR 97232, GY 13, Chang Chun Mi Ci and cucumber sequencing material 9930；Disease-resistant material has：Disease-resistant parent
WI2757, M 21, COUNTY FAIR F1, BANNA HUANGGUA, CUCUMIS HARDWICKII), this 10 materials are purchased
From Crops in Beijing Germplasm Bank.
This research carries out genome and resurveys sequence to 10 parts of cucumber materials, compares through biological information and analyzes, have studied including
Anti-/sense parent and Cucumber germplasm sequencing material 9930 find Foc-4 in interior totally 10 material Foc-4 genetic mutation situations
Genotype of the genetic material in the anti-sense material of difference is different because of its genetic background, and Foc-4 genes are not only in multiple genetic backgrounds
There is SNP to make a variation in material in a large number, while a large amount of Indel (insertion and deletion) variations are there is also, referring to table 2.Foc-4 genes
There is uniformity in genotype and phenotype of the Indel and SNP variations in 10 anti-/ susceptible materials.
In wherein disease-resistant material WI2757, M 21 and COUNTY FAIR F1, SNP5 plays important work in resistant effect
With；And Foc-4 genes in BANNA HUANGGUA and CUCUMIS HARDWICKII materials because Indel1-Indel3 and
SNP1-4, SNP6-13 etc. make a variation, and become the homologous gene of Foc-4 genes, and homology is each about 99.6%, but still has withered
Sick disease resistance.
Described genome resurvey sequence and Bioinformatic methods it is consistent with method therefor in embodiment 1.
In following table 2, grey bottom represents INDEL and SNP variations, wherein I：GTTTTTGTTTT is represented and be where there is 11
The insertion of individual base；D：TATATA is represented and be where there is 6 base deletions；SNP is directly identified with becoming isobase.
Table 2
2nd, in BANNA HUANGGUA materials disease-resistant gene Foc-4 functional verification
Disease-resistant gene Foc-4 and SEQ ID NO in BANNA HUANGGUA materials:The difference of the Foc-4 genes shown in 1 it
Place is listed in Table 2 below, the nucleotide sequence all same in other sites.
1st, detected materials：No. two are ground as parent with BANNA HUANGGUA and Tianjin, F2 genetic groups are built, it is therefrom random to select
Taking 80 individual plants carries out following experiment.Wherein, male parent BANNA HUANGGUA and maternal Tianjin grind No. two purchased from Crops in Beijing
Germplasm Bank.
2nd, by the seed gauze wrapped of above-mentioned detected materials, water seed soaking is sowed at 50 hole disks after 28 DEG C of constant temperature vernalization
In, to nurse young plants in hothouses in air-conditioning, seedling medium is the perlite or Nutrition Soil of sterilizing, is then extracted from seedling respectively using CTAB methods
The genomic DNA of detected materials, and with each genomic DNA as template, using upstream and downstream primer SEQID NO:7 and SEQ ID
NO:8 carry out Foc-4 full length genes PCR amplifications, then PCR primer is sequenced and sequence assembly is carried out, finally confirms above-mentioned to be measured
There is disease-resistant gene Foc-4 in there are 23 plants of seedling in material.The PCR is expanded referring to embodiment 1 (two).
3rd, fusarium wilt disease resistance detection is carried out to the seedling with disease-resistant gene Foc-4
There is to above-mentioned 23 plants of Preliminary Identifications the cucumber material of disease resistance using the method for 1 Part I step B of embodiment
Carry out field fusarium wilt disease resistance detection.
Found by state of an illness statistical analysis, above-mentioned 23 plants of Preliminary Identifications have the cucumber material state of an illness of disease resistance at 2 grades
Hereinafter, wherein 10 plants 0 grade, 8 plants 1 grade, 5 plants 2 grades, thus illustrate, presence and the cucumber anti-blight proterties of Foc-4 genes have
Uniformity.
3rd, in CUCUMIS HARDWICKII materials disease-resistant gene Foc-4 functional verification
Disease-resistant gene Foc-4 and SEQ ID NO in CUCUMIS HARDWICKII materials:Foc-4 shown in 1
It is listed in Table 2 below in place of the difference of gene, the nucleotide sequence all same in other sites.
1st, detected materials：No. two are ground as parent with CUCUMIS HARDWICKII and Tianjin, F is built2Genetic group, Cong Zhongsui
Machine is chosen 80 individual plants and carries out following experiment.Wherein, maternal CUCUMIS HARDWICKII and male parent Tianjin grind No. two purchased from Beijing
City's crops Germplasm Bank.
2nd, by the seed gauze wrapped of above-mentioned detected materials, water seed soaking is sowed at 50 hole disks after 28 DEG C of constant temperature vernalization
In, to nurse young plants in hothouses in air-conditioning, seedling medium is the perlite or Nutrition Soil of sterilizing, is then extracted from seedling respectively using CTAB methods
The genomic DNA of detected materials, and with each genomic DNA as template, using upstream and downstream primer SEQ ID NO:7 and SEQ ID
NO:8 carry out Foc-4 full length genes PCR amplifications, then PCR primer is sequenced and sequence assembly is carried out, finally confirms above-mentioned to be measured
There is disease-resistant gene Foc-4 in there are 19 plants of seedling in material.The PCR is expanded referring to embodiment 1 (two).
3rd, fusarium wilt disease resistance detection is carried out to the seedling with disease-resistant gene Foc-4
There is to above-mentioned 19 plants of Preliminary Identifications the cucumber material of disease resistance using the method for 1 Part I step B of embodiment
Carry out field fusarium wilt disease resistance detection.
Found by state of an illness statistical analysis, above-mentioned 19 plants of Preliminary Identifications have the state of an illness of the cucumber material of disease resistance 2
Level is following, wherein 9 plants 0 grade, 7 plants 1 grade, 3 plants 2 grades, thus illustrating, presence and the cucumber anti-blight proterties of Foc-4 genes have
There is uniformity.
4th, according to (the A genomic variation map provides insights into the such as Qi
genetic basis of cucumber domestication and diversity, Nature Genetics, 2013) report
The Cucumber germplasm variation discovery in road, has 57 SNP sites in Foc-4 genes in 115 parts of cucumber materials, more than 100
Indel variations are then more extensive.The sequence of which part India cucumber, finds Foc-4 genes in India's cucumber material by analysis
There is very Big mutation rate in material, such as India cucumber Hw1 there occurs 32 SNP, 3 INDEL, and its sequence is referring to SEQ ID NO:11,
With SEQ ID NO:1 to compare homology be only 91.4%, and identifies that through field resistance (anti-disease enzyme method is referring to embodiment
1 Part I step B) find that India's material still has disease resistance, it was demonstrated that with the print that Foc-4 genetic homologies are 91.4%
Degree cucumber material Foc-4 genes possess droop disease resistance.
Functional verification to the disease-resistant gene Foc-4 in Indian yellow melon Hw1 below
1) detected materials：India cucumber Hw1 is ground into No. two as parent with Tianjin, F is built2Genetic group, it is therefrom random to select
Taking 80 individual plants carries out following experiment.Wherein, maternal India cucumber Hw1 grinds No. two purchased from Crops in Beijing germplasm with male parent Tianjin
Storehouse.
2) by the seed gauze wrapped of above-mentioned detected materials, water seed soaking is sowed at 50 hole disks after 28 DEG C of constant temperature vernalization
In, to nurse young plants in hothouses in air-conditioning, seedling medium is the perlite or Nutrition Soil of sterilizing, is then extracted from seedling respectively using CTAB methods
The genomic DNA of detected materials, and with each genomic DNA as template, using upstream and downstream primer SEQ ID NO:7 and SEQ ID
NO:8 carry out Foc-4 full length genes PCR amplifications, then PCR primer is sequenced and sequence assembly is carried out, finally confirms above-mentioned to be measured
There is disease-resistant gene Foc-4 in there are 34 plants of seedling in material.The PCR is expanded referring to embodiment 1 (two).
3rd, fusarium wilt disease resistance detection is carried out to the seedling with disease-resistant gene Foc-4
There is to above-mentioned 34 plants of Preliminary Identifications the cucumber material of disease resistance using the method for 1 Part I step B of embodiment
Carry out field fusarium wilt disease resistance detection.
Found by state of an illness statistical analysis, above-mentioned 34 plants of Preliminary Identifications have the state of an illness of the cucumber material of disease resistance 2
Level is following, wherein 15 plants 0 grade, 15 plants 1 grade, 4 plants 2 grades, thus illustrate, presence and the cucumber anti-blight proterties of Foc-4 genes
With uniformity.
Embodiment 5：Cucumber fusarium axysporum is disease-resistant to be analyzed with scab resistant Ccu genes close linkage
To 90 RIL-F8 strains in embodiment 1 and 130 plants of F2:3 colonies carry out droop and the scab state of an illness refers to
(wherein, the disease index of droop is counted referring to 1 Part I step B of embodiment, scab disease index several accurate counts
Statistical method is as described below), the cucumber dense genetic map primer information delivered using Cavagnaro etc., to parent and RILs
Colony carries out molecular marker analysis, and encodes collection parent and each individual plant genotype data of RILs colonies.Comparative study cucumber is planted
The scab and droop disease index of strain, it is found that the phenotype of scab and droop is only in numbering 117 in 220 parts of materials
Different with performance in 125 plant materials, the state of an illness of 117 scab of numbering and droop is 0 and 4,125 scab of numbering and is withered
The state of an illness of disease is 5 and 1, and remaining is consistent.This research shows that droop and the disease-resistant gene of scab have close linkage pass
System, but be not same gene.
Wherein, scab carries out artificial inoculation on seedling using Excised cotyledons drop method.Son is cut when cucumber cotyledons are flattened
Leaf, is 1 × 10 with liquid-transfering gun drop concentration6～5 × 106The inoculation liquid 1 of spore/ml drips (about 0.02ml) in cotyledon central authorities, is placed in
Moisturizing in culture dish, cultivates in 20 DEG C of incubators.After inoculation, 7～10d carries out evaluation of resistance.
Scab Disease investigation and grade scale：
0 grade：It is asymptomatic；1 grade：Vaccination produces very little necrotic spot；2 grades：Vaccination is formed and does not extend necrotic plaque；3 grades：
Vaccination forms extension necrotic plaque, and extension spot is surrounded by yellow halo；4 grades：Vaccination to be formed and have a large amount of on extension spot, and scab
Mould layer is produced；5 grades：Cotyledon festers.
Wherein less than 2 is disease-resistant, and more than 3 is susceptible type.
So, genetic linkage analysis is carried out to scab disease-resistant gene using 4.0 softwares of JoinMap equally, finally Huang
Melon scab resistant gene Primary Location with (160kb of UW017820 and UW084909) in the same interval range of droop,
Referring to Fig. 2.
In a word, the reliability according to the disease-resistant functional gene Foc-4 the results of droop, and at the beginning of droop and scab
Same interval is positioned at, and the genetic distance scope is only 0.5cm, it is interval to only have 5 genes.So, Foc-4 genes and its
SNP marker can represent the interval genotype.Meanwhile, the phenotype of scab and Foc-4 genes in 220 plants of cucumber materials
SNP genotype have 218 plants it is identical, concordance rate is up to 99%.Therefore Foc-4 genes and its SNP marker and scab resistant Ccu bases
Because of close linkage, Foc-4 genes and its SNP marker can be applied to carry out cucumber and to resist/sense scab screening.
Claims (8)
1. cucumber fusarium axysporum disease-resistant gene Foc-4, is (a) SEQ ID NO in sequence table:Nucleotide sequence shown in 1.
2. a kind of genetic marker related to cucumber fusarium axysporum, the genetic marker are SEQ ID NO in sequence table:Shown in 1
Nucleotide sequence, wherein, base A of the 3530th is formed by G mutation.
3. the cDNA sequence of the cucumber fusarium axysporum disease-resistant gene Foc-4 described in claim 1 (a), is SEQ ID in sequence table
NO:Nucleotide sequence shown in 3.
4. the encoding proteins of the cucumber fusarium axysporum disease-resistant gene Foc-4 described in claim 1 (a), are the SEQ ID in sequence table
NO:Amino acid sequence shown in 5.
5. the cucumber fusarium axysporum described in the cucumber fusarium axysporum disease-resistant gene Foc-4 or claim 3 described in claim 1 is disease-resistant
Applications of the cDNA of gene Foc-4 in seed selection cucumber fusarium axysporum disease-resistant variety.
6. application of the genetic marker described in claim 2 in seed selection cucumber fusarium axysporum disease-resistant variety.
7. applications of the cucumber fusarium axysporum disease-resistant gene Foc-4 described in claim 1 in seed selection scab of cucumber disease-resistant variety.
8. application of the genetic marker described in claim 2 in seed selection scab of cucumber disease-resistant variety.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410114320.XA CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
| PCT/CN2014/089052 WO2015143867A1 (en) | 2014-03-25 | 2014-10-21 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410114320.XA CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103882032A CN103882032A (en) | 2014-06-25 |
| CN103882032B true CN103882032B (en) | 2017-03-29 |
Family
ID=50951155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410114320.XA Active CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882032B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015143867A1 (en) * | 2014-03-25 | 2015-10-01 | 北京市农林科学院 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
| CN107299105B (en) * | 2017-08-11 | 2020-09-25 | 河南省农业科学院园艺研究所 | Pathogenic FonACL 3 gene of watermelon wilt pathogen, deletion DNA fragment and deletion mutant thereof and application thereof |
| CN109706154B (en) * | 2017-10-26 | 2021-04-27 | 中国农业大学 | CsPR3 gene and application thereof in cucumber fusarium wilt resistance |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010098670A1 (en) * | 2009-02-27 | 2010-09-02 | Monsanto Invest N.V. | Fusarium resistant cucumber plants |
-
2014
- 2014-03-25 CN CN201410114320.XA patent/CN103882032B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103882032A (en) | 2014-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103866005B (en) | The primer of Muskmelon Fusarium wilt resistance and complete female system molecular marker assisted selection and method | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN103305510A (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN104560983B (en) | Two SNP marker and its application with anti-cucumber powdery mildew close linkage | |
| CN103320437A (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| WO2015143867A1 (en) | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof | |
| Ekins et al. | Population structure of Sclerotinia sclerotiorum on sunflower in Australia | |
| CN104630215A (en) | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers | |
| CN102395678A (en) | Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof | |
| WO2015192566A1 (en) | Cucumber target leaf spot resistance gene cca as well as linked molecular markers and applications thereof | |
| CN103882032B (en) | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application | |
| CN110607388A (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN103789419A (en) | Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN104946630B (en) | Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof | |
| CN103882017B (en) | The molecule marker of cucumber fusarium axysporum disease-resistant gene Foc-4 and primer special thereof and application | |
| CN110527741A (en) | A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage | |
| CN104031995B (en) | A kind of method of molecular marker auxiliary breeding for disease resistance | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN111944920A (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN105861496B (en) | A kind of molecular labeling and its application with balsam pear mildew-resistance gene close linkage | |
| CN110358862A (en) | With the molecular labeling Hxjy-14 of rice wide spectrum high resistance to hoja blanca gene Xa45 (t) close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |