CN105950722A - Rice SNP (single nucleotide polymorphism) sites related to brown planthopper resistance and application of SNP sites - Google Patents
Rice SNP (single nucleotide polymorphism) sites related to brown planthopper resistance and application of SNP sites Download PDFInfo
- Publication number
- CN105950722A CN105950722A CN201610289724.1A CN201610289724A CN105950722A CN 105950722 A CN105950722 A CN 105950722A CN 201610289724 A CN201610289724 A CN 201610289724A CN 105950722 A CN105950722 A CN 105950722A
- Authority
- CN
- China
- Prior art keywords
- rice
- snp
- gene
- gene promoter
- promoter upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses rice SNP (single nucleotide polymorphism) sites related to brown planthopper resistance and an application of the SNP sites. The rice SNP sites are located on upstream-641bp, -140bo and -43bp positions of a rice BGIOSGA015836 gene promoter, wherein base mutation of the BGIOSGA015836 gene promoter upstream-641bp is T, base mutation of the gene promoter upstream-140bp is G and base mutation of the gene promoter upstream-43bp is G. According to the invention, it discovers that the three polymorphism sites on the upstream region of the rice BGIOSGA015836 gene are closely related to phenotype of rice insect resistance; and through mutation of the three polymorphism sites, the high expression of the rice brown planthopper resistant BGIOSGA015836 gene can be induced; therefore, the rice has an effect of resisting the brown planthopper.
Description
Technical field
The invention belongs to technical field of molecular biology, be specifically related to a kind of SNP site relevant to Rice Resistance brown paddy plant hopper
And application.
Background technology
Along with the mankind enter the genome times afterwards comprehensively, carry out before functional genome research becomes life science comprehensively
Along field.Owing to the transgenic technology of Oryza sativa L. is relatively easy, and with other gramineous crop genome, there is synteny, thus
By depending on doing model plant.At present, rice genome deliberate genetic figure and physical map complete, further to Oryza sativa L. functional gene
Study, socio-economic development and biological study are significant.
Have more than the people of half in the world with Oryza sativa L. as staple food at present.Food Security, is that the people of the world faces
Challenge.20th century 50, the breeding wheat for semidwarfness of the sixties and the hybrid rice of the seventies cultivate twice scientific and technological revolution makes rice yield big
Amplitude improves.But Oryza sativa L. is endangered by large-area disease pest in recent decades, Rice Production is made to be on the hazard.Brown paddy plant hopper is China
Primary pest in Rice Production, its adult and nymph, with lancet thorn water suction rice juice, cause yellow leaf or withered, cause the underproduction or
Total crop failure.According to Chinese agriculture yearbook record, brown paddy plant hopper insect pest in 1966,1969,1973,1977,1983 and 2003 national greatly
Occur, national especially big generation in 1987,1991,2005,2006 and 2007, hazard area reach the 50% of the Oryza sativa L. gross area with
On, cause serious loss to China's Rice Production.And the harm of brown paddy plant hopper mostly occurs in the Oryza sativa L. maturation pustulation period, the most greatly
Amount uses insecticide, and the pollution to Oryza glutinosa is also the most serious problem.
Utilizing brown planthopper resistant gene to cultivate insect-proof rice kind is the most cost-effective method in brown paddy plant hopper integrated control,
And genetic marking method is to cultivate the important technology of resistant variety.Along with molecular biology and genetic development, emerge
A variety of genetic markers, such as labellings such as AFLP, RAPD, SSR, SNP, wherein, SNP marker is because having high pass widely distributed, suitable
The amount feature such as automated analysis, inheritance stability, is increasingly becoming in genetic breeding research the genetic marker of first-selection.If these heredity marks
Together with note can be associated with the production traits, can realize carrying out selection and use from DNA level, overcome in traditional method artificial
The interference of subjective factors, improves the accuracy selected, and can identify the individuality with merit in early days, filter out excellent
Good standby parent, thus shorten breeding cycle, accelerate breeding process.It is thus found that the gene relevant with Rice Resistance brown paddy plant hopper and
Its SNP site, is greatly improved screening effect.
Summary of the invention
It is an object of the invention to provide a kind of SNP site relevant to Rice Resistance brown paddy plant hopper and application thereof.
The technical solution used in the present invention is:
Oryza sativa L. single nucleotide polymorphism SNP site, is respectively positioned in Oryza sativa L. BGIOSGA015836 gene promoter upstream sequence
At Lie-641 ,-140 and-43 bases, wherein the-641st base of BGIOSGA015836 gene promoter upstream is dashed forward
Becoming T, the-140th base mutation of gene promoter upstream is G, and the-43rd base mutation of gene promoter upstream is G.
Preferably, the application in screening BPH-resistant rice varieties of the described Oryza sativa L. single nucleotide polymorphism SNP site.
A kind of method improving Rice Resistance brown paddy plant hopper, by Oryza sativa L. BGIOSGA015836 gene promoter upstream the-641st
Base mutation is T, and/or to be positioned at the-140th base mutation of gene promoter upstream be G, and/or is positioned on gene promoter
Swimming the-43rd base mutation is G.
The authentication method of a kind of BPH-resistant rice varieties, comprises the steps: to extract oryza sativa genomic dna, to extract
The DNA obtained is template, utilizes primer to carry out PCR amplification, will obtain PCR primer order-checking and identify, if containing list described above
Nucleotide polymorphisms SNP site, then be judged to BPH-resistant rice varieties.
Preferably, described primer, its nucleotide sequence is as follows:
SNP-f:CAGTTCAACAGGCTGACT (SEQ ID NO:1),
SNP-r:GGGATCAGAGAGGAAGAAATC (SEQ ID NO:2).
Because the base corresponding to first nucleotide starting the synthesis of RNA chain in gene order is designated as+1, in this base
The sequence of trip is designated as negative, and the sequence in downstream is designated as positive number.The BGIOSGA015836 gene of insect-proof rice kind BG1222 upper
Trip-750～-1bp sequence as shown in SEQ ID NO:3, sense worm rice varieties TN1 BGIOSGA015836 gene upstream-
The sequence of 750～-1bp is as shown in SEQ ID NO:4.
The invention has the beneficial effects as follows:
Present invention discover that three pleomorphism sites of Oryza sativa L. BGIOSGA015836 upstream region of gene are deposited with near-isogenic rice lines phenotype
At tight association, by the sudden change of these 3 pleomorphism sites, Rice Resistance brown paddy plant hopper BGIOSGA015836 gene can be caused
High expressed, so that Oryza sativa L. shows the effect of brown planthopper resistant.
The invention also discloses the authentication method of BPH-resistant rice varieties, by extracting oryza sativa genomic dna, to extract
The DNA obtained is template, utilizes primer to carry out PCR amplification, will obtain PCR primer order-checking and identify, if containing above-mentioned monokaryon glycosides
Acid polymorphic SNP site, then be judged to BPH-resistant rice varieties.
Accompanying drawing explanation
Fig. 1 is the BGIOSGA015836 expression time sequence of rice varieties BG1222 and TN1 after being sucked by brown paddy plant hopper
Row change；
Fig. 2 is hybridization F2The expression of BGIOSGA015836 and the relation of near-isogenic rice lines fractional value in offspring.
Detailed description of the invention
Brown paddy plant hopper is the primary pest that hazard rice produces, and morphs due to Biotypes of The Brown Planthopper Nilaparvata Lugens Stal in recent years and produces anti-
The reasons such as the property of medicine, brown paddy plant hopper disaster is on the rise.Production practices prove, utilize resistant variety be most economical, safety and have
The measure of effect.According to " standard Seedling dish identification method ", BG1222 is carried out pest-resistant rank detection in seedling stage for many years, found that it is to brown
Plant hopper has stablizes resistance, and BG1222 also has higher resistance to bacterial leaf-blight, therefore has higher in breeding
Value.
TN1 is the internationally recognized sense worm rice varieties without any anti insect gene.
Inventor by having rice varieties BG1222 and the research of sense worm rice varieties TN1 of stable resistance to brown paddy plant hopper
Find brown planthopper resistant gene in rice BGIOSGA015836.Pest-resistant cultivar with sense worm kind compared with, the gene of BGIOSGA015836
There is significant difference in expression.In pest-resistant cultivar BG1222, the expression of BGIOSGA015836 is than sense worm rice varieties TN1
Expression more than high ten times.Regardless of whether it is the most remote to be sucked the expression of BGIOSGA015836 in BG1222 by brown paddy plant hopper
Expression higher than TN1.
In addition inventor is also to brown planthopper resistant gene in pest-resistant rice varieties BG1222 and sense worm rice varieties TN1
The upstream sequence of BGIOSGA015836 is analyzed, and finds 3 polymorphic SNP site.
Rice varieties BG1222 used in R&D process of the present invention and sense worm rice varieties TN1 is homozygote.
Below in conjunction with embodiment, the present invention is further illustrated, but is not limited thereto.
There is significant difference in embodiment 1 pest-resistant cultivar gene expression amount of BGIOSGA015836 compared with sense worm kind
One. paddy gene RNA extracts
1) sample is divided into tissue and cell: cell is directly collected；Liquid nitrogen grinding tissue samples, add 500ul containing 4% β-
The extract with CTAB liquid of mercaptoethanol, 65 degree of water-bath 30min；
2) being subsequently adding isopyknic chloroform/isoamyl alcohol (24:1), after mixing 10,000g is centrifuged 10min；
3) adding isopyknic isopropanol ,-20 degree place 1h, and 12,000g are centrifuged 10min, abandon supernatant；
4) adding the resuspended precipitation of 1000ul Trizol, be subsequently adding 200 μ l chloroforms, be shaken vigorously by hand for 15 seconds, room temperature is quiet
Put 5min；
5) at 4 DEG C, 10,000g are centrifuged 3min, and solution is divided into three layers, and RNA is dissolved in aqueous phase, and transfer aqueous phase is to another
New RNase free EP pipe；
6) adding 0.5 times of volume isopropanol, vortex fully mixes；
7) at 4 DEG C, 12,000g are centrifuged 10min, RNA precipitate occur, remove supernatant after being centrifuged at the bottom of pipe；
8) adding 1ml 75% ethanol, overturn gently with hands, 12,000g are centrifuged 5min, remove supernatant；
9) room temperature is dried or is vacuum dried, and adds 60 μ l DEPC water dissolution precipitations.
Two. remove genome
Use the DNase I of RNase-free, by following system configurations reactant liquor:
37 DEG C of digestion 30min, 65 DEG C of inactivation 10min.
Operation the most according to the following steps:
1) adding isopyknic phenol, after mixing of turning upside down, 10,000rpm, centrifugal 5min, take supernatant；
2) adding isopyknic chloroform, after mixing of turning upside down, 10,000rpm, centrifugal 10min, take supernatant；
3) adding equal-volume isopropanol, the most fully mix ,-20 DEG C stand 15min；
4), at 4 DEG C, 10,000g are centrifuged 10min, collect RNA precipitate, remove supernatant；
5) by 75% washing with alcohol twice, super-clean bench air-dries；
6) 10 μ l DEPC water dissolution precipitations are added.
Three. purity detecting and electrophoresis detection
Purity detecting: take the 60 times of dilutions of 2 μ l RNA sample, in the upper mensuration of micro-spectrophotometer k2800 (the triumphant Austria in Beijing)
OD value, OD260/OD280Ratio more than 1.8, illustrate that the RNA prepared is purer, without protein contamination.
Four. reverse transcription
1) in PCR pipe, template ribonucleic acid, primer mixture, total amount 12ul are added.Reaction system is as follows:
Rapidly in cooled on ice 2min after 70 DEG C of insulation 10min.
2) in this PCR pipe, following reagent is added
Above-mentioned 20 μ l reaction solution 42 DEG C is incubated 60min；72 DEG C of insulation 15mn；-20 DEG C save backup.
Five. quantitatively
Utilizing following primer to carrying out the gene expression quantitative analysis of BGIOSGA015836, its base sequence is as follows.
RE-f:CCAACAGCTCTGCGCTCATC (SEQ ID NO:5),
RE-r:ACTCCAGCCAAAAGAAACCCA (SEQ ID NO:6).
1) reaction system: cDNA dilutes 3 times
2) reaction condition: use ViiA7software
95℃30S；
95 DEG C of 3S, 60 DEG C of 34S (collection fluorescence signal)；45 circulations.
Melt curve analysis is analyzed: temperature 60 C-95 DEG C, reading per minute 1 time.
Result is shown in Fig. 1.
In Fig. 1, abscissa is the hourage that Oryza sativa L. is sucked by brown paddy plant hopper, and vertical coordinate is the relative table of BGIOSGA015836
The amount of reaching: with at 0 hour (h), in TN1, the expression of gene BGIOSGA015836 is standardized as numerical value 1, At All Other Times with material
Gene expression amount be all based on this, owing to the difference value of expression has tens times more than, so taking expression numerical value with 10
The logarithm end of for obtains final relative expression quantity.
In the case of being sucked by brown paddy plant hopper as can be seen from Figure 1, plant by external irritant, BGIOSGA015836's
Expression can improve, and illustrates that this gene had both had composing type in BG1222 and TN1 and (also do not had by environmental stimuli expression poor
Different) differential expression, it may have induction type (being caused differential expression by environmental stimuli) differential expression.In different time points,
BGIOSGA015836 gene all can be significantly higher than the expression of TN1 at the expression of BG1222.
Fig. 1 result shows that the expression of BGIOSGA015836 in pest-resistant cultivar BG1222 is than sense worm rice varieties TN1's
Expression more than high ten times.Regardless of whether sucked by brown paddy plant hopper, the expression of the BGIOSGA015836 in BG1222 is all remote high
Expression in TN1.
The clone of the gene of embodiment 2BGIOSGA015836, and polypeptide analysis
Respectively the BGIOSGA015836 gene of pest-resistant cultivar BG1222 and sense worm kind TN1 is cloned, carry out point
Analysis.
The wherein BGIOSGA015836 gene in pest-resistant cultivar BG1222, its nucleotide sequence is as shown in SEQ ID NO:7
(including exon and intron), the BGIOSGA015836 gene in sense worm kind TN1, its nucleotide sequence such as SEQ ID
Shown in NO:8 (including exon and intron).
Wherein in pest-resistant cultivar BG1222 the cDNA sequence of BGIOSGA015836 gene as shown in SEQ ID NO:9；And feel
In worm kind TN1, the cDNA sequence of BGIOSGA015836 gene is as shown in SEQ ID NO:10.Above-mentioned cDNA has base at 5 to have
Institute is different, but the peptide sequence encoding the Rice Resistance brown paddy plant hopper obtained is identical, its aminoacid sequence such as SEQ ID NO:
Shown in 11.
Embodiment 3 pest-resistant cultivar is the detection of BGIOSGA015836 upstream pleomorphism site compared with sense worm kind
One, utilize CTAB extraction process to extract oryza sativa genomic dna, or utilize the test kit of commercialization to extract paddy gene
Group.
Two, PCR
Utilize following primer to carrying out the detection of BGIOSGA015836 upstream pleomorphism site, the following institute of its base sequence
Show.
SNP-f CAGTTCAACAGGCTGACT (SEQ ID NO:1),
SNP-r GGGATCAGAGAGGAAGAAATC (SEQ ID NO:2).
Reaction system is as follows:
PCR response procedures is: 94 DEG C of 4min；94 DEG C of 50sec, 55 DEG C of 30sec, 72 DEG C of 50ec, 35 circulations.72℃
10min.PCR product is checked order after purification, judges its gene polymorphism sites type according to the sequence of sequencing result.
Because the base corresponding to first nucleotide starting the synthesis of RNA chain in gene order is designated as+1, in this base
The sequence of trip is designated as negative, and the sequence in downstream is designated as positive number.
Order-checking post analysis finds: in pest-resistant cultivar BG1222 and sense worm kind TN1 in the upstream sequence of BGIOSGA015836
There are 3 SNP pleomorphism sites and there is tight association with near-isogenic rice lines phenotype, the results are shown in Table 1.
The distribution of table 1SNP
| Upstream position | TN1 | BG1222 |
| -641 | C | T |
| -140 | T | G |
| -43 | A | G |
In table 1, pest-resistant cultivar BG1222, compared with sense worm kind TN1, is positioned at BGIOSGA015836 gene promoter upstream
Base C of-641bp position (namely at the-641st base) sports T, is positioned on BGIOSGA015836 gene promoter
Base T of trip-140bp (namely at the-140th base) is mutated into G, and is positioned at BGIOSGA015836 gene promoter
Base A of sub-upstream-43bp (namely at the-43rd base) is mutated into G.
The sequence such as SEQ ID of the upstream-750～-1bp of the BGIOSGA015836 gene of insect-proof rice kind BG1222
Shown in NO:3, the sequence such as SEQ ID NO of the upstream-750～-1bp of the BGIOSGA015836 gene of sense worm rice varieties TN1:
Shown in 4.
Although the upstream sequence of above-mentioned two kind BGIOSGA015836 gene there is also the difference of other bases, but,
With the presence of and only these 3 SNP pleomorphism sites and near-isogenic rice lines phenotype tight association.And these 3 SNP site are in
The upstream regulatory region of BGIOSGA015836 gene promoter.
Embodiment 4 pest-resistant cultivar carries out hybridizing F with sense worm kind2Generation
F is set up by the hybridization of BG1222 Yu TN12Progeny population, F2The sample n=512 of progeny population.Therefrom have chosen
The individual detection of 60 different resistance fractional values, and the F to different resistance rank phenotypes2Offspring individuals detects it respectively
The expression of BGIOSGA015836, pest-resistant with Oryza sativa L. with the expression and upstream pleomorphism site determining BGIOSGA015836
The dependency of phenotype.
Result is shown in Fig. 2.
Fig. 2 result shows: hybridization F2Offspring's checking shows that the expression of BGIOSGA015836 becomes positive with near-isogenic rice lines
Close (the highest insect resistace of expression is the strongest).In offspring, insect resistace is the strongest, and its resistance fractional value (Grade) is the least, corresponding
The expression of BGIOSGA015836 is the highest.Resistance fractional value (Grade) is divided into 0,1,3,5,7,9；Fractional value is the least to be represented it and resists
Worm property is the strongest.
At F2Progeny population, the F to different resistance rank phenotypes2Offspring individuals detection BGIOSGA015836 upstream sequence
Pleomorphism site.The results are shown in Table 2.
Table 2SNP and the degree of association of near-isogenic rice lines phenotype
| Upstream position | TN1(S) | BG1222(R) | SNP index_RF2 | SNP index_SF2 | Delta_SNP index(SF2-RF2) |
| -641 | C | T | 0.13 | 1 | 0.87 |
| -140 | T | G | 0.12 | 1 | 0.88 |
| -43 | A | G | 0.13 | 1 | 0.87 |
In table 2, SNP index represent the base type in this site compared with reference sequences, the alkali different from reference sequences
The sequence quantity of base type is divided by the ratio of sequence quantity altogether；If SNP index is the 0 base type showing this site
It is just the same with reference sequences, if SNP index is 1 to show that the base type in this site is the most different with reference sequences.
Table 2 with the sequence of BG1222 as reference sequences, RF2(F2In show the individuality of insect resistace) SNP basic with
BG1222 is identical, SF2(F2In show the individuality of susceptibility) SNP with BG1222 entirely different.Delta_SNP index is anti-
Should the relatedness of site and phenotype, if 0 shows this site and phenotype non-correlation, if showing this site closer to 1
The strongest with the dependency of phenotype.
As known from Table 2: hybridization F2In offspring, said gene upstream pleomorphism site (SNP) is deposited with near-isogenic rice lines phenotype
At tight association.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment
Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify,
All should be the substitute mode of equivalence, within being included in protection scope of the present invention.
<110>Inst. of Plant Protection, Guangdong Prov. Academy of Agricultural Sciences
<120>a kind of SNP site relevant to Rice Resistance brown paddy plant hopper and application
<130>
<160> 11
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>artificial sequence
<400> 1
cagttcaaca ggctgact 18
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
gggatcagag aggaagaaat c 21
<210> 3
<211> 750
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 3
agatattttg acctctcaac tattaaaacc ggtgtaattt gattctctaa gcggttttag 60
agtacggttt tgctgacatg gggctttgac ccagttcaac aggctgactt agcatgtggg 120
acccacatct taaaaaaaga agtcaaatta catcgatttc aatagttggg aggtctaaat 180
atccagtatt gcgattcagg gatatacata ttaaagatga gctatatttt gagggagcca 240
aagtggactt attccacagc agcacaaggg ccaactcatg ggccgttttt tctggccctt 300
acactctgtg ctgcctctgc ctgtaccaat cctctttttg attttctttt aacgagttgt 360
ctttttcgac gcacagtcgt attaatacac caactgaaat acgagtacaa tttctgtaca 420
atacatacgt acatacatac acgtattctt tagaagtaca tacatatacg aagcctttca 480
gtttcaggtg ggacccaccc cgcacaccac gacaccgtct cgatcccccc cctcctctcc 540
tcctctcgcc ggcgacccct ccgccgcttc cttcgccgga atcgatcgat cccatcctgc 600
ccaagccgcc gccgatttca cctcaccttg gtcgtaagta ctactatctc tgatccggtc 660
ccgatccaga tcggaattct tccgaccccc taccataatc gcacgcggtt tcttgatttc 720
ttcctctctg atcccaagct aggaggtcgc 750
<210> 4
<211> 750
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 4
agatattttg acctctcagc tattaaaacc ggtgtaattt gattctctaa gcggttttag 60
agtacggttt tgctgacatg gggctttgac ccagttcaac aggctgactc agcatgtggg 120
acccacatct taaaaaaaga agtcaaatta catcgatttc aatagttggg gggtctaaat 180
atccagtatt gcgattcagg gatatacata ttaaagatga gctatatttt gagggagcca 240
aagtggactt attccacagc agcacaaggg ccaactcatg ggccgttttt tctggccctt 300
acactctgtg ctgcctctgc ctgtaccaat cctctttttg attttctttt aacgagttgt 360
ctttttcgac gcacagtcgt attaatacac caactgaaat acgagtacaa tttctgtaca 420
atacatgcgt acatacatac acgtattctt tagaagtaca tacatatacg aagcctttca 480
gtttcaggtg ggacccaccc cgcacaccac gacaccgtct cgatcccccc cctcctctcc 540
tcctctcgcc ggcgacccct ccgccgcttc cttcgccgga atcgatcgat cccatcctgc 600
ccaagccgcc tccgatttca cctcaccttg gtcgtaagta ctactatctc tgatccggtc 660
ccgatccaga tcggaattct tccgaccccc taccctaatc gcacgcgatt tcttgatttc 720
ttcctctctg atcccaagct aggaggtcgc 750
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ccaacagctc tgcgctcatc 20
<210> 6
<211> 21
<212> DNA
<213>artificial sequence
<400> 6
actccagcca aaagaaaccc a 21
<210> 7
<211> 2779
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 7
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccaccca ccacctcctg ccctttccgc cttcctcttt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tcccctgtgt ttgcaggaca cagtgactgg gtttcttttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaac 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaattgcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca caaggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttgtaatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatccaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttctg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 8
<211> 2779
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 8
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccacccc ccacctcctc ccctttccgc cttgctcgtt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tgccctgtgt ttgcaggaca cggtgactgg gtttttgttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaat 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaatttcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca cacggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttataatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatcgaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttccg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 9
<211> 393
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 9
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacag tgactgggtt tcttttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcc 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tctgctgaat cagtggcgtc agataggcga tga 393
<210> 10
<211> 393
<212> DNA
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 10
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacgg tgactgggtt tttgttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcg 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tccgctgaat cagtggcgtc agataggcga tga 393
<210> 11
<211> 130
<212> PRT
<213>Oryza sativa L. (Oryza.sativa L.)
<400> 11
Met Ala Gly Arg Pro Ser Ile Pro Thr Asn Ser Ser Ala Leu Ile Ala
1 5 10 15
Ile Ile Ala Asp Glu Asp Thr Val Thr Gly Phe Leu Leu Ala Gly Val
20 25 30
Gly Asn Val Asp Leu Arg Lys Lys Thr Asn Tyr Leu Ile Val Asp Asn
35 40 45
Lys Thr Thr Val Lys Gln Ile Glu Asp Ala Phe Lys Glu Phe Thr Thr
50 55 60
Arg Glu Asp Ile Ala Ile Val Leu Ile Ser Gln Tyr Val Ala Asn Met
65 70 75 80
Ile Arg Phe Leu Val Asp Ser Tyr Asn Arg Pro Val Pro Ala Ile Leu
85 90 95
Glu Ile Pro Ser Lys Asp His Pro Tyr Asp Pro Ala His Asp Ser Val
100 105 110
Leu Ser Arg Val Lys Tyr Leu Phe Ser Ala Glu Ser Val Ala Ser Asp
115 120 125
Arg Arg
130
Claims (5)
1. Oryza sativa L. single nucleotide polymorphism SNP site, is respectively positioned in Oryza sativa L. BGIOSGA015836 gene promoter upstream sequence
At Lie-641 ,-140 and-43 bases, wherein the-641st base of BGIOSGA015836 gene promoter upstream is dashed forward
Becoming T, the-140th base mutation of gene promoter upstream is G, and the-43rd base mutation of gene promoter upstream is G.
2. the answering in screening BPH-resistant rice varieties of the Oryza sativa L. single nucleotide polymorphism SNP site described in claim 1
With.
3. the method improving Rice Resistance brown paddy plant hopper, it is characterised in that: by Oryza sativa L. BGIOSGA015836 gene promoter upstream
-641st base mutation is T, and/or to be positioned at the-140th base mutation of gene promoter upstream be G, and/or is positioned at gene
The-43rd, promoter upstream base mutation is G.
4. the authentication method of a BPH-resistant rice varieties, it is characterised in that comprise the steps: to extract rice genome
DNA, to extract the DNA that obtains as template, utilizing primer to carry out PCR amplification, will obtaining the order-checking qualification of PCR product, if containing
Single nucleotide polymorphism SNP site described in claim 1, then be judged to BPH-resistant rice varieties.
5. according to the authentication method described in claim 4, it is characterised in that: described primer, its nucleotide sequence is as follows:
SNP-f:CAGTTCAACAGGCTGACT(SEQ ID NO:1),
SNP-r:GGGATCAGAGAGGAAGAAATC(SEQ ID NO:2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610289724.1A CN105950722B (en) | 2016-05-03 | 2016-05-03 | One kind SNP site relevant to rice brown planthopper resistant and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610289724.1A CN105950722B (en) | 2016-05-03 | 2016-05-03 | One kind SNP site relevant to rice brown planthopper resistant and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950722A true CN105950722A (en) | 2016-09-21 |
| CN105950722B CN105950722B (en) | 2019-09-03 |
Family
ID=56913563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610289724.1A Active CN105950722B (en) | 2016-05-03 | 2016-05-03 | One kind SNP site relevant to rice brown planthopper resistant and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950722B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896281A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Molecular mark method for rice variety anti-brownspot gene site |
| CN102181440A (en) * | 2011-04-13 | 2011-09-14 | 武汉大学 | Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof |
| CN103215237B (en) * | 2013-03-25 | 2015-06-24 | 南京农业大学 | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof |
| CN103509791B (en) * | 2013-07-31 | 2016-03-16 | 江西省农业科学院水稻研究所 | The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof |
-
2016
- 2016-05-03 CN CN201610289724.1A patent/CN105950722B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896281A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Molecular mark method for rice variety anti-brownspot gene site |
| CN102181440A (en) * | 2011-04-13 | 2011-09-14 | 武汉大学 | Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof |
| CN103215237B (en) * | 2013-03-25 | 2015-06-24 | 南京农业大学 | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof |
| CN103509791B (en) * | 2013-07-31 | 2016-03-16 | 江西省农业科学院水稻研究所 | The genetic marker of Rice Resistance brown paddy plant hopper major gene Bph14 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| YASUMORI TAMURA ET AL.: "Map-based Cloning and Characterization of a Brown Planthopper Resistance Gene BPH26 from Oryza sativa L. ssp. indica Cultivar ADR52", 《SCIENTIFIC REPORTS》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950722B (en) | 2019-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Combined use of bulked segregant analysis and microarrays reveals SNP markers pinpointing a major QTL for resistance to Phytophthora capsici in pepper | |
| Yakubov et al. | Combination of SCAR primers and Touchdown-PCR for sex identification in Pistacia vera L. | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN104969855B (en) | Method for cultivating rice breeding material with broad spectrum and lasting spike blast resistance | |
| CN102031253B (en) | Molecular marker method for identifying indica type rice and japonica rice by using rice grain | |
| CN107034223B (en) | The anti-plant hopper gene BGIOSGA015651 of adjusting and controlling rice and its application | |
| CN110183525A (en) | The relevant TXR albumen of wheat stripe rust resisting disease and its encoding gene and application | |
| CN115927720B (en) | Soy saponin related KASP (KASP) mark and application thereof | |
| Miyatake et al. | Fine mapping of a major locus representing the lack of prickles in eggplant revealed the availability of a 0.5-kb insertion/deletion for marker-assisted selection | |
| CN107058338A (en) | The ethylene responses transcription factor gene of one yield and property of cotton association | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN101487056A (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| Shen et al. | Analysis of genetic diversity of Brassica rapa var. chinensis using ISSR markers and development of SCAR marker specific for Fragrant Bok Choy, a product of geographic indication | |
| CN102690811B (en) | Molecular marker SIsv1363 closely linked with millet leaf color gene | |
| CN105820222B (en) | Brown planthopper resistant gene in rice and its application | |
| CN106434709A (en) | Allelic variation and gene marker application of rice brown planthopper resisting gene Bph3 | |
| CN103882032B (en) | Cucumber fusarium axysporum disease-resistant gene Foc 4 and its encoding proteins and application | |
| CN110484648A (en) | A kind of Indel molecular labeling of the raw inflorescence of the novel single cluster of identification capsicum, primer and application | |
| CN105950722B (en) | One kind SNP site relevant to rice brown planthopper resistant and application | |
| CN109825604A (en) | With the molecular labeling of peach aphid resistance shape close linkage, for detecting the primer, kit, method and its application of peach aphid resistance shape | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN112813180B (en) | Molecular marker and primer pair for identifying cabbage leaf wax powder character and application thereof | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN109251996A (en) | Detect dCAPS label and the application of the low temperature resistant gene C OLD1 genotype of rice | |
| Chen et al. | Marker-assisted development and evaluation of monogenic lines of rice cv. Kaohsiung 145 carrying blast resistance genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |