CN105820222B - Brown planthopper resistant gene in rice and its application - Google Patents

Brown planthopper resistant gene in rice and its application Download PDF

Info

Publication number
CN105820222B
CN105820222B CN201610289474.1A CN201610289474A CN105820222B CN 105820222 B CN105820222 B CN 105820222B CN 201610289474 A CN201610289474 A CN 201610289474A CN 105820222 B CN105820222 B CN 105820222B
Authority
CN
China
Prior art keywords
rice
gene
expression quantity
brown planthopper
brown
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610289474.1A
Other languages
Chinese (zh)
Other versions
CN105820222A (en
Inventor
李怡峰
肖汉祥
张振飞
李燕芳
张扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Original Assignee
Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Protection Research Institute Guangdong Academy of Agricultural Sciences filed Critical Plant Protection Research Institute Guangdong Academy of Agricultural Sciences
Priority to CN201610289474.1A priority Critical patent/CN105820222B/en
Publication of CN105820222A publication Critical patent/CN105820222A/en
Application granted granted Critical
Publication of CN105820222B publication Critical patent/CN105820222B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Botany (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Insects & Arthropods (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of brown planthopper resistant gene in rice and its applications.The present invention is signed by having the rice varieties BG1222 of stable resistance and the research of sense worm rice varieties TN1 to find a kind of brown planthopper resistant gene in rice to brown paddy plant hopper as BGIOSGA015836, nucleotide sequence is as shown in SEQ ID NO:4.Pest-resistant cultivar is compared with feeling worm kind, and there are significant differences for the gene expression amount of BGIOSGA015836: regardless of whether being sucked by brown paddy plant hopper, the expression quantity of the BGIOSGA015836 in BG1222 is all much higher than the expression quantity of TN1.Hybridize F2Offspring's verification result shows that the expression quantity of BGIOSGA015836 is positively correlated with near-isogenic rice lines, and expression quantity is higher, and insect resistace is stronger.

Description

Brown planthopper resistant gene in rice and its application
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a kind of brown planthopper resistant gene in rice BGIOSGA015836 also relates to application of the gene in rice and rice paddy seed brown planthopper resistant.
Background technique
As the mankind enter the genome times afterwards comprehensively, before development functional genome research has become life science comprehensively Along field.There is synteny since the transgenic technology of rice is relatively easy, and with other gramineous crop genomes, thus By depending on doing model plant.Currently, rice genome deliberate genetic figure and physical map are completed, further to rice functional gene It is studied, is of great significance to socio-economic development and biological study.
The people of half is had more than in the world using rice as staple food at present.Food Security is that the people of the world faces Challenge.The hybrid rice in 20th century 50, the breeding wheat for semidwarfness of the sixties and the 70's, which cultivates scientific and technological revolution twice, keeps rice yield big Amplitude improves.But rice is endangered by the disease pest of large area in recent decades, and Rice Production is made to be on the hazard.Brown paddy plant hopper is China Primary pest in Rice Production, adult and nymph cause yellow leaf or withered with lancet piercing and sucking rice juice, cause the underproduction or Total crop failure.It is recorded according to Chinese agriculture yearbook, brown paddy plant hopper insect pest is national in 1966,1969,1973,1977,1983 and 2003 Big to occur, national especially big generation in 1987,1991,2005,2006 and 2007, hazard area reaches the rice gross area 50% or more, serious loss is caused to China's Rice Production.And the harm of brown paddy plant hopper mostly occurred in the rice mature pustulation period, Insecticide is largely used at this time, and the pollution to paddy is also problem very serious.
Cultivating insect-proof rice kind using brown planthopper resistant gene is method the most cost-effective in brown paddy plant hopper integrated control. International Rice Research Institute (IRRI) even result of study and Southeast Asia Rice Production it was verified that only medium resistance Horizontal rice varieties, are also enough the collective control of brown paddy plant hopper is below horizontal what is caused damages, are unlikely to cause rice Actual harm and production loss.Therefore, excavating brown planthopper resistant gene in rice and applying in rice breeding project is anti-harness the river The essential measure of brown plant-hopper.
To begin from the 1960s, the genetics of resistance of brown paddy plant hopper and breeding research just have begun progress, but with new The generation of bion (or new cause evil type), pest-resistant cultivar are faced with reduced service life, the risk that resistance is lost.Such as international water Rice research institute released the kind IR26 with Bph1 gene in 1973, occurred that the bion 2 of evil can be caused after 2-3； 1977-1978 releases the kind IR36 and IR42 of tool Bph2 resistant gene, and as a result nineteen eighty-two occurs in some countries in succession The new bion of brown paddy plant hopper, it has to cultivate corresponding new resistant variety IR56 and IR64 again in nineteen eighty-three.In Seo in 2006 The rice varieties for carrying different anti-plant hopper genes several to South Korea are tested, wherein Cheongcheongbyeo(base containing Bph1 Cause), ASD7 and M63(gene containing Bph2) the insect resistace of rice all declined, but Gayabyeo(contain simultaneously Bph1 with Bph2 gene) rice still there is good insect resistace (Seo et al., 2009).Ptb33(contain simultaneously Bph2 with Bph3 gene) cause evil it is horizontal lower, aggrieved grade is 2.5, and Performance of cultivar is pest-resistant (making widely known, 2011).
Therefore, it continues deeper into screening and studies anti-source material, finds new resistant gene, and its related gene is determined Position and clone, research and develop the new rice varieties with resistance genetic material, tool has very great significance.
The purpose of the present invention is to provide a kind of brown planthopper resistant gene in rice BGIOSGA015836 and its applications.
The technical solution used in the present invention is:
Brown planthopper resistant gene in rice BGIOSGA015836 encodes albumen, amino acid sequence such as SEQ ID NO:1 institute Show.
The cDNA sequence of brown planthopper resistant gene in rice BGIOSGA015836.
Preferably, nucleotide sequence is as shown in SEQ ID NO:2 or SEQ ID NO:3.
Brown planthopper resistant gene in rice BGIOSGA015836, nucleotide sequence is as shown in SEQ ID NO:4 or the sequence Column are through replacement, missing or increase one or more nucleotide, and encode the nucleotide sequence of same amino acid sequence.
The wherein BGIOSGA015836 gene in pest-resistant cultivar BG1222, nucleotide sequence such as SEQ ID NO:4 institute Show (including exon and introne), feels the BGIOSGA015836 gene in worm kind TN1, nucleotide sequence such as SEQ ID (including exon and introne) shown in NO:5.The two encodes identical amino acid sequence.
Application of the gene BGIOSGA015836 in rice breeding.
The gene BGIOSGA015836 is improving the application in Rice Resistance Brown Planthopper Resistance.
A method of rice brown planthopper resistant performance is improved, is the method by molecular breeding method or genetic engineering, mentions The expression quantity of high BGIOSGA015836 gene is to improve rice brown planthopper resistant character.
The beneficial effects of the present invention are:
The present invention is by having the research of the rice varieties BG1222 of stable resistance and sense worm rice varieties TN1 to brown paddy plant hopper A kind of brown planthopper resistant gene in rice is found, is signed as BGIOSGA015836.Pest-resistant cultivar is compared with feeling worm kind There are significant differences for the gene expression amount of BGIOSGA015836.
The expression quantity of BGIOSGA015836 is higher by ten than the expression quantity for feeling worm rice varieties TN1 in pest-resistant cultivar BG1222 Times or more.Regardless of whether being sucked by brown paddy plant hopper, the expression quantity of the BGIOSGA015836 in BG1222 is all much higher than the table of TN1 Up to amount.
Hybridize F2Offspring's verifying shows that the expression quantity of BGIOSGA015836 is positively correlated that (expression quantity is got over near-isogenic rice lines High insect resistace is stronger).Insect resistace is stronger in offspring, and resistance fractional value (Grade) is smaller, corresponding BGIOSGA015836's Expression quantity is higher.
Detailed description of the invention
The BGIOSGA015836 expression quantity time sequence that Fig. 1 is the rice varieties BG1222 and TN1 after being sucked by brown paddy plant hopper Column variation；
Fig. 2 is hybridization F2The relationship of the expression quantity of BGIOSGA015836 and near-isogenic rice lines fractional value in offspring.
Specific embodiment
The present invention is further illustrated combined with specific embodiments below, and however, it is not limited to this.
Brown paddy plant hopper is the primary pest of hazard rice production, in recent years since Biotypes of The Brown Planthopper Nilaparvata Lugens Stal morphs and it is anti-to generate The reasons such as pharmacological property, brown paddy plant hopper disaster are on the rise.Production practices prove, using resistant variety are most economical, safety and have The measure of effect.The seedling stage pest-resistant rank detection for having carried out many years to BG1222 according to " standard seed plate identification method ", finds it to brown Plant hopper, which has, stablizes resistance, and BG1222 is to bacterial leaf-blight also resistance with higher, therefore with higher in breeding Utility value.But the gene which BG1222 has crucial brown paddy plant hopper is associated with pest-resistant sex expression, so far there are no both at home and abroad Document is related to.
TN1 is the internationally recognized sense worm rice varieties without any anti insect gene.
The present invention is by having the research of the rice varieties BG1222 of stable resistance and sense worm rice varieties TN1 to brown paddy plant hopper Find brown planthopper resistant gene in rice BGIOSGA015836.Pest-resistant cultivar is compared with feeling worm kind, the gene of BGIOSGA015836 There are significant differences for expression quantity.In pest-resistant cultivar BG1222, the expression quantity of BGIOSGA015836 is than sense worm rice varieties TN1 High ten times of expression quantity or more.Regardless of whether being sucked by brown paddy plant hopper, the expression quantity of the BGIOSGA015836 in BG1222 is all remote Expression quantity higher than TN1.
By have stablize resistance rice varieties BG1222 with feel worm kind TN1 and hybridize F2The research of offspring is real It tests and shows that the expression quantity of BGIOSGA015836 and near-isogenic rice lines are positively correlated (expression quantity is higher, and insect resistace is stronger).F2Offspring Middle insect resistace is stronger, and resistance fractional value (Grade) is smaller, and the expression quantity of corresponding BGIOSGA015836 is higher.
There are significant differences for the gene expression amount of 1 pest-resistant cultivar of embodiment BGIOSGA015836 compared with feeling worm kind
One, paddy gene RNA is extracted
1) sample is divided into tissue and cell: cell is directly collected；Liquid nitrogen grinding tissue samples are added 500 μ l and contain 4% β- The CTAB extracting solution of mercaptoethanol, 65 degree of water-bath 30min；
2) isometric chloroform/isoamyl alcohol (24:1) then is added, 10,000g is centrifuged 10min after mixing；
3) isometric isopropanol is added, -20 degree place 1h, and 12,000g centrifugation 10min abandon supernatant；
4) 1000ul Trizol is added and precipitating is resuspended, 200 μ l chloroforms are then added, are shaken vigorously by hand for 15 seconds, room temperature Stand 5min；
5) at 4 DEG C, 10,000g centrifugation 3min, solution is divided into three layers, and RNA is dissolved in water phase, and transfer water phase is to another A new RNase free EP pipe；
6) 0.5 times of volume isopropanol is added, vortex mixes well；
7) at 4 DEG C, 12,000g centrifugation 10min, there is RNA precipitate in tube bottom after centrifugation, removes supernatant；
8) 75% ethyl alcohol of 1ml is added, is gently overturned with hand, 12,000g centrifugation 5min remove supernatant；
9) room temperature is dried or is dried in vacuo, and 60 μ l DEPC water dissolution precipitating is added.
Two, remove genome
Using the DNase I of RNase-free, by following system configurations reaction solution:
37 DEG C of digestion 30min, 65 DEG C of inactivation 10min.
Then it operates according to the following steps:
1) isometric phenol is added, 10,000rpm after mixing of turning upside down, is centrifuged 5min, takes supernatant；
2) isometric chloroform is added, 10,000rpm after mixing of turning upside down, is centrifuged 10min, takes supernatant；
3) isometric isopropanol is added, gently mixes well, -20 DEG C of standing 15min；
4) at 4 DEG C, 10,000g centrifugation 10min collect RNA precipitate, remove supernatant；
5) twice with 75% ethanol washing, super-clean bench air-dries；
6) 10 μ l DEPC water dissolution precipitating is added.
Three, purity detectings and electrophoresis detection
Purity detecting: 60 times of 2 μ l RNA sample dilutions are taken, in the triumphant Austria in the Beijing micro-spectrophotometer k2800() on measure OD value, OD260/OD280Ratio be greater than 1.8, illustrate preparation RNA it is purer, no protein contamination.
Four, reverse transcriptions
1) template ribonucleic acid, primer mixture, 12 μ l of total amount are added in PCR pipe.Reaction system is as follows:
Cool down 2min after 70 DEG C of heat preservation 10min on ice rapidly.
2) following reagent is added in the PCR pipe
By 42 DEG C of heat preservation 60min of above-mentioned 20 μ l reaction solution；72 DEG C of heat preservation 15mn；- 20 DEG C save backup.
Five, are quantitative
The analysis of the gene expression amount of BGIOSGA015836 is carried out using following primer pair, base sequence is as follows:
RE-f:CCAACAGCTCTGCGCTCATC(SEQ ID NO:6),
RE-r:ACTCCAGCCAAAAGAAACCCA(SEQ ID NO:7).
1) reaction system: cDNA dilutes 3 times
2) reaction condition: ViiA7 software is used
95℃ 30S；
95 DEG C of 3S, 60 DEG C of 34S(collect fluorescence signal)；45 circulations.
Melt curve analysis analysis: it -95 DEG C of temperature 60 C, reads 1 time per minute.
The result is shown in Figure 1.
Abscissa is the hourage that rice is sucked by brown paddy plant hopper in Fig. 1, and ordinate is the opposite table of BGIOSGA015836 Up to amount: being standardized as numerical value 1, other time and material with the expression quantity of the gene BGIOSGA015836 in 0 hour (h), TN1 Gene expression amount be all based on this, since the difference value of expression quantity has as many as tens times, thus by expression numerical quantity take with 10 Relative expression quantity is finally obtained for the logarithm at bottom.
In the case where being sucked as can be seen from Figure 1 by brown paddy plant hopper, plant by external irritant, BGIOSGA015836's Expression quantity can improve, and illustrate that both there is the gene composing type (not by environmental stimuli or to have expression poor in BG1222 and TN1 It is different) differential expression, it may have induction type (being caused differential expression by environmental stimuli) differential expression.In different time points, BGIOSGA015836 gene can all be significantly higher than the expression quantity of TN1 in the expression quantity of BG1222.
Fig. 1 is the result shows that the expression quantity of BGIOSGA015836 is than sense worm rice varieties TN1's in pest-resistant cultivar BG1222 High ten times of expression quantity or more.Regardless of whether being sucked by brown paddy plant hopper, the expression quantity of the BGIOSGA015836 in BG1222 is all remote high In the expression quantity of TN1.
The clone of the gene of 2 BGIOSGA015836 of embodiment and polypeptide analysis
The BGIOSGA015836 gene of pest-resistant cultivar BG1222 and sense worm kind TN1 are cloned respectively, divided Analysis.
The wherein BGIOSGA015836 gene in pest-resistant cultivar BG1222, nucleotide sequence such as SEQ ID NO:4 institute Show (including exon and introne), feels the BGIOSGA015836 gene in worm kind TN1, nucleotide sequence such as SEQ ID (including exon and introne) shown in NO:5.
Wherein in pest-resistant cultivar BG1222 the cDNA sequence of BGIOSGA015836 gene as shown in SEQ ID NO:2；And The cDNA sequence of BGIOSGA015836 gene in worm kind TN1 is felt as shown in SEQ ID NO:3.Above-mentioned cDNA has base at 5 It is different, but the polypeptide sequence for encoding obtained rice brown planthopper resistant is identical, amino acid sequence such as SEQ ID Shown in NO:1.
3 pest-resistant cultivar of embodiment carries out hybridizing F with sense worm kind2Generation
F is established with hybridizing for TN1 by BG12222Progeny population, wherein F2Sample n=512 of progeny population.Therefrom choose The individual detection of 60 different resistance fractional values, and to the F of different resistance rank phenotypes2Offspring individuals detect it respectively The expression quantity of BGIOSGA015836, to determine the expression quantity and the correlation of the pest-resistant phenotype of rice of BGIOSGA015836.
As a result see Fig. 2.
Fig. 2 the result shows that: hybridization F2The expression quantity and near-isogenic rice lines that offspring's verifying shows BGIOSGA015836 are at positive It closes (expression quantity is higher, and insect resistace is stronger).Insect resistace is stronger in offspring, and resistance fractional value is smaller, corresponding The expression quantity of BGIOSGA015836 is higher.Resistance fractional value (Grade) is divided into 0,1,3,5,7,9；Fractional value is smaller, and to represent it anti- Worm property is stronger.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.
<110>Inst. of Plant Protection, Guangdong Prov. Academy of Agricultural Sciences
<120>brown planthopper resistant gene in rice and its application
<130>
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 130
<212> PRT
<213>rice (Oryza.sativa L.)
<400> 1
Met Ala Gly Arg Pro Ser Ile Pro Thr Asn Ser Ser Ala Leu Ile Ala
1 5 10 15
Ile Ile Ala Asp Glu Asp Thr Val Thr Gly Phe Leu Leu Ala Gly Val
20 25 30
Gly Asn Val Asp Leu Arg Lys Lys Thr Asn Tyr Leu Ile Val Asp Asn
35 40 45
Lys Thr Thr Val Lys Gln Ile Glu Asp Ala Phe Lys Glu Phe Thr Thr
50 55 60
Arg Glu Asp Ile Ala Ile Val Leu Ile Ser Gln Tyr Val Ala Asn Met
65 70 75 80
Ile Arg Phe Leu Val Asp Ser Tyr Asn Arg Pro Val Pro Ala Ile Leu
85 90 95
Glu Ile Pro Ser Lys Asp His Pro Tyr Asp Pro Ala His Asp Ser Val
100 105 110
Leu Ser Arg Val Lys Tyr Leu Phe Ser Ala Glu Ser Val Ala Ser Asp
115 120 125
Arg Arg
130
<210> 2
<211> 393
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 2
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacag tgactgggtt tcttttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcc 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tctgctgaat cagtggcgtc agataggcga tga 393
<210> 3
<211> 393
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 3
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggacacgg tgactgggtt tttgttggct ggagttggca atgttgatct gaggaaaaag 120
acaaattatc ttattgttga taacaaaaca acagtcaaac aaattgaaga tgcgtttaag 180
gagttcacta caagggagga cattgcaatt gtactcatca gtcaatatgt tgcaaacatg 240
attagatttc ttgtggatag ctacaacaga ccggttcctg ctatattgga gattccatcg 300
aaggatcatc cttatgaccc agcacacgat tctgtccttt ctcgcgtgaa gtacctattt 360
tccgctgaat cagtggcgtc agataggcga tga 393
<210> 4
<211> 2779
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 4
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccaccca ccacctcctg ccctttccgc cttcctcttt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tcccctgtgt ttgcaggaca cagtgactgg gtttcttttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaac 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaattgcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca caaggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttgtaatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatccaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttctg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 5
<211> 2779
<212> DNA
<213>rice (Oryza.sativa L.)
<400> 5
atggcgggga ggcccagcat cccgaccaac agctctgcgc tcatcgccat catcgccgac 60
gaggtagtta cagccacccc ccacctcctc ccctttccgc cttgctcgtt gcctttgctt 120
ggattggctg attgtgccgc ctctaccgct gctcttttgc tacatctagt agttaccggt 180
gttctaacat gctcttgttg attgaggata aatacccaat tatgtcataa gcctactgat 240
gattcagcga attgtgttct aacatgctct tgttatttgc ttttatttgt tcgtttttat 300
ctttccgcga tgtttgcttt cttatttgaa ctacactcat gtggagtgct agtttgtaat 360
aatgggctgt agctccactt gagcaaaggc cgggatgtta tattccatta tctaaaaaaa 420
tgctcttgtt gattgaggat acatacccaa ttttgttaag cctactgatg atccagctaa 480
ttgtagtaat gcctgagtcc ggctcagtgt gttttctttt acctgtgtac ctgactgtca 540
tttttcatcc atcccaccca taccaatata aaataaaaga gagtataata cctccacttt 600
atcaaatcca atcaaatatt catctcttga tttactccca atgtatccac tacttttaca 660
aactctgatg taatgcttgc ttaaaaatga acttattttg ggacaaacgg gggagagaca 720
aaaatgacct tatcatggga tggaaggagt aattaggtag ctacaaacca gtgccttctg 780
ttacatgttt gtgatgagga aaactgtttt caacatcaga tttgcgcata atcattctgt 840
ggtttctaaa ctctttgcca aatatgaatt tacggcttgt caaattgctc atgattaata 900
attttggtgg catttgctag cttattgaat ttgagtaaca tgtaaggttt caagcaggaa 960
acaaatataa aaatgtaatg ctattacata ctgtttggta agagcttgct gatgccaaat 1020
acgaggaatg aaagttagct gatgctcaag aaaaattaca tcaaggaccc ttcacaattt 1080
cattctcgct tgcttaaaat atactcctga tgggttaagt caaggtagca aacagtagta 1140
gctaaccagc ataatttgat gagaactgga tgactaaact gaatcctctt aattaacaac 1200
gggcataaaa cctcatacta tctttatcaa tataaaacat atgtaactct ctctaagtgt 1260
ttccaggttc cccagtaatt tagccatgat tggagtatct gacaggagtg ttttgtttcc 1320
tgccctgtgt ttgcaggaca cggtgactgg gtttttgttg gctggagttg gcaatgttga 1380
tctgaggaaa aagacaaatt atcttattgt tgataacagt aataactttc acttgctaat 1440
atgcttaatt tctctatcaa tatcttgctg tttgttttgt cctgatttct gcctcttaca 1500
atagggacat tgcatgatat cctgttgatc atctcatgtg cacaagtcat attatcttta 1560
cccatttaca tgttccatta cctgactgcc aaatcctttc ttctaacttg atagctacaa 1620
atcagtgcct tcttcatgat aagacctaat ttgttgagtt ctgccaattt ttttactata 1680
atgctgcata tgctcattga atcccaaggc ttattttggt agggggtgtt caatcttctt 1740
gaatggttgt attaatcttg ataatttcct gcttaataga gttattgaca tgttccgtat 1800
ttccacttgg tagctggcat attatttgaa ataaaataag aaagtggatc tcacccagtc 1860
acatgtcaga gacaattaat ttcttcatta ttgtaggacg tgaatttcat ccctgagctt 1920
atggtttcat ctttatgtta cccttatgca ttttattatg ttagcagact tcctaatgct 1980
ttagtagtcc atagacttca cacggctgaa ttttactctg acatgttaca gaaacaacag 2040
tcaaacaaat tgaagatgcg tttaaggagt tcactacaag ggaggacatt gcaattgtac 2100
tcatcagtca atatgtaagt agctttcttt gtttatataa tgaagtgata actgatcagc 2160
ttgtcactaa gtatcctggc ctcagaaagt cacaatgatt ggaaacaaaa ctattcaatt 2220
ctaaattaag tcagcttgtc actaagtttc ctggcctcag aaagttagtg actggaaaca 2280
aaactgtttc aattctaaac tatttccgct tgtcactaag tctcctggcc atagtcagcc 2340
ttgtttcttt ggagcgctct cctgagtttt caaaatggca tgtcccaggg gcatatgatc 2400
aatgaatttc aatacaaaaa cccatcaaaa tgatgtgaat tttttttaat tcttatgtga 2460
tttatctacc aatttactgg cctaaggttc ctgcagcttt gcattataca tttataatag 2520
ctgaaatcgt taacaaatta tgtgcagtct aaaatggttc ttcgtgttcg acacaatcac 2580
acaacctgat ggttttctat ttttcatttg gcaggttgca aacatgatta gatttcttgt 2640
ggatagctac aacagaccgg ttcctgctat attggagatt ccatcgaagg atcatcctta 2700
tgacccagca cacgattctg tcctttctcg cgtgaagtac ctattttccg ctgaatcagt 2760
ggcgtcagat aggcgatga 2779
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
ccaacagctc tgcgctcatc 20
<210> 7
<211> 21
<212> DNA
<213>artificial sequence
<400> 7
actccagcca aaagaaaccc a 21

Claims (3)

1. application of the gene BGIOSGA015836 in rice breeding；The ammonia of the gene BGIOSGA015836 coding albumen Base acid sequence is as shown in SEQ ID NO:1.
2. gene BGIOSGA015836 is improving the application in Rice Resistance Brown Planthopper Resistance；The gene BGIOSGA015836 The amino acid sequence of albumen is encoded as shown in SEQ ID NO:1.
3. a kind of method for improving rice brown planthopper resistant performance, it is characterised in that: pass through molecular breeding method or genetic engineering Method improves the expression quantity of BGIOSGA015836 gene described in claim 1 to improve rice brown planthopper resistant character.
CN201610289474.1A 2016-05-03 2016-05-03 Brown planthopper resistant gene in rice and its application Active CN105820222B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610289474.1A CN105820222B (en) 2016-05-03 2016-05-03 Brown planthopper resistant gene in rice and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610289474.1A CN105820222B (en) 2016-05-03 2016-05-03 Brown planthopper resistant gene in rice and its application

Publications (2)

Publication Number Publication Date
CN105820222A CN105820222A (en) 2016-08-03
CN105820222B true CN105820222B (en) 2019-05-07

Family

ID=56528112

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610289474.1A Active CN105820222B (en) 2016-05-03 2016-05-03 Brown planthopper resistant gene in rice and its application

Country Status (1)

Country Link
CN (1) CN105820222B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107034223B (en) * 2017-05-08 2019-11-29 广东省农业科学院植物保护研究所 The anti-plant hopper gene BGIOSGA015651 of adjusting and controlling rice and its application
CN113699179B (en) * 2021-07-30 2022-04-05 广东省农业科学院植物保护研究所 Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101463354A (en) * 2009-01-06 2009-06-24 武汉大学 Brown planthopper resistant gene in rice and use thereof
CN102296108A (en) * 2011-10-12 2011-12-28 湖北省农业科学院粮食作物研究所 Method for screening brown planthopper resistant rice, and special primers thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101463354A (en) * 2009-01-06 2009-06-24 武汉大学 Brown planthopper resistant gene in rice and use thereof
CN102296108A (en) * 2011-10-12 2011-12-28 湖北省农业科学院粮食作物研究所 Method for screening brown planthopper resistant rice, and special primers thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PREDICTED: V-type proton ATPase subunit F [Oryza brachyantha];无;《Genbank Database》;20160304;全文 *

Also Published As

Publication number Publication date
CN105820222A (en) 2016-08-03

Similar Documents

Publication Publication Date Title
CN107034223B (en) The anti-plant hopper gene BGIOSGA015651 of adjusting and controlling rice and its application
CN109321582A (en) Application of the aegilops tauschii Yr4DS gene in the plant stripe rust resisting breeding of wheat race
Rieseberg et al. Androdioecy is derived from dioecy in Datiscaceae: evidence from restriction site mapping of PCR-amplified chloroplast DNA fragments
CN105274120B (en) N &#39; au the genes and its cloning process of a kind of resisting tobacco mosaic virus and application
CN108603198A (en) Manipulate the composition and method of development of plants
CN105985965A (en) Gene GW7 for controlling grain shape, exterior quality and yield of rice and applications of gene GW7
CN105820222B (en) Brown planthopper resistant gene in rice and its application
CN104404054B (en) Corn anti-head-smut related gene ZmNL clone identification and its purposes in anti-head-smut corn breeding
Shi et al. A conserved hypothetical gene is required but not sufficient for Ptr ToxC production in Pyrenophora tritici-repentis
AU2014211518A1 (en) Solanum lycopersicum plants having pink fruits
CN104531718B (en) Apple V-ATPase subunit genes MdVHA-B1S396A and its degeneration-resistant application
CN101591384A (en) A kind of plant fungal disease resistance correlative protein and encoding gene thereof and application
CN110331223B (en) Molecular marker, primer pair, kit and method for identifying different cane shoots types
Peng et al. Frequencies and variations of Magnaporthe oryzae avirulence genes in Hunan Province, China
CN110004155A (en) Control disease-resistant gene, protein and its application of plant phobotaxis aphid resistance shape
CN109825604A (en) With the molecular labeling of peach aphid resistance shape close linkage, for detecting the primer, kit, method and its application of peach aphid resistance shape
CN103060336B (en) Rice blast resisting gene Pi-y43 (t) and SSR (simple sequence repeat) markers relative to gene Pi-y43 (t)
CN101144083A (en) Descurainiasophia DsCBF gene, preparation method and application thereof
CN112813180B (en) Molecular marker and primer pair for identifying cabbage leaf wax powder character and application thereof
CN105950722B (en) One kind SNP site relevant to rice brown planthopper resistant and application
CN109706154A (en) CsPR3 gene and its application in cucumber anti-blight
Salazar-Mesta et al. Characterization, pathogenicity, and reproduction of Meloidogyne enterolobii populations parasitizing vegetables in Sinaloa, Mexico
CN107075500A (en) The method and material of fruit size can be changed
CN100529078C (en) Protein coding sequence for controlling rice tapetum degradation
CN101250532B (en) Butterfly orchid PhAGCu gene coded sequence and uses thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant