CN103882032A - Cucumber blight disease resistance gene Foc-4 as well as encoding protein and application thereof - Google Patents
Cucumber blight disease resistance gene Foc-4 as well as encoding protein and application thereof Download PDFInfo
- Publication number
- CN103882032A CN103882032A CN201410114320.XA CN201410114320A CN103882032A CN 103882032 A CN103882032 A CN 103882032A CN 201410114320 A CN201410114320 A CN 201410114320A CN 103882032 A CN103882032 A CN 103882032A
- Authority
- CN
- China
- Prior art keywords
- foc
- gene
- disease
- cucumber
- resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cucumber blight disease resistance gene Foc-4 as well as an encoding protein and application thereof. The gene is a nucleotide sequence shown in SEQ ID NO:1 in a sequence table. The resistance gene Foc-4 provided by the invention has important application value, and can generate a specific molecular marker or a tightly linked marker according to the gene sequence information; genotype of cucumber and descendant plants thereof can be identified by using these markers; the cucumber blight disease resistance gene Foc-4 is applied to the molecular marker to assist selective breeding, so as to improve the breeding efficiency. In addition, the cucumber blight disease resistance gene Foc-4 disclosed by the invention also can be used for selectively breeding scab disease-resistant variety of the cucumber.
Description
Technical field
The invention belongs to gene order and Application Areas, be specifically related to cucumber fusarium axysporum disease-resistant gene Foc-4 and proteins encoded thereof and application.
Background technology
Cucumber (Cucumis Sativus.L) is extensively cultivation in the world, and China is cucumber cultivation area maximum, country that ultimate production is the highest in the world.
Cucumber fusarium axysporum (Fusarium Wilt), have another name called wilt disease, dead arm, dead seedling disease, a kind of by soil infection, invade from root or collar portion, in the entozoic systemic disease of vascular bundle (conduit type blight), one of three large diseases of more difficult control on cucumber production, often cause greater loss, it is cucumber all over the world at present, the particularly main soil-borne disease of greenhouse and other protection Viola grypoceras A. Grays, this germ is at soil, in the residual body of diseased plant and the farm manure that do not become thoroughly decomposed or be attached on seed and survive the winter, become primary source of infection in next year, can be by rainwater, irrigation waters etc. carry out long-distance communications, the general time can make cucumber yield loss 25%-35%, when serious morbidity, can make cucumber total crop failure.Blight adopts chemical prevention effect undesirable, and not only making to produce to drop into increases and can cause environmental safety hidden danger, though rotation of crops grafting is usually used in prevention and control add-on technology difficulty and labour cost.Therefore breeding resistant variety is the optimal path that solves blight harm.
The pathogenic bacteria of cucumber fusarium axysporum is Fusarium oxysporum cucumber specialized form (Fusarium oxysporum.sp.cucumebrium Owen.), belongs to imperfect fungi fungi.Germ produces two types of conidiums of size, macroconidium fusiform or sickleshaped, and water white transparency, apical cell taper shape, what have is micro-ly hook-shaped, and base portion inverted cone is cut shape or podocyte, 1～3, tool barrier film.Microconidium is born in aerial hyphae more, ellipse or sausage shape, and water white transparency, without barrier film.Chlamydospore smooth surface, tawny.Because of pathogenic difference between the bacterial strain of various places, can distinguish different physiological strains, there is physiological strain abroad No. 1, No. 2 and No. 3, China's cucumber fusarium axysporum pathogenic and different, called after physiological strain No. 4 abroad.
Clone gene is to find one of most important application of molecule marker chain with objective trait.Map based cloning (Map-based cloning) utilizes molecular genetic linkage map, and objective trait and molecule marker are mapped and connected by genetic linkage, target gene is positioned at chain very closely between flanking marker with it; Also can obtain the molecule marker chain with target gene with colony's segregation analysis (BSA method) or near isogenic line method, then utilize mapping population that this molecule marker is navigated on collection of illustrative plates.Thereby go to screen large fragment DNA library by these marks, identify the clone relevant with mark, obtain succeeded by subclone and chromosome walking (Chromosome walking) form the cloned sequence that contains goal gene, finally be aided with again conversion and complementation test and verified (Wang Yongfei, 2001).At present, use and be separated to a large amount of plant genes based on map-based cloning, especially with disease-resistant relevant gene (Zeng ZB, 1994; Easily wheat, 1998), but have no disease-resistant gene about cucumber fusarium axysporum physiological strain 4 by the report of successful separating clone.
Summary of the invention
For the defect of prior art, one of object of the present invention is to provide a kind of cucumber fusarium axysporum disease-resistant gene Foc-4.
Two of object of the present invention is to provide the genetic marker of a kind of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
Three of object of the present invention be to be provided for the to increase pair of primers of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
Four of object of the present invention is to provide the cDNA sequence of a kind of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
Five of object of the present invention is to provide the proteins encoded of a kind of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4.
Six of object of the present invention is to provide the application of a kind of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 and genetic marker.
To achieve these goals, the present invention has adopted following technical scheme:
Cucumber fusarium axysporum disease-resistant gene Foc-4, (a) be the nucleotide sequence shown in SEQ ID NO:1 in sequence table, (b) for sequence table in the above homology of sequence 90% shown in SEQ ID NO:1 and have with sequence table in the nucleotide sequence of sequence identical function shown in SEQ ID NO:1.
The cucumber fusarium axysporum disease-resistant gene Foc-4 the present invention relates to utilizes anti-sense genetic group to carry out Fine Mapping clone and obtains.The present invention selects classical disease-resistant material WF2757 and the susceptible material of important backbone parent Tianjin to grind No. two, builds RILs-F
8, F
2:3and F
2genetic group, enantiopathy gene carries out Primary Location and Fine Mapping, anti-blight gene Fine Mapping is in No. 2 chromosomal 25kb interval ranges, only there are 2 genes in this interval, through the online compare of analysis of NCBI Blast (http://blast.ncbi.nlm.nih.gov/), the 1st gene is TIR NB-ARC disease-resistant gene, the 2nd the transcription factor genes involved that gene is bHLH96-like.As everyone knows, it is typical NBS-LRR class disease-resistant gene that TIR NB-ARC gene has conserved domain, therefore infer that this TIR NB-ARC gene is the important candidate gene Foc-4 of anti-blight, its DNA sequence dna is to obtain by the gene order in Fine Mapping interval is checked order.
The genetic marker of cucumber fusarium axysporum disease-resistant gene Foc-4 shown in above-mentioned SEQ ID NO:1, the bases G of the 3530th of susceptible gene sports base A.
For increasing the pair of primers of cucumber fusarium axysporum disease-resistant gene Foc-4 shown in above-mentioned SEQ ID NO:1, there is respectively the nucleotide sequence shown in SEQ ID NO:7 and SEQ ID NO:8 in sequence table.
The present invention is according to the Cucumber germplasm 9930 of having announced and GY14 sequence information, in conjunction with utilizing Softberry on-line prediction software FGENESH (http://sunl.softberry.com/) predicted gene structure, and stop encoding sequence according to the initial sum predicting the outcome, a pair of being respectively of design full length gene amplimer: the nucleotide sequence shown in SEQ ID NO:7 and SEQ ID NO:8 in sequence table, utilize respectively anti-/ sense material genomic dna to carry out pcr amplification, obtain the disease-resistant material of DNA full length sequence SEQ ID NO:1(of gene Foc-4 in anti-/ sense material) and the susceptible material of SEQ ID NO:2(), total length 4677bp, and two gene DNA sequences that antagonism is felt in material carry out contrast and analysis, in anti-/ sense material, there is a SNP site in Foc-4DNA sequence, the 3530th of this gene, the base of susceptible material is G, the base of disease-resistant material is A, it can be applied to exploitation anti-blight molecule marker.
The cDNA sequence of cucumber fusarium axysporum disease-resistant gene Foc-4 shown in above-mentioned SEQ ID NO:1 is the nucleotide sequence shown in SEQ ID NO:3 in sequence table.
The cucumber fusarium axysporum disease-resistant gene Foc-4cDNA(mRNA the present invention relates to) sequence be utilize total length primer SEQ ID NO:7 and SEQ ID NO:8 as upstream and downstream primer using resist/feel the first chain after total RNA reverse transcription of material as template carry out pcr amplification acquisition anti-/ cDNA of cucumber fusarium axysporum disease-resistant gene Foc-4 in sense material, the cDNA(mRNA of gene Foc-4 in anti-/ sense material) sequence total length is respectively SEQ ID NO:3 and SEQ ID NO:4, utilize Softberry on-line prediction Foc-4 sequence, obtain cDNA structure, and draw the structural representation (referring to Fig. 1) of Foc-4 gene.By the contrast of SEQ ID NO:3 and SEQ ID NO:4 sequence, the cDNA(mRNA of cucumber anti-blight gene Foc-4) in anti-/ sense material, there is variable shearing difference, 5th exon of the cDNA that causes Foc-4 in susceptible material is than large 270bp in disease-resistant material, infer and change because the existence of this variable shearing causes gene important structure territory, thereby cause the disease resistance of TIR NB-ARC gene to change.
The proteins encoded of cucumber fusarium axysporum disease-resistant gene Foc-4 shown in above-mentioned SEQ ID NO:1 is the aminoacid sequence shown in the SEQ ID NO:5 in sequence table.
The cucumber fusarium axysporum disease-resistant gene aminoacid sequence the present invention relates to is to utilize the cDNA(mRNA of Foc-4 gene in anti-/ sense material) sequence SEQ ID NO:3 and SEQ ID NO:4, obtain respectively FOC-4 amino acid (albumen) sequence SEQ ID NO:5 and SEQ ID NO:6 in anti-/ sense material through softberry on-line prediction software translation, and the FOC-4 aminoacid sequence that resists/feel in material compares, in anti-/ susceptible material, there is the difference of 90aa in FOC-4, infer that this difference causes disease-resistant structural domain to change, thereby cause the disease resistance of TIR NB-ARC gene to change.
The application of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 in seed selection cucumber fusarium axysporum disease-resistant variety.
The application of above-mentioned genetic marker in seed selection cucumber fusarium axysporum disease-resistant variety.
The application of above-mentioned cucumber fusarium axysporum disease-resistant gene Foc-4 in seed selection scab of cucumber disease-resistant variety.
The application of above-mentioned genetic marker in seed selection scab of cucumber disease-resistant variety.
The present invention has following beneficial effect:
The present invention utilizes map based cloning and forward genetics method, disease-resistant gene Foc-4 to cucumber fusarium axysporum physiological strain 4 carries out Fine Mapping and clone, obtain cucumber fusarium axysporum disease-resistant gene Foc-4, and study nucleotide sequence and the aminoacid sequence of this gene in anti-/ susceptible material and analyze and compare, obtain cucumber anti-blight gene Foc-4 difference and polymorphism analysis in anti-/ susceptible material, and verified the function of this blight disease-resistant gene Foc-4.Disease-resistant gene Foc-4 provided by the invention has important using value, can produce specific molecule marker or its close linkage mark according to described gene order information, include but not limited to SNP(mononucleotide polymorphic), InDel(insertion and deletion is polymorphic), RFLP(restriction enzyme length is polymorphic), CAP(cutting amplified fragments is polymorphic), can identify the genotype of cucumber and offspring plant with these marks, for molecular marker assisted selection breeding, thereby improve breeding efficiency; In addition, cucumber fusarium axysporum disease-resistant gene Foc-4 of the present invention can also be used for seed selection scab of cucumber disease-resistant variety.
Accompanying drawing explanation
Fig. 1 is the interval gene Foc-4 of cucumber fusarium axysporum gene Fine Mapping structural representation.That Fig. 1 (A) and Fig. 1 (B) are respectively is anti-/ sense material in the structural representation of gene Foc-4, the size of 5th exon of disease-resistant Foc-4 gene in anti-/ sense material there are differences.(Foc-4 gene is oppositely to insert in chromogene group, actual the 5th exon for Foc-4 gene of the 3rd exon therefore showing in figure).
Fig. 2 is cucumber fusarium axysporum disease-resistant gene Foc-4 location linkage map, and wherein left figure is that cucumber fusarium axysporum gene is just located schematic diagram, and middle figure is blight disease-resistant gene Fine Mapping schematic diagram, and right figure is gene distribution situation and gene annotation in 25kb interval range.
Fig. 3 is that Foc-4 gene SNP molecule marker enzyme is cut the result schematic diagram.
Embodiment
Below by specific embodiment, the present invention is described in detail, but the present invention is not limited to this.
Embodiment 1: the acquisition of cucumber fusarium axysporum disease-resistant gene Foc-4
One, disease-resistant gene Foc-4 Primary Location and the Fine Mapping of cucumber fusarium axysporum physiological strain 4
Concrete localization method comprises the following steps:
A, cucumber fusarium axysporum localization of disease resistance genes research parent and genetic group:
Select respectively WF2757(male parent) and Tianjin grind No. two (female parent) for anti-sense parent, build 90 RIL-F
8strain, the F of 130 strains
2:3colony and the F that exceedes 2000 strains
2large group.Wherein, male parent WF2757 and maternal Tianjin are ground No. two purchased from Crops in Beijing germplasm resource bank.
B, the investigation of cucumber fusarium axysporum localization of disease resistance genes research disease index:
The seed of parent and each colony is wrapped up with gauze, hot water treatment of seeds, after 28 ℃ of constant temperature vernalization, be sowed in 50 hole dishes, nurse young plants in hothouses at air-conditioning, the perlite that seedling medium is sterilizing or Nutrition Soil.
For No. 4 Chinese cucumber fusarium axysporum Race Identification and control document (Chinese cucumber fusarium axysporum Race Identification and the control by Huang Zhongsheng etc. for examination bacterial classification cucumber fusarium axysporum (Fusarium oxysporum f.sp.cucumerinum Owen.) physiological strain, North China agronomy report, 1994,9(4): the method for recording 81-86) separates and obtains.Adopt the method for (cucumber fusarium axysporum method of resistance identification research-radicle inoculation method, China's Vegetable, 02 phases in 1985) such as father-in-law Zu Xin to prepare cucumber fusarium axysporum liquid, blood counting chamber is measured spore concentration.Root inoculation method is soaked in employing: in the time that cucumber seedlings flattens, extract seedling, wash root, 1 × 10
6～5 × 10
6in the inoculation liquid of individual spore/mL, soak root, then plant in the plastic nutritional alms bowl (specification 6.5cm × 6.5cm) that bactericidal nurishing soil is housed, in greenhouse, cultivate.Maintain 24～28 ℃ daytime, night is at 16～20 ℃.Repeat, repeat 30 strains at every turn for 3 times.
After inoculation, 7～10d carries out state of an illness investigation as stated above.Severity Scaling standard is: 0 grade: asymptomatic; 1 grade: 1 cotyledon yellow; 2 grades: 2 cotyledon yellows or wilting; 3 grades: 1 true leaf is slightly wilted; 4 grades: 1～2 true leaf is obviously wilted; 5 grades: complete stool is seriously wilted or be withered.Below 2, being wherein disease-resistant, more than 3 is susceptible type.
The state of an illness to parent and each colony is accurately added up.
The Primary Location of C, cucumber fusarium axysporum disease-resistant gene Foc-4:
The cucumber dense genetic map primer information of utilizing (Genome-wide characterization of simple sequence repeats in cucumber, BMC Genomics, 2010) such as Cavagnaro to deliver, in conjunction with 90 RIL-F
8the F of strain and 130 strains
2:3the accurate statistics of colony's disease index, carries out molecular marker analysis to parent and RIL colony, and coding gathers parent and the each individual plant genotype data of RILs colony.Female genotype is designated as A, and the genotype of male parent is designated as B, F
1heterozygous genes type is designated as H, and fuzzy or missing data is designated as U.Use χ
2test carries out ratio comptibility test analysis to data, adopts JoinMap4.0 software (Stam1993, Van Ooijen2001) structure linkage map (referring to Fig. 2), software LOD threshold values be set be 4.0 and choose Kosambi formula (Kosambi1944), in 160kb interval by cucumber anti-blight gene Primary Location between No. 2 chromosomal molecule marker UW017820 and UW084909 (referring to Fig. 2), according to (RNA-Seq improves annotation of protein-coding genes in the cucumber genome such as Li, BMC genomics, 2011) annotation to Cucumber germplasm predicting by the online software of Softberry, there is a NBS-LRR series connection disease-resistant gene (NBS-LRR is disease-resistant gene conserved domain) being formed by multiple NBS-LRR disease-resistant genes in this interval, be difficult to prediction and select candidate gene, carry out Fine Mapping research so need further to expand colony.
The Fine Mapping of D, cucumber fusarium axysporum disease-resistant gene Foc-4:
Through building the F that exceedes 2000 strains
2large group continues anti-blight gene to carry out Fine Mapping, simultaneously, the genome order of resurveying has been carried out to anti-sense parent used in this laboratory, through bioinformation compare of analysis, 79560 Indel and 108727 SNP molecule markers between parents, are developed, within the scope of the 160kb between first positioning area, select to have designed 14 pairs of Indel molecule markers (referring to table 1) and carry out population analysis, after checking, utilize these 14 pairs of Indel marks to carry out Fine Mapping research to anti-blight gene, wherein the synthetic of primer completed by life work biotechnology (Shanghai) limited-liability company, utilize equally JoinMap4.0 software to carry out genetic linkage mapping analysis, the final F in 2000 strains
2in the scope of the 25kb of molecule marker UW017805 and Indel2027634, in Fine Mapping interval, in the test materials of nearly 2300 strains, there is 1 exchange individual plant by anti-blight gene Fine Mapping in large group.
Each PCR reaction system (10 μ L) while adopting above-mentioned 14 pairs of Indel molecule markers to carry out Fine Mapping is as follows: 25ng template DNA, 0.5 μ M upstream primer, 0.5 μ M downstream primer, the dNTP mix of 0.2mM; 0.5U Taq archaeal dna polymerase, 1 × PCR Buffer(Fermentas) 2 μ L, ddH2O supplies 10 μ L.
PCR response procedures is: stage 1:95 ℃ of denaturation 3min; Stage 2:94 ℃ 30s, 60 ℃ of 1min, 72 ℃ of 1min, 1 ℃ of the each cycle down of annealing temperature, totally 8 circulations; Stage 3:94 ℃ 30s, 53 ℃ of 30s, 72 ℃ of 1min, totally 32 circulations; Stage 4:72 ℃ is extended 5min; Stage 5:4 ℃ preservation; Wherein, PCR instrument is the Veriti96well Thermal Cycler purchased from Applied Biosystems company.
Table 1 is for 14 pairs of Indel molecule marker primer information of Fine Mapping
E, anti-blight predictive genes are analyzed:
In the 25kb interval of Fine Mapping, there are 2 genes, through the online compare of analysis of NCBI Blast, the 1st gene is TIR NB-ARC disease-resistant gene, the 2nd the transcription factor genes involved that gene is bHLH96-like.TIRNB-ARC is common conserved domain in NBS-LRR class disease-resistant gene, therefore locates the important candidate gene Foc-4 that this TIR NB-ARC gene is anti-blight.The result of Fine Mapping has been got rid of the interference of middle NBS-LRR series connection disease-resistant gene between first positioning area.There is a SNP at anti-/ sense storeroom in Foc-4 gene, at the 3530th of gene, disease-resistant gene base is A, and susceptible gene base is G.Infer that this SNP may cause the change of disease resistance, can be used for developing anti-blight compact linkage molecule mark, the disease-resistant candidate gene that this TIR NB-ARC gene is blight.
Two, the acquisition of cucumber fusarium axysporum disease-resistant gene Foc-4 full length DNA sequence
A, confession examination material:
Described is disease-resistant material WF2757 for examination material, grinds No. two in contrast with susceptible material Tianjin.
The amplification of the DNA total length of B, cucumber fusarium axysporum disease-resistant gene Foc-4:
The extraction of Cucumber germplasm DNA adopts CTAB method, be template for resist/sense of examination material genomic dna, utilize Foc-4 full length gene amplification upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 to carry out full length gene pcr amplification, obtain respectively full length gene SEQ ID NO:1 and the SEQ ID NO:2 of Foc-4 gene on anti-/ sense material through sequence assembly, total length is all counted 4677bp.Utilize the Foc-4 full length gene of DNAMAN software counterwork/sense material to compare, find that in disease-resistant material, base is A at a SNP of the 3530th existence of anti-/ sense storeroom Foc-4 gene, and in susceptible material, base is G.This SNP can, as the closely linked molecule marker of anti-blight, be applied to worldwide cucumber fusarium axysporum breeding for disease resistance.
In the reaction system (20 μ L) of described pcr amplification reaction, contain: 25ng template DNA, 0.5 μ M upstream primer, 0.5 μ M downstream primer, the dNTP mix of 0.2mM; 0.5U Taq archaeal dna polymerase, 1 × PCR Buffer(Fermentas) 2 μ L, ddH
2o supplies 20 μ L.
Described PCR response procedures is: 95 ℃ of denaturation 3min; 94 ℃ of 30s, 60 ℃ of 1min, 72 ℃ of 4min, totally 42 circulations; 72 ℃ are extended 10min; PCR instrument is the Veriti96well Thermal Cycler purchased from Applied Biosystems company.
Described amplified production is diluted to 80 μ L with the deionized water of sterilizing, puts into Caliper nucleic acid automatic analyser and analyzes.
Upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8, the order-checking of PCR product and the sequence assembly of DNA full length sequence all synthesize and analyze in Shanghai Sheng Gong company.Sequencing result shows that the full length DNA sequence of cucumber fusarium axysporum disease-resistant gene Foc-4 is as shown in SEQ ID NO:1 in sequence table, altogether 4677bp.
Embodiment 2: cucumber fusarium axysporum disease-resistant gene Foc-4cDNA and protein sequence identification and analysis
One, the cDNA(mRNA of cucumber fusarium axysporum disease-resistant gene Foc-4) total length amplification:
Utilize anti-sense parent material WF2757 and Tianjin to grind No. two, choose respectively the total RNA of young leaflet tablet tissue extraction, carry out the first chain (cDNA) of the synthetic mRNA of reverse transcription, utilize total length amplification upstream and downstream primer SEQ ID NO:7 and the SEQ ID NO:8 of Foc-4 gene to carry out pcr amplification take this mRNA first chain as template, obtain respectively the cDNA(mRNA in anti-/ sense material) sequence total length SEQ ID NO:3 and SEQ ID NO:4.Utilize the Foc-4 full length gene of DNAMAN software counterwork/sense material to compare, find variable shearing to occur, show as the difference in size that has 270bp on the 5th exon, referring to Fig. 1 at anti-/ sense storeroom Foc-4 gene cDNA sequence.Compared with susceptible material, the cDNA sequence of disease-resistant material shows as disappearance between 1915-2184bp.Infer and change because the existence of this variable shearing causes gene important structure territory, thereby cause the disease resistance of TIR NB-ARC gene to change.
Described RNA extracts, reverse transcription test kit is all purchased from Fermentas company.
In the reaction system (50 μ L) of described pcr amplification reaction, contain: 25ng template DNA, 0.5 μ M upstream primer, 0.5 μ M downstream primer, the dNTP mix of 0.2mM; 0.5U Taq archaeal dna polymerase, 1 × PCR Buffer(Fermentas) 5 μ l, ddH
2o supplies 50 μ l.
Described PCR response procedures is: 95 ℃ of denaturation 3min; 94 ℃ of 30s, 60 ℃ of 1min, 72 ℃ of 2min, totally 40 circulations; 72 ℃ are extended 7min; PCR instrument is the Veriti96well Thermal Cycler purchased from Applied Biosystems company.
The order-checking of PCR product and the sequence assembly of described Foc-4 gene cDNA sequence are all analyzed in Shanghai Sheng Gong company, wherein the cDNA sequence of the Foc-4 gene in disease-resistant material is as shown in SEQ ID NO:3, and the cDNA sequence of the Foc-4 gene in susceptible material is as SEQ ID NO:4.
Two, the sequential analysis of the proteins encoded of cucumber fusarium axysporum disease-resistant gene Foc-4:
The cucumber fusarium axysporum disease-resistant gene aminoacid sequence the present invention relates to is to utilize the cDNA(mRNA of Foc-4 gene in anti-/ sense material) sequence SEQ ID NO:3 and SEQ ID NO:4, obtain through softberry on-line prediction software translation respectively, in anti-/ sense material, FOC-4 amino acid (albumen) sequence is respectively as shown in SEQ ID NO:5 and SEQ ID NO:6, and utilize DNAMAN software aminoacid sequence to compare in anti-/ sense material, find that FOC-4 albumen exists the difference of 90aa in anti-/ susceptible material, the relatively susceptible material of FOC-4 aminoacid sequence of disease-resistant material, between 638-727aa, show as disappearance.Therefore infer that this difference causes disease-resistant structural domain to change, thereby cause the disease resistance of TIRNB-ARC gene to change.
Embodiment 3: the functional verification of disease-resistant gene Foc-4 and applying in seed selection cucumber fusarium axysporum disease-resistant variety
One, the functional verification of cucumber fusarium axysporum disease-resistant gene Foc-4
1, detected materials: take WF2757 and GY14 as parent, build F
2genetic group, therefrom chooses at random 100 individual plants and carries out the disease-resistant evaluation of blight and order-checking.Wherein, male parent WF2757 and maternal GY14 are purchased from Crops in Beijing Germplasm Bank.
2, the seed of above-mentioned detected materials is wrapped up with gauze, water seed soaking, after 28 ℃ of constant temperature vernalization, be sowed in 50 hole dishes, nurse young plants in hothouses at air-conditioning, seedling medium is perlite or the Nutrition Soil of sterilizing, then adopt CTAB method from seedling, to extract the genomic dna of each detected materials, and take each genomic dna as template, utilize upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 to carry out Foc-4 full length gene pcr amplification, then PCR product checked order and carry out sequence assembly, in the above-mentioned 100 parts of detected materials of final confirmation, there are 27 strain seedling to there is the Foc-4 gene shown in SEQ ID NO:1.Described pcr amplification is referring to embodiment 1 second section.
3, the seedling with the Foc-4 gene shown in SEQ ID NO:1 is carried out to fusarium wilt disease resistance detection
The cucumber material that adopts the method for the embodiment 1 step B of first part to have the Foc-4 gene shown in SEQ ID NO:1 to above-mentioned 30 strains carries out field fusarium wilt disease resistance detection.
Find by state of an illness statistical study, in the above-mentioned cucumber seedling with the Foc-4 gene shown in SEQ ID NO:1, the state of an illness is all below 2 grades, wherein 0 grade of 9 strain, 2 grades of 10 1 grade of strain, 8 strains, explanation thus, the existence of fox-4 gene and cucumber anti-blight proterties have consistence.
Two, genetic marker is applied in seed selection cucumber fusarium axysporum disease-resistant variety
The present invention utilizes Foc-4 gene that embodiment 1 the obtains SNP site in anti-sense material, design online website http://helix.wustl.edu/dcaps/dcaps.html according to dCAPs primer, development and Design and anti-/ closely linked dCAPs molecule marker of sense blight, wherein forward and oppositely amplimer be respectively: SEQ ID NO:9(GATATGTTACAGTACTGTACCCAGTCGA) and SEQ ID NO:10(CTAGTAGTGTTAAGGGCTTTGAGCAGTT).Carry out pcr amplification by this primer pair parents material (grind No. two in disease-resistant material WF2757 and susceptible material Tianjin), and in conjunction with SalI restriction endonuclease, PCR product enzyme is cut, obtain respectively anti-/ susceptible specific band, wherein disease-resistant band is 164bp, and susceptible band is 134bp.
The PCR reaction system of this part and program are with reference to the step D of embodiment 1 first part; Enzyme is cut in system (20 μ L) and is contained: 10 × NEB damping fluid, 2 μ l, and pcr amplification product 10 μ l, 100 × BSA0.2 μ L, restriction endonuclease SalI0.5 μ L, sterilizing distilled water is supplied 20 μ L.Endonuclease reaction program is: stage 1:37 ℃ of incubation 10h; Stage 2:65 ℃ of 20min inactivation; Stage 3:4 ℃ preservation.
Utilize this dCAPs molecule marker to 90 of embodiment 1 RIL-F
8strain, 130 strain F
2:3colony's strain and 2000 strain F
2cucumber material in genetic group carries out PCR and SalI restriction analysis, and investigate enzyme and cut the relation of result and disease-resistant phenotype (disease-resistant Phenotypic examination is referring to the step B of first part of embodiment 1), find dCAPs molecule marker and the disease-resistant phenotype close linkage of 2220 strain cucumber material in Foc-4 gene, consistence reaches 100%, reach be divided into from level, its cleavage map is referring to Fig. 3.
Foregoing has fully confirmed that Foc-4 gene and the dCAPs molecule marker according to its SNP exploitation can be applied to resist/susceptible screening of blight and marker assisted selection research.
Embodiment 4: the applied analysis of resist/sense of different genetic background cucumber materials blight Foc-4 gene
One, for the molecule marker of fully checking Foc-4 gene and its SNP contribution rate in different genetic background, the present invention has selected 10 materials, through No. 4 disease-resistant evaluations of field blight physiological strain (disease-resistant authentication method is referring to the step B of first part of embodiment 1), find 5 anti-blights, (susceptible material has 5 sense blights: grind No. two in Susceptible parent Tianjin, COOLGREEN MR97232, GY13, Chang Chun Mi Ci and cucumber order-checking material 9930; Disease-resistant material has: disease-resistant parent WF2757, M21, COUNTY FAIR F1, BANNA HUANGGUA, CUCUMIS HARDWICKII), these 10 materials are all purchased from Crops in Beijing Germplasm Bank.
This research is carried out the genome order of resurveying to 10 parts of cucumber materials, through bioinformation compare of analysis, totally 10 the material Foc-4 genovariation situations including anti-/ sense parent and Cucumber germplasm order-checking material 9930 are studied, find the Foc-4 genetic material genotype in the anti-sense material of difference because of its genetic background different, Foc-4 gene not only exists SNP to make a variation in a large number in multiple genetic background materials, also there are a large amount of Indel(insertion and deletions simultaneously) variation, referring to table 2.There is consistence in the Indel of Foc-4 gene and genotype and the phenotype of SNP variation in 10 anti-/ susceptible materials.
Wherein disease-resistant material WF2757, in M21 and COUNTY FAIR F1, SNP5 plays a significant role in resistant effect; And Foc-4 gene in BANNA HUANGGUA and CUCUMIS HARDWICKII material because Indel1-Indel3 and SNP1-4, the variations such as SNP6-13, become the homologous gene of Foc-4 gene, homology is all about 99.6%, but still has blight disease resistance.
The described genome order of resurveying is consistent with method therefor in embodiment 1 with bioinformation method.
In table 2 below, the ash end, represents INDEL and SNP variation, and wherein I:GTTTTTGTTTT represents to exist the insertion of 11 bases herein; D:TATATA represents to exist 6 base deletions herein; SNP is directly with variation base mark.
Table 2
Two, the functional verification of disease-resistant gene Foc-4 in BANNA HUANGGUA material
In BANNA HUANGGUA material, the difference part of the Foc-4 gene shown in disease-resistant gene Foc-4 and SEQ ID NO:1 is all listed in table 2, and the nucleotide sequence in other sites is all identical.
1, detected materials: grind No. two as parent take BANNA HUANGGUA and Tianjin, build F2 genetic group, therefrom choose at random 80 individual plants and carry out following experiment.Wherein, male parent BANNA HUANGGUA and maternal Tianjin are ground No. two purchased from Crops in Beijing Germplasm Bank.
2, the seed of above-mentioned detected materials is wrapped up with gauze, water seed soaking, after 28 ℃ of constant temperature vernalization, be sowed in 50 hole dishes, nurse young plants in hothouses at air-conditioning, seedling medium is perlite or the Nutrition Soil of sterilizing, then adopt CTAB method from seedling, to extract the genomic dna of each detected materials, and take each genomic dna as template, utilize upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 to carry out Foc-4 full length gene pcr amplification, then PCR product checked order and carry out sequence assembly, finally confirming has in 23 strain seedling and has disease-resistant gene Foc-4 in above-mentioned detected materials.Described pcr amplification is referring to embodiment 1(bis-).
3, the seedling with disease-resistant gene Foc-4 is carried out to fusarium wilt disease resistance detection
The cucumber material that adopts the method for the embodiment 1 step B of first part to have disease resistance to above-mentioned 23 strain preliminary evaluation carries out field fusarium wilt disease resistance detection.
Find by state of an illness statistical study, the cucumber material state of an illness that above-mentioned 23 strain preliminary evaluation have a disease resistance all below 2 grades, wherein 0 grade of 10 strain, 2 grades of 81 grade of strain, 5 strains, explanation thus, the existence of Foc-4 gene and cucumber anti-blight proterties have consistence.
Three, the functional verification of disease-resistant gene Foc-4 in CUCUMIS HARDWICKII material
Foc-4 shown in disease-resistant gene Foc-4 and SEQ ID NO:1 in CUCUMIS HARDWICKII material
The difference part of gene is all listed in table 2, and the nucleotide sequence in other sites is all identical.
1, detected materials: grind No. two as parent take CUCUMIS HARDWICKII and Tianjin, build F
2genetic group, therefrom chooses at random 80 individual plants and carries out following experiment.Wherein, maternal CUCUMIS HARDWICKII and male parent Tianjin are ground No. two purchased from Crops in Beijing Germplasm Bank.
2, the seed of above-mentioned detected materials is wrapped up with gauze, water seed soaking, after 28 ℃ of constant temperature vernalization, be sowed in 50 hole dishes, nurse young plants in hothouses at air-conditioning, seedling medium is perlite or the Nutrition Soil of sterilizing, then adopt CTAB method from seedling, to extract the genomic dna of each detected materials, and take each genomic dna as template, utilize upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 to carry out Foc-4 full length gene pcr amplification, then PCR product checked order and carry out sequence assembly, finally confirming has in 19 strain seedling and has disease-resistant gene Foc-4 in above-mentioned detected materials.Described pcr amplification is referring to embodiment 1(bis-).
3, the seedling with disease-resistant gene Foc-4 is carried out to fusarium wilt disease resistance detection
The cucumber material that adopts the method for the embodiment 1 step B of first part to have disease resistance to above-mentioned 19 strain preliminary evaluation carries out field fusarium wilt disease resistance detection.
Find by state of an illness statistical study, above-mentioned 19 strain preliminary evaluation have the state of an illness of cucumber material of disease resistance all below 2 grades, wherein 0 grade of 9 strain, and 2 grades of 71 grade of strain, 3 strains, explanation thus, the existence of Foc-4 gene and cucumber anti-blight proterties have consistence.
Four, according to (A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity such as Qi, Nature Genetics, 2013) variation of the Cucumber germplasm of report is found, in 115 parts of cucumber materials, in Foc-4 gene, have 57 SNP sites, more than 100 Indel variation is more extensive.The sequence of part India cucumber wherein by analysis, find that very large variation occurs Foc-4 gene in India's cucumber material, as there are 32 SNP in India cucumber Hw1,3 INDEL, its sequence is referring to SEQ ID NO:11, homology is only 91.4% compared with SEQ ID NO:1, with identify that through field resistance (disease-resistant authentication method is referring to the step B of first part of embodiment 1) finds that this India's material still has disease resistance, proves and Foc-4 DNA homolog is 91.4% India's cucumber material Foc-4 gene possesses blight disease resistance.
Functional verification to the disease-resistant gene Foc-4 in purree melon Hw1 below
1) detected materials: India cucumber Hw1 and Tianjin are ground to No. two as parent, build F
2genetic group, therefrom chooses at random 80 individual plants and carries out following experiment.Wherein, maternal India cucumber Hw1 and male parent Tianjin are ground No. two purchased from Crops in Beijing Germplasm Bank.
2) seed of above-mentioned detected materials is wrapped up with gauze, water seed soaking, after 28 ℃ of constant temperature vernalization, be sowed in 50 hole dishes, nurse young plants in hothouses at air-conditioning, seedling medium is perlite or the Nutrition Soil of sterilizing, then adopt CTAB method from seedling, to extract the genomic dna of each detected materials, and take each genomic dna as template, utilize upstream and downstream primer SEQ ID NO:7 and SEQ ID NO:8 to carry out Foc-4 full length gene pcr amplification, then PCR product checked order and carry out sequence assembly, finally confirming has in 34 strain seedling and has disease-resistant gene Foc-4 in above-mentioned detected materials.Described pcr amplification is referring to embodiment 1(bis-).
3, the seedling with disease-resistant gene Foc-4 is carried out to fusarium wilt disease resistance detection
The cucumber material that adopts the method for the embodiment 1 step B of first part to have disease resistance to above-mentioned 34 strain preliminary evaluation carries out field fusarium wilt disease resistance detection.
Find by state of an illness statistical study, above-mentioned 34 strain preliminary evaluation have the state of an illness of cucumber material of disease resistance all below 2 grades, wherein 0 grade of 15 strain, and 2 grades of 15 1 grade of strain, 4 strains, explanation thus, the existence of Foc-4 gene and cucumber anti-blight proterties have consistence.
Embodiment 5: cucumber fusarium axysporum is disease-resistant to be analyzed with scab resistant Ccu gene close linkage
The accurate statistics that the F2:3 colony of 90 RIL-F8 strains in embodiment 1 and 130 strains is carried out to blight and black spot disease index (wherein, the disease index of blight is added up referring to the embodiment 1 step B of first part, black spot disease index statistical method is as described below), the cucumber dense genetic map primer information of utilizing Cavagnaro etc. to deliver, parent and RILs colony are carried out to molecular marker analysis, and coding gathers parent and the each individual plant genotype data of RILs colony.The black spot of comparative study cucumber plant and blight disease index, find in 220 parts of materials, the phenotype of black spot and blight is only different with performance in 125 plant materials in numbering 117, the state of an illness of numbering 117 black spots and blight is 0 and 4, the state of an illness of numbering 125 black spots and blight is 5 and 1, and all the other are all consistent.This research shows that the disease-resistant gene of blight and black spot exists close linkage relation, but is not same gene.
Wherein, black spot adopts in vitro cotyledon topical application to carry out artificial inoculation on seedling.In the time that cucumber cotyledons flattens, cut cotyledon, with liquid-transfering gun drop concentration be 1 × 10
6～5 × 10
6the inoculation liquid 1 (about 0.02ml) of spore/ml, in cotyledon central authorities, is placed in culture dish moisturizing, in 20 ℃ of incubators, cultivates.After inoculation, 7～10d carries out evaluation of resistance.
The investigation of the black spot state of an illness and grade scale:
0 grade: asymptomatic; 1 grade: vaccination produces very little necrotic spot; 2 grades: vaccination forms does not expand necrotic plaque; 3 grades: vaccination forms expansion necrotic plaque, expansion spot is surrounded by yellow haloing; 4 grades: vaccination forms expansion spot, and on scab, have a large amount of mould layers to produce; 5 grades: cotyledon festers.
Below 2, being wherein disease-resistant, more than 3 is susceptible type.
So, adopt equally JoinMap4.0 software to carry out genetic linkage analysis to black spot disease-resistant gene, finally cucumber scab resistant gene Primary Location with the same interval range of blight in (160kb of UW017820 and UW084909), referring to Fig. 2.
In a word, according to the reliability of the disease-resistant functional gene Foc-4 of blight the result, and blight and black spot be just positioned at same interval, and this genetic distance scope is only 0.5cm, and only there are 5 genes in interval.So Foc-4 gene and SNP mark thereof can represent the genotype that this is interval.Meanwhile, in 220 strain cucumber materials, the phenotype of black spot has 218 strains identical with Foc-4 gene SNP genotype, and concordance rate reaches 99%.Therefore Foc-4 gene and SNP mark thereof and scab resistant Ccu gene close linkage, can apply Foc-4 gene and SNP mark thereof and carry out the screening of resist/sense of cucumber black spot.
Claims (9)
1. cucumber fusarium axysporum disease-resistant gene Foc-4, (a) be the nucleotide sequence shown in SEQ ID NO:1 in sequence table, (b) have with sequence table in the above homology of sequence 90% shown in SEQ ID NO:1 and have with sequence table in the nucleotide sequence of sequence identical function shown in SEQ ID NO:1.
2. claim 1(a) genetic marker of described cucumber fusarium axysporum disease-resistant gene Foc-4, the bases G of the 3530th of susceptible gene sports base A.
3. for the claim 1(a that increases) pair of primers of described cucumber fusarium axysporum disease-resistant gene Foc-4, be respectively the nucleotide sequence shown in SEQ ID NO:7 and SEQ ID NO:8 in sequence table.
4. claim 1(a) the cDNA sequence of described cucumber fusarium axysporum disease-resistant gene Foc-4 is the nucleotide sequence shown in SEQ ID NO:3 in sequence table.
5. claim 1(a) proteins encoded of described cucumber fusarium axysporum disease-resistant gene Foc-4 is the aminoacid sequence shown in the SEQ ID NO:5 in sequence table.
6. the application of the cDNA of cucumber fusarium axysporum disease-resistant gene Foc-4 claimed in claim 1 or cucumber fusarium axysporum disease-resistant gene Foc-4 claimed in claim 4 in seed selection cucumber fusarium axysporum disease-resistant variety.
7. the application of genetic marker claimed in claim 2 in seed selection cucumber fusarium axysporum disease-resistant variety.
8. the application of cucumber fusarium axysporum disease-resistant gene Foc-4 claimed in claim 1 in seed selection scab of cucumber disease-resistant variety.
9. the application of genetic marker claimed in claim 2 in seed selection scab of cucumber disease-resistant variety.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410114320.XA CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
| PCT/CN2014/089052 WO2015143867A1 (en) | 2014-03-25 | 2014-10-21 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410114320.XA CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103882032A true CN103882032A (en) | 2014-06-25 |
| CN103882032B CN103882032B (en) | 2017-03-29 |
Family
ID=50951155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410114320.XA Active CN103882032B (en) | 2014-03-25 | 2014-03-25 | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882032B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015143867A1 (en) * | 2014-03-25 | 2015-10-01 | 北京市农林科学院 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
| CN107299105A (en) * | 2017-08-11 | 2017-10-27 | 河南省农业科学院园艺研究所 | Watermelon blight bacteria pathogenic FonAGL3 genes, its missing DNA fragmentation, deletion mutant and its application |
| CN109706154A (en) * | 2017-10-26 | 2019-05-03 | 中国农业大学 | CsPR3 gene and its application in cucumber anti-blight |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010098670A1 (en) * | 2009-02-27 | 2010-09-02 | Monsanto Invest N.V. | Fusarium resistant cucumber plants |
-
2014
- 2014-03-25 CN CN201410114320.XA patent/CN103882032B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010098670A1 (en) * | 2009-02-27 | 2010-09-02 | Monsanto Invest N.V. | Fusarium resistant cucumber plants |
Non-Patent Citations (4)
| Title |
|---|
| KANG,H: "Cucumis sativus isolate BGICucGB006756-TA putative TIR-NBS-LRR-AAA+ATPase gene,complete cds", 《GENBAN 登录号为 HM064413》 * |
| KANG,H: "Cucumis sativus isolate BGICucGB006756-TA putative TIR-NBS-LRR-AAA+ATPase gene,complete cds", 《GENBAN 登录号为 HM064413》, 7 June 2011 (2011-06-07) * |
| 张海英: "黄瓜重要抗病基因的分子标记研究及遗传图谱的构建", 《中国博士学位论文数据库农业科技辑》 * |
| 毛爱军 等: "黄瓜品系WIS2757对黄瓜枯萎病生理小种4和黑星病的抗性遗传与连锁分析", 《中国农业科学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015143867A1 (en) * | 2014-03-25 | 2015-10-01 | 北京市农林科学院 | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof |
| CN107299105A (en) * | 2017-08-11 | 2017-10-27 | 河南省农业科学院园艺研究所 | Watermelon blight bacteria pathogenic FonAGL3 genes, its missing DNA fragmentation, deletion mutant and its application |
| CN107299105B (en) * | 2017-08-11 | 2020-09-25 | 河南省农业科学院园艺研究所 | Pathogenic FonACL 3 gene of watermelon wilt pathogen, deletion DNA fragment and deletion mutant thereof and application thereof |
| CN109706154A (en) * | 2017-10-26 | 2019-05-03 | 中国农业大学 | CsPR3 gene and its application in cucumber anti-blight |
| CN109706154B (en) * | 2017-10-26 | 2021-04-27 | 中国农业大学 | CsPR3 gene and application thereof in cucumber fusarium wilt resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103882032B (en) | 2017-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102352367B (en) | Clone and application of semi-dominant gene qGL3 capable of controlling grain length and grain weight of rice kernel | |
| CN103866005B (en) | The primer of Muskmelon Fusarium wilt resistance and complete female system molecular marker assisted selection and method | |
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN104560983B (en) | Two SNP marker and its application with anti-cucumber powdery mildew close linkage | |
| Sun et al. | Resistance to powdery mildew in the pea cultivar Xucai 1 is conferred by the gene er1 | |
| WO2015143867A1 (en) | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof | |
| CN105764330A (en) | Genetic loci associated with response to abiotic stress | |
| KR101508744B1 (en) | Chloroplast DNA marker for distinguishing Brassica species and uses thereof | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN103266109A (en) | Molecular marker of rice resistance gene Xa23 and application of molecular marker | |
| CN105802960A (en) | Molecular marker and use thereof | |
| Chen et al. | Genetic variation in tomato populations from four breeding programs revealed by single nucleotide polymorphism and simple sequence repeat markers | |
| CN103882032A (en) | Cucumber blight disease resistance gene Foc-4 as well as encoding protein and application thereof | |
| Gonda et al. | Genome-based high-resolution mapping of fusarium wilt resistance in sweet basil | |
| Wang et al. | Development of EST-SSR markers related to salt tolerance and their application in genetic diversity and evolution analysis in Gossypium | |
| CN104404054A (en) | Clone identification of gene ZmNL related to head-smut resistance of corn and application of clone identification in breeding of corn resistant to head smut disease | |
| CN103789419A (en) | Co-dominance tag primer group for identifying allele type of rice photo-thermo-sensitive genic male-sterile gene p/tms12-1, and applications thereof | |
| Satya et al. | Genome synteny and evolution of AABB allotetraploids in Hibiscus section Furcaria revealed by interspecific hybridization, ISSR and SSR markers | |
| CN102149274A (en) | CVYV-resistant plants of the species cucumis melo | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| JP4892647B1 (en) | New varieties, methods for distinguishing plant varieties, and methods for rapid development of rice individuals | |
| CN104946630B (en) | Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof | |
| CN103882017B (en) | The molecule marker of cucumber fusarium axysporum disease-resistant gene Foc-4 and primer special thereof and application | |
| CN108690883B (en) | Molecular marker RMD7 for assisting in identifying soybean powdery mildew resistance of soybean to be detected |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |