CN105950649B - A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application - Google Patents
A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application Download PDFInfo
- Publication number
- CN105950649B CN105950649B CN201610351632.1A CN201610351632A CN105950649B CN 105950649 B CN105950649 B CN 105950649B CN 201610351632 A CN201610351632 A CN 201610351632A CN 105950649 B CN105950649 B CN 105950649B
- Authority
- CN
- China
- Prior art keywords
- spt15
- py16tef1
- recombinant plasmid
- saccharomyces cerevisiae
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/102—Plasmid DNA for yeast
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to gene engineering technology fields, more particularly, to a kind of recombinant plasmid pY16TEF1- that Ethanol in Saccharomyces cerevisiae yield can be improved△SPT15-125 and its application.A kind of △ SPT15-125 in the present invention recombinant plasmid pY16TEF1- △ SPT15-125, the recombinant plasmid pY16TEF1- △ SPT15-125 isSPT15Gene obtains after mutation, and △ SPT15-125 base sequence is SEQ ID No.2, and the amino acid sequence of the transcription factor spt15p translated is SEQ ID No.3；The base to mutate in the sequence SEQ ID No.2 is respectively 39a > g, 128 a > g, 156a > g, 163a > g, 247a > g, 653a > g；The amino acid to mutate in the sequence SEQ ID No.3 is respectively Glu43Gly, Lys55Glu, Lys83 Glu, Lys218Arg；The carrying recombinant plasmid pY16TEF1-△The saccharomyces cerevisiae of SPT15-125 is improving the application in alcohol yied.Ethanol in Saccharomyces cerevisiae yield can be improved in the present invention.
Description
One, technical field:
The present invention relates to gene engineering technology fields, more particularly, to a kind of recombination that Ethanol in Saccharomyces cerevisiae yield can be improved
Plasmid pY16TEF1- △ SPT15-125 and its application.
Two, background technique:
The fermentation process of grape wine is not only closely bound up with grape material, and saccharomyces cerevisiae used in fermentation also has very high point
System.Grape berry lower for sugar content needs by way of artificial sugaring when fermentation, can ferment to obtain target wine
The product of degree.Therefore, it is to reduce Production of Wine cost that a kind of high-yield ethanol saccharomyces cerevisiae is cultivated in screening, improves grape wine enterprise
The important method of industry economic benefit.This high-yield ethanol saccharomyces cerevisiae, will have higher alcohol yied.
Saccharomyces cerevisiae with high ethano yield is not only advantageous for wine industry, while also having to ethanol production industry
Important function.
The production method of ethyl alcohol includes chemical synthesis and microbe fermentation method.The former with petroleum cracking generate ethylene with
Water synthesizing alcohol, increasingly depleted with petroleum resources, this synthetic method of ethyl alcohol is also restrained.Microbial fermentation production
Ethyl alcohol has the advantages that environmentally protective using renewable resource as fermentation substrate, and produces the most important side of alcohol fuel
Formula is exactly to carry out biofermentation using saccharomyces cerevisiae, compared to other methods, it is advantageous that yield is high, easily culture, ethyl alcohol is resistance to
By the strong feature of property.About eighty per cant or more alcohol fuel produces by means of which at present.For producing fuel
The mainly starchy material of ethyl alcohol, under biological enzyme formulation effect, starchy material is broken down into what saccharomycete can utilize
Fermentable sugars.Under present circumstances, alcohol fermentation is carried out using traditional handicraft, sugared concentration about 23% (w/v), final ethyl alcohol is dense
Degree is about 11%~12% (v/v), and production cost is higher, and quite a few cost is used for energy consumption.Therefore, breeding high-yield
Ethyl alcohol saccharomyces cerevisiae improves the utilization rate and conversion ratio of sugar, becomes raising alcohol fuel fermentation industry efficiency, reduction is produced into
This key.
The screening high yield saccharomyces cerevisiae of significance due to to(for) new energy and wine production new paragon, many scientific research works
Author is successively conceived to this technology, and more commonly used screening mode has directly from nature separation, continuous culture method, mutagenesis
Method, protoplast fusion method, heat-shock treatment method and genetic engineering breeding etc..The directly big, sieve from nature mask work amount
Low efficiency is selected, mutation breeding may generate adverse effect to a certain extent, protoplast fusion and gene work to target shape
Journey breeding etc. solves these problems to a certain extent, improves screening efficiency.
Three, summary of the invention:
The present invention provides a kind of recombinant plasmid pY16TEF1- △ to solve the shortcoming in above-mentioned background technique
Ethanol in Saccharomyces cerevisiae yield can be improved in SPT15-125 and its application.
To achieve the above object, a kind of the technical solution adopted by the present invention are as follows: recombinant plasmid pY16TEF1- △ SPT15-
125, it is characterised in that: the △ SPT15-125 in the recombinant plasmid pY16TEF1- △ SPT15-125 is SPT15 gene warp
It is obtained after crossing mutation, △ SPT15-125 base sequence is SEQ ID No.2, the amino of the transcription factor spt15p translated
Acid sequence is SEQ ID No.3.
The base to mutate in the sequence SEQ ID No.2 is respectively 39a > g, 128a > g, and 156a > g, 163a >
g,247a>g,653a>g；
The amino acid to mutate in the sequence SEQ ID No.3 is respectively Glu43Gly, Lys55Glu,
Lys83Glu,Lys218Arg。
The saccharomyces cerevisiae of the carrying recombinant plasmid pY16TEF1- △ SPT15-125 is improving answering in alcohol yied
With.
Compared with prior art, the present invention has the advantage that as follows with effect: Ethanol in Saccharomyces cerevisiae production can be improved in the present invention
Rate.
Four, Detailed description of the invention:
Fig. 1 is SPT15 gene PCR amplification electrophoretogram (M:DL2,000DNA Marker, swimming lane 1:SPT15)；
Fig. 2 is SPT15PCR product and SPT15 gene order comparison result；
Fig. 3 is plasmid pY16TEF1 restriction enzyme digestion and electrophoresis figure (III digest Marker of M: λ-Hind, swimming lane 1: plasmid
pY16TEF1)；
Five: specific embodiment:
Next in the following with reference to the drawings and specific embodiments the present invention will be further explained, but does not limit this hair with this
It is bright.
In a kind of recombinant plasmid pY16TEF1- △ SPT15-125, the recombinant plasmid pY16TEF1- △ SPT15-125
△ SPT15-125 to be SPT15 gene obtain after mutation, △ SPT15-125 base sequence is SEQ ID No.2, institute
The amino acid sequence of the transcription factor spt15p of translation is SEQ ID No.3.
The base to mutate in the sequence SEQ ID No.2 is respectively 39a > g, 128a > g, and 156a > g, 163a >
g,247a>g,653a>g；
The amino acid to mutate in the sequence SEQ ID No.3 is respectively Glu43Gly, Lys55Glu,
Lys83Glu,Lys218Arg。
The saccharomyces cerevisiae of the carrying recombinant plasmid pY16TEF1- △ SPT15-125 is improving answering in alcohol yied
With.
The construction method of the saccharomyces cerevisiae engineered yeast for carrying plasmid pY16TEF1- △ SPT15-125 of the invention, be by
PY16TEF1- △ SPT15-125 plasmid is imported in saccharomyces cerevisiae and is obtained.
It is electroporated method or lithium chloride conversion method by the method for plasmid transformed saccharomyces cerevisiae.
Sequence table
SEQIDNo.1
atggccgatgaggaacgtttaaaggagtttaaagaggcaaacaagatagtgtttgatccaaataccag
acaagtatgggaa
aaccagaatcgagatggtacaaaaccagcaactactttccagagtgaagaggacataaaaagagctgc
cccagaatctg
aaaaagacacctccgccacatcaggtattgttccaacactacaaaacattgtggcaactgtgactttg
gggtgcaggttaga
tctgaaaacagttgcgctacatgcccgtaatgcagaatataaccccaagcgttttgctgctgtcatca
tgcgtattagagagc
caaaaactacagctttaatttttgcctcagggaaaatggttgttaccggtgcaaaaagtgaggatgac
tcaaagctggccag
tagaaaatatgcaagaattatccaaaaaatcgggtttgctgctaaattcacagacttcaaaatacaaa
atattgtcggttcgtgt
gacgttaaattccctatacgtctagaagggttagcattcagtcatggtactttctcctcctatgagcc
agaattgtttcctggttt
gatctatagaatggtgaagccgaaaattgtgttgttaatttttgtttcaggaaagattgttcttactg
gtgcaaagcaaagggaa
gaaatttaccaagcttttgaagctatataccctgtgctaagtgaatttagaaaaatgtga
SEQIDNo.2
Spt15-125 gene nucleotide series
atggccgatgaggaacgtttaaaggagtttaaagaggcgaacaagatagtgtttgatccaaataccag
acaagtatggga
aaaccagaatcgagatggtacaaaaccagcaactactttccagagtggagaggacataaaaagagctg
ccccagagtct
gaagaagacacctccgccacatcaggtattgttccaacactacaaaacattgtggcaactgtgacttt
ggggtgcaggttag
atctggaaacagttgcgctacatgcccgtaatgcagaatataaccccaagcgttttgctgctgtcatc
atgcgtattagagag
ccaaaaactacagctttaatttttgcctcagggaaaatggttgttaccggtgcaaaaagtgaggatga
ctcaaagctggcca
gtagaaaatatgcaagaattatccaaaaaatcgggtttgctgctaaattcacagacttcaaaatacaa
aatattgtcggttcgt
gtgacgttaaattccctatacgtctagaagggttagcattcagtcatggtactttctcctcctatgag
ccagaattgtttcctggt
ttgatctatagaatggtgaagccgaaaattgtgttgttaatttttgtttcaggaaagattgttcttac
tggtgcaaggcaaaggg
aagaaatttaccaagcttttgaagctatataccctgtgctaagtgaatttagaaaaatgtga
SEQ ID No.3
Met Ala Asp Glu Glu Arg Leu Lys Glu Phe Lys Glu Ala Asn Lys Ile Val
Phe Asp Pro
Asn Thr Arg Gln Val Trp Glu Asn Gln Asn Arg Asp Gly Thr Lys Pro Ala
Thr Thr Phe
Gln Ser Gly Glu Asp Ile Lys Arg Ala Ala Pro Glu Ser Glu Glu Asp Thr
Ser Ala Thr
Ser Gly Ile Val Pro Thr Leu Gln Asn Ile Val Ala Thr Val Thr Leu Gly
Cys Arg Leu
Asp Leu Glu Thr Val Ala Leu His Ala Arg Asn Ala Glu Tyr Asn Pro Lys
Arg Phe Ala
Ala Val Ile Met Arg Ile Arg Glu Pro Lys Thr Thr Ala Leu Ile Phe Ala
Ser Gly Lys Met
Val Val Thr Gly Ala Lys Ser Glu Asp Asp Ser Lys Leu Ala Ser Arg Lys
Tyr Ala Arg
Ile Ile Gln Lys Ile Gly Phe Ala Ala Lys Phe Thr Asp Phe Lys Ile Gln
Asn Ile Val Gly
Ser Cys Asp Val Lys Phe Pro Ile Arg Leu Glu Gly Leu Ala Phe Ser His
Gly Thr Phe
Ser Ser Tyr Glu Pro Glu Leu Phe Pro Gly Leu Ile Tyr Arg Met Val Lys
Pro Lys Ile Val
Leu Leu Ile Phe Val Ser Gly Lys Ile Val Leu Thr Gly Ala Arg Gln Arg
Glu Glu Ile Tyr
Gln Ala Phe Glu Ala Ile Tyr Pro Val Leu Ser Glu Phe Arg Lys Met
Method as used in the following examples is International Standards Method in the art unless otherwise specified, with reference to " point
Sub- cloning experimentation guide " specific method described in (fourth edition) Joe Sambrook book carries out.
The building of 1 Saccharomyces Cerevisiae in S PT15 gene mutation library of case study on implementation
1) saccharomyces cerevisiae YS59 total DNA is extracted as template using DNA extraction kit, design upstream and downstream primer
CTG459F/R carries out PCR amplification, primer to SPT15 gene are as follows:
Upstream primer nucleotide sequence are as follows:
5'-TAGAACTAGTGGATCCATGGCCGATGAGGAACGTTTAAAG-3'；
Downstream primer nucleotide sequence are as follows:
5’-GCTTGATATCGAATTCTCACATTTTTCTAAATTCACTTAGCACAG-3’
PCR amplification obtains 723 bp of the area SPT15 gene C DS identical with document report, and reaction system is 50 μ L reactants
System, is made of following ingredients:
PCR reaction condition is as follows: 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, totally 30 circulations, then 72
DEG C extend 10min, 12 DEG C heat preservation.
It takes 5 μ L pcr amplification products to carry out agarose gel electrophoresis, there is a clear band (figure at 750bp as the result is shown
1)。
In order to verify whether above-mentioned pcr amplification product is SPT15 gene, and whether have occurred in amplification procedure prominent
Become, therefore PCR product is sequenced, there is no base mutations in amplification procedure as the result is shown.
2) the SPT15 gene that amplification obtains is connected with by the pY16TEF1 plasmid of BamH I and EcoR I double digestion
It connects, construction recombination plasmid pY16TEF1-SPT15, plasmid pY16TEF1 double enzyme digestion reaction system is as follows:
It is reacted 4 hours under the conditions of 37 DEG C.
The reaction system that plasmid pY16TEF1 after digestion is connect with the SPT15 gene after amplification is as follows:
It is reacted 15 minutes under the conditions of 50 DEG C.
Connection product is converted into e. coli jm109, to expand recombinant plasmid pY16TEF1-SPT15.Recombination is carried out
PCR, primer are as follows:
Upstream primer nucleotide sequence are as follows: 5 '-ATAGGGACCTAGACTTCAGG-3 '；
Downstream primer nucleotide sequence are as follows: 5 '-GACCTCCCATTGATATTTAAG-3 '
Reaction system is as follows:
PCR reaction condition is as follows: 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, totally 30 circulations, then 72
DEG C extend 10min, 12 DEG C heat preservation.
PY16TEF1-SPT15PCR product is sequenced, sequencing result shows that the connection of SPT15 gene is correct, plasmid structure
Build up function.
3) as follows to the reaction system of SPT15 gene progress fallibility PCR in pY16TEF1-SPT15:
Reaction condition: 94 DEG C of initial denaturations 30s, 94 DEG C of denaturation 30s, 68 DEG C of annealing 1min, totally 25 circulations, then 68 DEG C of extensions
1min, 12 DEG C of heat preservations.
5 μ L PCR products are taken to carry out agarose gel electrophoresis, as a result as shown in Figure 2.
△ SPT15 and plasmid pY16TEF1 after mutation is subjected to digestion according to the method in 2), connect, obtains recombinating matter
Grain pY16TEF1- △ SPT15.Connection product is converted into e. coli jm109, to expand recombinant plasmid pY16TEF1- △
SPT15.5 μ L are taken to carry out agarose gel electrophoresis (Fig. 3) without with the plasmid pY16TEF1- △ SPT15 Jing Guo digestion respectively.
By Fig. 3 electrophoresis result it is inferred that △ SPT15 is successfully connected to pY16TEF1.
By the recombinant plasmid pY16TEF1- △ SPT15 thermal transition after 2.5 μ L mutation into E.coli JM109, coating is flat
Plate, 37 DEG C are incubated overnight.20 E.coli JM109 positive bacterium colonies are selected, plasmid is extracted and are sequenced.It is soft using Vector NTI
Sequencing gained sequence is compared in part, and sequence alignment result shows that random mutation, mutational site have occurred for SPT15 gene
Number is differed at 2~10, and mutational site is without Preference.
Therefore, it is possible to judge that SPT15 gene mutation library constructs successfully.
S.cerevisiae YS59 is this research department's preservation, the purchase of E.coli JM109 competent cell in the implementation case
In Dalian treasured biotech firm, plasmid pY16TEF1 is purchased from NTCC Type Tissue Collection-BioVector plasmid vector bacterial strain
Cytogene collection.The synthesis of primer involved in the implementation case and gene sequencing are complete by Shanghai Sheng Gong biotech company
At.DNA extraction kit involved in the implementation case, plasmid extraction kit, plastic recovery kit, the examination of yeast rapid conversion
Agent box is purchased from Omega biotech company, the U.S..
LB culture medium in the implementation case: peptone 1%, yeast extract 0.5%, NaCl 0.5%, agar 1.5%, ammonia
Parasiticin 0.1%, pH7.4.YPD culture medium: yeast extract 1%, glucose 2%, peptone 2%, pH are natural.SD-Ura training
Support base: glucose 20g/L, YNB6.7g/L, Ura do supplement0.77g/L, pH6.8.
The screening of 2 high-yield ethanol saccharomyces cerevisiae engineered yeast strain of case study on implementation
1) it by SPT15 random mutation plasmid library pY16TEF1- △ SPT15, is transformed into saccharomyces cerevisiae YS59.It will conversion
Liquid is uniformly coated on SD-Ura solid medium, 30 DEG C of culture 96h or so, transformant is obtained, by all transformant liquid
After SD-Ura culture media shaking vase culture, culture presevation is carried out, obtains S.cerevisia YS59-pY16TEF1- △ SPT15 mutation
Library；
2) after the S.cerevisia YS59-pY16TEF1- △ SPT15 mutated library bacterial strain of acquisition being activated for 24 hours respectively,
It is inoculated in SD-Ura fluid nutrient medium, is left to ferment under the conditions of 25 DEG C.It is surveyed after fermentation using SBA bio-sensing analyzer
The indexs such as ethanol content are measured, are obtained compared with S.cerevisiae YS59, ethyl alcohol synthetic ratio improves 16.6% bacterial strain
S.cerevisiae pY16TEF1-△SPT15-125；
3) method in case study on implementation 1 (2) to pY16TEF1-SPT15PCR is utilized, to S.cerevisiae
PY16TEF1- △ SPT15-125 carries out PCR amplification, and is sequenced, with SPT15 gene base sequence (the SEQ ID before mutation
No.1 it) compares, △ SPT15 has 6 base mutations in pY16TEF1- △ SPT15-125 (SEQ ID No.2, overstriking are shown).
SD-Ura fluid nutrient medium in the implementation case are as follows: glucose 20g/L, YNB6.7g/L, Ura do
Supplement 0.77g, pH6.8.
Case study on implementation 3S.cerevisiae pY16TEF1- △ SPT15-125 is applied in simulation grape juice
After the S.cerevisia pY16TEF1- △ SPT15-125 bacterial strain activation for 24 hours of acquisition, connect according to 1% (V/V)
Kind amount is inoculated in 800mL simulation grape juice (volume of fermentation vessel 1L), is left to ferment under the conditions of 25 DEG C to Can Tang≤2g/
L.The indexs such as its residual sugar and ethanol content, acquisition and control strain are measured using SBA bio-sensing analyzer after fermentation
S.cerevisiae YS59 is compared, and ethyl alcohol synthetic ratio improves 16%, is shown in Table 1.
Simulation grape juice in the implementation case are as follows: 95% ethyl alcohol of ergo stock:12.5mL Tween80,37.5mL,
0.125g ergosterol；Solution A: in 375mL deionized water plus 100g glucose, 100g fructose, 4mL ergo stock dissolve
Deionized water adds to 500mL afterwards；Solution B: add 6g L (+) tartaric acid, 3g L (-) malic acid, 0.5g in 250mL deionized water
Citric acid；Solution C: 1.7g YNB (no amino yeast nitrogen) in 250mL deionized water, 2g caseinhydrolysate, 6mg inositol,
0.2g anhydrous calcium chloride, 0.8g L-arginine, 1g L-PROLINE, 0.1g tryptophan, 1g ammonium phosphate；Mixed liquor: A, B, C are mixed
Afterwards, with potassium hydroxide tune pH to 3.25, filtration sterilization is ready-to-use.
The fermentation character of the simulation grape juice of 1 high-yield ethanol Wine brewing yeast strain of table
SEQUENCE LISTING
<110>Xibei Univ. of Agricultural & Forest Science & Technology
<120>it a kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its answers
With
<130> 1
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 723
<212> DNA
<213>saccharomyces cerevisiae YS59
<400> 1
atggccgatg aggaacgttt aaaggagttt aaagaggcaa acaagatagt gtttgatcca 60
aataccagac aagtatggga aaaccagaat cgagatggta caaaaccagc aactactttc 120
cagagtgaag aggacataaa aagagctgcc ccagaatctg aaaaagacac ctccgccaca 180
tcaggtattg ttccaacact acaaaacatt gtggcaactg tgactttggg gtgcaggtta 240
gatctgaaaa cagttgcgct acatgcccgt aatgcagaat ataaccccaa gcgttttgct 300
gctgtcatca tgcgtattag agagccaaaa actacagctt taatttttgc ctcagggaaa 360
atggttgtta ccggtgcaaa aagtgaggat gactcaaagc tggccagtag aaaatatgca 420
agaattatcc aaaaaatcgg gtttgctgct aaattcacag acttcaaaat acaaaatatt 480
gtcggttcgt gtgacgttaa attccctata cgtctagaag ggttagcatt cagtcatggt 540
actttctcct cctatgagcc agaattgttt cctggtttga tctatagaat ggtgaagccg 600
aaaattgtgt tgttaatttt tgtttcagga aagattgttc ttactggtgc aaagcaaagg 660
gaagaaattt accaagcttt tgaagctata taccctgtgc taagtgaatt tagaaaaatg 720
tga 723
<210> 2
<211> 723
<212> DNA
<213>saccharomyces cerevisiae YS59
<400> 2
atggccgatg aggaacgttt aaaggagttt aaagaggcga acaagatagt gtttgatcca 60
aataccagac aagtatggga aaaccagaat cgagatggta caaaaccagc aactactttc 120
cagagtggag aggacataaa aagagctgcc ccagagtctg aagaagacac ctccgccaca 180
tcaggtattg ttccaacact acaaaacatt gtggcaactg tgactttggg gtgcaggtta 240
gatctggaaa cagttgcgct acatgcccgt aatgcagaat ataaccccaa gcgttttgct 300
gctgtcatca tgcgtattag agagccaaaa actacagctt taatttttgc ctcagggaaa 360
atggttgtta ccggtgcaaa aagtgaggat gactcaaagc tggccagtag aaaatatgca 420
agaattatcc aaaaaatcgg gtttgctgct aaattcacag acttcaaaat acaaaatatt 480
gtcggttcgt gtgacgttaa attccctata cgtctagaag ggttagcatt cagtcatggt 540
actttctcct cctatgagcc agaattgttt cctggtttga tctatagaat ggtgaagccg 600
aaaattgtgt tgttaatttt tgtttcagga aagattgttc ttactggtgc aaggcaaagg 660
gaagaaattt accaagcttt tgaagctata taccctgtgc taagtgaatt tagaaaaatg 720
tga 723
<210> 3
<211> 240
<212> Protein
<213>saccharomyces cerevisiae YS59
Met Ala Asp Glu Glu Arg Leu Lys Glu Phe Lys Glu Ala Asn Lys 15
Ile Val Phe Asp Pro Asn Thr Arg Gln Val Trp Glu Asn Gln Asn 30
Arg Asp Gly Thr Lys Pro Ala Thr Thr Phe Gln Ser Gly Glu Asp 45
Ile Lys Arg Ala Ala Pro Glu Ser Glu Glu Asp Thr Ser Ala Thr 60
Ser Gly Ile Val Pro Thr Leu Gln Asn Ile Val Ala Thr Val Thr 75
Leu Gly Cys Arg Leu Asp Leu Glu Thr Val Ala Leu His Ala Arg 90
Asn Ala Glu Tyr Asn Pro Lys Arg Phe Ala Ala Val Ile Met Arg 105
Ile Arg Glu Pro Lys Thr Thr Ala Leu Ile Phe Ala Ser Gly Lys 120
Met Val Val Thr Gly Ala Lys Ser Glu Asp Asp Ser Lys Leu Ala 135
Ser Arg Lys Tyr Ala Arg Ile Ile Gln Lys Ile Gly Phe Ala Ala 150
Lys Phe Thr Asp Phe Lys Ile Gln Asn Ile Val Gly Ser Cys Asp 165
Val Lys Phe Pro Ile Arg Leu Glu Gly Leu Ala Phe Ser His Gly 180
Thr Phe Ser Ser Tyr Glu Pro Glu Leu Phe Pro Gly Leu Ile Tyr 195
Arg Met Val Lys Pro Lys Ile Val Leu Leu Ile Phe Val Ser Gly 210
Lys Ile Val Leu Thr Gly Ala Arg Gln Arg Glu Glu Ile Tyr Gln 225
Ala Phe Glu Ala Ile Tyr Pro Val Leu Ser Glu Phe Arg Lys Met 240
Claims (3)
1. a kind of recombinant plasmid pY16TEF1- △ SPT15-125, it is characterised in that: the recombinant plasmid pY16TEF1- △
△ SPT15-125 in SPT15-125 is that SPT15 gene obtains after mutation, and △ SPT15-125 base sequence is SEQ ID
The amino acid sequence of No.2, the transcription factor spt15p translated are SEQ ID No.3.
2. a kind of recombinant plasmid pY16TEF1- △ SPT15-125 according to claim 1, it is characterised in that: the sequence
The base to mutate in column SEQ ID No.2 is respectively 39a > g, 128a > g, 156a > g, 163a > g, 247a > g, 653a > g；
The amino acid to mutate in the sequence SEQ ID No.3 is respectively Glu43Gly, Lys55Glu, Lys83Glu,
Lys218Arg。
3. recombinant plasmid pY16TEF1- △ SPT15-125 as described in claim 1 is improving recombinant Saccharomyces cerevisiae alcohol yied
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610351632.1A CN105950649B (en) | 2016-05-25 | 2016-05-25 | A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610351632.1A CN105950649B (en) | 2016-05-25 | 2016-05-25 | A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950649A CN105950649A (en) | 2016-09-21 |
| CN105950649B true CN105950649B (en) | 2019-07-09 |
Family
ID=56909788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610351632.1A Expired - Fee Related CN105950649B (en) | 2016-05-25 | 2016-05-25 | A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950649B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110628804B (en) * | 2019-06-24 | 2021-04-13 | 河北工业大学 | Method for constructing saccharomyces cerevisiae strain with high tolerance to isobutanol |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008133665A2 (en) * | 2006-12-07 | 2008-11-06 | Massachusetts Institute Of Technology | Global transcription machinery engineering |
| CN103820346A (en) * | 2014-03-12 | 2014-05-28 | 南京工业大学 | Brew yeast and application of brew yeast to manufacturing alcohol through fermentation |
-
2016
- 2016-05-25 CN CN201610351632.1A patent/CN105950649B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008133665A2 (en) * | 2006-12-07 | 2008-11-06 | Massachusetts Institute Of Technology | Global transcription machinery engineering |
| CN103820346A (en) * | 2014-03-12 | 2014-05-28 | 南京工业大学 | Brew yeast and application of brew yeast to manufacturing alcohol through fermentation |
Non-Patent Citations (4)
| Title |
|---|
| Construction of Saccharomyces cerevisiae Strains With Enhanced Ethanol Tolerance by Mutagenesis of the TATA-Binding Protein Gene and Identification of Novel Genes Associated With Ethanol Tolerance;Jungwoo Yang等;《Biotechnology and Bioengineering》;20110317;第108卷(第8期);第1776-1787页 |
| Evaluation of gene modification strategies for the development of low-alcohol-wine yeasts;VARELA C D等;《Applied and Environmental Microbiology》;20121231;第78卷(第16期);第6068-6070页 |
| Microbiological approaches to lowering ethanol concentration in wine;KUTYNA D R等;《Trends in Food Science & Technology》;20101231;第21卷(第6期);第293-300页 |
| 产乙醇工程菌构建方法的研究进展;常冬冬等;《中国农学通报》;20131231;第29卷(第2期);第120-124页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950649A (en) | 2016-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Williams et al. | Cloning the gene for the malolactic fermentation of wine from Lactobacillus delbrueckii in Escherichia coli and yeasts | |
| CN106367361B (en) | A kind of saccharomyces cerevisiae engineered yeast strain and its construction method, application | |
| CN108060114B (en) | A kind of Escherichia coli of fermenting and producing l-Alanine and its application | |
| CN101177685A (en) | Screening method for genes of brewing yeast | |
| CN105143447B (en) | Protein and application thereof with xylose isomerase activity | |
| CN102839133A (en) | Strain producing long chain dibasic acid, and application thereof | |
| CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
| CN108949706B (en) | L-proline-4-hydroxylase, gene engineering bacterium thereof, construction method and application | |
| CN105950649B (en) | A kind of recombinant plasmid pY16TEF1- △ SPT15-125 that Ethanol in Saccharomyces cerevisiae yield can be improved and its application | |
| CN113604472B (en) | CRISPR/Cas gene editing system applied to Trichoderma reesei | |
| CN106916837A (en) | Hyperosmosis glycerine protein kinase gene RkHog1 and its recombinant expression carrier | |
| CN105624051B (en) | Wood-sugar fermentation yeast strain and construction method based on the building of evolution engineering | |
| CN105907779B (en) | A kind of recombinant plasmid pY16TEF1- △ SPT15 reducing Ethanol in Saccharomyces cerevisiae yield and its application | |
| CN103131720A (en) | Fungi xylose isomerase gene and application thereof | |
| CN113293107B (en) | Saccharomyces cerevisiae for industrial production with high organic acid tolerance and construction method thereof | |
| CN102533574A (en) | Yellow wine yeast engineering strain with low urea yield and construction method thereof | |
| CN107058263A (en) | A kind of high efficiency preparation method of new beta amylase | |
| CN115838645A (en) | Yeast strain for high yield of orotic acid and application thereof | |
| CN114409751A (en) | YH 66-04470 gene mutation recombinant bacterium and application thereof in preparation of arginine | |
| CN111378682A (en) | Method for reducing ethyl carbamate content in yellow wine by metabolically modifying saccharomyces cerevisiae | |
| CN102719459B (en) | Produce the method for endoglucanase, 1,4-BETA-D-glucancellobio-hydrolase and beta-glucosidase | |
| CN107815461A (en) | Rumen Fungi xylose isomerase gene and its application | |
| CN106434700B (en) | A kind of saccharomyces cerevisiae spt15 fixed point saturation gene mutation method improving alcohol yied | |
| CN109749948A (en) | A kind of recombinant pichia yeast strain and construction method sticking the expression of corn glutamine transaminage using TEF1 promoter regulation | |
| CN114249803B (en) | Engineering bacterium for high-yield arginine and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190709 Termination date: 20200525 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |