CN105949292A - Application of protein LMM5.4 in regulating disease resistance and hypersensitivity of plants - Google Patents
Application of protein LMM5.4 in regulating disease resistance and hypersensitivity of plants Download PDFInfo
- Publication number
- CN105949292A CN105949292A CN201610459682.1A CN201610459682A CN105949292A CN 105949292 A CN105949292 A CN 105949292A CN 201610459682 A CN201610459682 A CN 201610459682A CN 105949292 A CN105949292 A CN 105949292A
- Authority
- CN
- China
- Prior art keywords
- plant
- protein
- sequence
- transgenic plant
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses application of a protein LMM5.4 in regulating disease resistance and hypersensitivity of plants. In the application disclosed by the invention, the protein LMM5.4 is the following A1), A2) or A3): A1) protein of which the amino acid sequence is Sequence 5; A2) protein with the same functions obtained by substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence disclosed as Sequence 5 in the sequence table; or A3) fusion protein obtained by connecting a tag to the N terminal or/and C terminal of A1) or A2). The experiment proves that the LMM5.4 is related to disease resistance of plants and can regulate the hypersensitivity of plants, and thus, the LMM5.4 and genes thereof can be utilized to regulate the disease resistance and hypersensitivity of plants.
Description
Technical field
The present invention relates in biological technical field Protein L MM5.4 regulation and control disease resistance of plant with in allergy
Application.
Background technology
In order to tackle the attack of pathogen in natural environment, plant evolution goes out the defense mechanism of complexity.Wherein, most effective
One of mode be allergy (Hypersensitive response, HR).Allergy refers to when plant is subject to
After non-affine pathogen infection, infected position cell the most dead, thus a kind of defence limiting pathogen propagation is anti-
Should, belong to apoptosis (programmed cell death, PCD) (Greenberg, 1997).Class is sick
Change mutant (lesion mimic mutants) is not in the case of having pathogen infection, with regard to formation class that can be spontaneous
Like the ecthyma gangrenosa (lesion) of allergy, therefore lesion mimic be research plant cell death, allergy and
The important materials of defense response.Lesion mimic reports (Hoisington et al., 1982) in Semen Maydis,
Subsequently Fructus Hordei Vulgaris (Wolter et al., 1993), arabidopsis (Dietrich et al., 1994；Greenberg and
Ausubel,1993；Greenberg et al., 1994), the species such as Oryza sativa L. (Takahashi et al., 1999)
In be all found.Oryza sativa L. is as important cereal crops and model plant, to its cell death and the research of disease resistance mechanisms
Have great importance.
Summary of the invention
The technical problem to be solved is the disease resistance how regulating and controlling plant and allergy.
For solve above-mentioned technical problem, present invention firstly provides Protein L MM5.4 regulation and control disease resistance of plant and/or
Application in regulation and control plant allergy；Described Protein L MM5.4 is following A1), A2) or A3):
A1) aminoacid sequence is the protein of sequence 5；
A2) by shown in sequence in sequence table 5 aminoacid sequence through one or several amino acid residue replacement and/
Or lack and/or add and have the protein of identical function；
A3) at A1) or N end A2) or/and C end connects the fused protein that label obtains.
Wherein, sequence 5 is made up of 656 amino acid residues.
In order to make A1) in protein be easy to purification, can in by sequence table the aminoacid sequence shown in sequence 5
The amino terminal of the protein of row composition or carboxyl terminal connect upper label as shown in table 1.
Table 1, the sequence of label
Above-mentioned A2) in, one or the replacement of several amino acid residue and/or disappearance and/or be added to less than 10
The replacement of individual amino acid residue and/or disappearance and/or interpolation.
Above-mentioned A2) in LMM5.4 can synthetic, it is possible to first synthesize its encoding gene, then carry out biological expression and obtain.
Above-mentioned A2) in LMM5.4 encoding gene can by will in the DNA sequence shown in sequence 4 lack one or several
The codon of individual amino acid residue, and/or carry out the missense mutation of one or several base pair, and/or at its 5 ' end
And/or 3 ' end connect the coded sequence of the label shown in table 1 and obtain.
For solving above-mentioned technical problem, present invention also offers the biomaterial relevant to LMM5.4 at regulation and control plant disease-resistant
Property and/or regulation and control plant allergy in application；Described biomaterial is following B1) to B14) in any one:
B1) nucleic acid molecules of LMM5.4 is encoded；
B2) containing B1) expression cassette of described nucleic acid molecules；
B3) containing B1) recombinant vector of described nucleic acid molecules；
B4) containing B2) recombinant vector of described expression cassette；
B5) containing B1) recombinant microorganism of described nucleic acid molecules；
B6) containing B2) recombinant microorganism of described expression cassette；
B7) containing B3) recombinant microorganism of described recombinant vector；
B8) containing B4) recombinant microorganism of described recombinant vector；
B9) containing B1) the transgenic plant cells system of described nucleic acid molecules；
B10) containing B2) the transgenic plant cells system of described expression cassette；
B11) containing B1) Transgenic plant tissue of described nucleic acid molecules；
B12) containing B2) Transgenic plant tissue of described expression cassette；
B13) containing B1) the transgenic plant organ of described nucleic acid molecules；
B14) containing B2) the transgenic plant organ of described expression cassette.
In above-mentioned application, B1) described nucleic acid molecules is following b1)-b3) and in any one:
B1) the cDNA molecule of sequence 4 or DNA molecular during nucleotide sequence is sequence table；
B2) nucleotide sequence and b1) limited has 75% or more than 75% homogeneity, and the cDNA of coding LMM5.4
Molecule or genomic DNA molecule；
B3) under strict conditions with b1) nucleotide sequence hybridization that limits, and the cDNA molecule of coding LMM5.4 or
Genomic DNA molecule.
Wherein, described nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；Described nucleic acid divides
Son can also be RNA, such as mRNA or hnRNA etc..
Wherein, sequence 4 is made up of 1971 nucleotide, the protein shown in coded sequence 5.
Those of ordinary skill in the art can use the side of known method, such as orthogenesis and point mutation easily
Method, the nucleotide sequence that the present invention encodes LMM5.4 suddenlys change.Those are through manually modified, have and this
The nucleotide sequence 75% of the LMM5.4 of invention isolated or the nucleotide of higher homogeneity, if coding LMM5.4
And there is LMM5.4 function, all it is derived from the nucleotide sequence of the present invention and is equal to the sequence of the present invention.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this
The nucleotide sequence of protein of the composition of the aminoacid sequence shown in coded sequence 5 of invention has 75% or higher, or
85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or
Computer software is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio
(%) representing, it can be used to the homogeneity evaluating between correlated series.
In above-mentioned application, described stringent condition is at 2 × SSC, in the solution of 0.1%SDS, hybridizes also at 68 DEG C
Wash film 2 times, each 5min, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash film 2
Secondary, each 15min；Or, 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, under the conditions of 65 DEG C
Hybridize and wash film.
Above-mentioned 75% or more than 75% homogeneity, can be the homogeneity of 80%, 85%, 90% or more than 95%.
In above-mentioned application, B2) described in expression cassette (the LMM5.4 gene table of the nucleic acid molecules containing coding LMM5.4
Reach box), refer to express the DNA of LMM5.4, this DNA in host cell and not only can include starting LMM5.4 base
Because of the promoter transcribed, may also include the terminator terminating LMM5.4 genetic transcription.Further, described expression cassette also may be used
Including enhancer sequence.The promoter that can be used for the present invention includes but not limited to: constitutive promoter, tissue, organ
The promoter special with growth, and inducible promoter.The example of promoter includes but not limited to: cauliflower mosaic
The constitutive promoter 35S of poison: from the wound-inducible promoter of Fructus Lycopersici esculenti, leucine aminopeptidase (" LAP ",
Chao et al. (1999) Plant Physiol 120:979-992)；From chemical inducible promoter of Nicotiana tabacum L.,
Pathogeny is correlated with 1 (PR1) (being induced by salicylic acid and BTH (diazosulfide-7-carbothioic acid S-methyl ester))；
Fructus Lycopersici esculenti protease inhibitor II promoter (PIN2) or LAP promoter (all can use methyl jasmonate to induce)；
Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline inducible promoter (United States Patent (USP) 5,057,422)；
Seed specific promoters, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent
200710099169.7)), and the special promoter of seed storage protein matter (such as, phaseollin., napin, oleosin
Promoter (Beachy et al. (1985) EMBO is J.4:3047-3053) with Semen sojae atricolor beta conglycin).
They can be used alone or be used in combination with other plant promoter.All references cited herein is drawn all in full
With.Suitably transcription terminator includes but not limited to: Agrobacterium nopaline syntase terminator (NOS terminator), flower
Cauliflower mosaic virus CaMV 35S terminator, tml terminator, Semen Pisi sativi rbcS E9 terminator and nopaline and Octopus
Propylhomoserin synthase terminator (see, e.g.: Odell et al. (I985)Nature 313:810；Rosenberg
Et al. (1987) Gene, 56:125；Guerineau et al. (1991) Mol.Gen.Genet, 262:141；
Proudfoot(1991)Cell,64:671；Sanfacon et al. Genes Dev., 5:141；Mogen etc.
People (1990) Plant Cell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad
Et al. (1989) Nucleic Acids Res.17:7891；Joshi et al. (1987) Nucleic Acid
Res.,15:9627)。
Available existing expression vector establishment contains the recombinant vector of LMM5.4 expression casette.Described plant expression vector
Including double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438,
PCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or
PCAMBIA1391-Xb (CAMBIA company) etc..Described plant expression vector also can comprise the 3 ' of exogenous gene and hold non-turning over
Translate region, i.e. comprise polyadenylation signals and any other participates in mRNA processing or the DNA fragmentation of gene expression.Described
The bootable polyadenylic acid of polyadenylation signals joins 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti)
Plasmid gene (such as rouge alkali synthetase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end is transcribed
Untranslated region is respectively provided with similar functions.When using the gene constructed plant expression vector of the present invention, it be also possible to use enhancer,
Including translational enhancer or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region rises
Beginning codon etc., but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.Described turn over
The source translating control signal and start codon is widely, can be natural, it is also possible to be synthesis.Translate
Beginning region can come from transcription initiation region or structural gene.For the ease of transgenic plant cells or plant are reflected
Determine and screening, plant expression vector used can be processed, face can be produced as added the coding can expressed in plant
The enzyme of complexion changed or the gene (gus gene, luciferase genes etc.) of luminophor, antibiotic marker gene (as
Give the nptII gene to kanamycin and associated antibiotic resistance, give herbicide phosphinothricin resistance
Bar gene, gives the hph gene to antibiotic hygromycin resistance, and gives the dhfr to methotrexate resistance
Gene, gives EPSPS gene to glyphosate) or anti-chemical reagent marker gene etc. (such as anti-herbicide
Gene), provide metabolism mannose ability mannose-6-phosphate isomerase gene.From the safety of transgenic plant
Consider, any selected marker can be not added with, directly screen transformed plant with adverse circumstance.
In above-mentioned application, described carrier can be plasmid, glutinous grain, phage or viral vector.Described plasmid is concretely
PCAMBIA1300 or pTCK303.
B3) described recombinant vector can be containing the DNA sequence for encoding LMM5.4 shown in sequence 4；B3 further)
Described recombinant vector concretely pUbi::LMM5.4.Described pUbi::LMM5.4 be by the Kpn I of pTCK303 and
DNA sequence between Spe I recognition site replaces with shown in the expressed sequence 5 that the DNA sequence shown in sequence 4 obtains
The recombinant vector of LMM5.4.
In above-mentioned application, described microorganism can be yeast, antibacterial, algae or fungus.Described antibacterial concretely Agrobacterium,
Such as Agrobacterium EHA105.
In above-mentioned application, described transgenic plant cells system, Transgenic plant tissue and transgenic plant organ do not wrap
Include propagating materials.
For solving above-mentioned technical problem, present invention also offers following arbitrary application of LMM5.4 or described biomaterial:
H1, reduce the application in plant cultivating disease resistance；
H2, reduce the application in disease resistance of plant product in preparation；
H3, reduce the application in plant cultivating allergy；
H4, reduce the application in plant allergy product in preparation.
For solving above-mentioned technical problem, present invention also offers regulation and control disease resistance of plant or allergy product, described
Product contains LMM5.4 or described biomaterial.
In the said goods, described product can be using LMM5.4 or described biomaterial as active component, it is also possible to will
The compositions that LMM5.4 or described biomaterial and other disease resistance material are combined obtaining is as active component.
For solving above-mentioned technical problem, present invention also offers following M1) or M2):
M1) method cultivating the transgenic plant that disease resistance reduces, including importing following 1 in recipient plant) or 2)
Obtain transgenic plant；
1) encoding gene of LMM5.4；
2) expression cassette of the encoding gene containing LMM5.4；
Described transgenic plant disease resistance compared with described recipient plant reduces；
M2) method cultivating the transgenic plant that allergy reduces, including importing described 1 in recipient plant)
Or described 2) obtain transgenic plant；The allergy compared with described recipient plant of described transgenic plant reduces.
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 4) of described LMM5.4 passes through
LMM5.4 gene recombinant vectors containing LMM5.4 expression casette imports in purpose plant.
In said method, wherein said LMM5.4 gene can be modified the most as follows, then imports in receptor seed plant,
To reach more preferable expression effect:
1) modify according to actual needs and optimize, so that gene efficient expression；Such as, can plant according to receptor
The codon that thing is had a preference for, changes its password while keeping the aminoacid sequence of LMM5.4 gene of the present invention
Son is to meet plant-preference；During optimization, it is desirable that the coded sequence after optimization keeps certain GC
Content, to be best implemented with the high level expression of quiding gene in plant, wherein G/C content can be 35%, be more than
45%, more than 50% or more than about 60%；
2) gene order of neighbouring initial methionine is modified, so that translation is the most initial；Such as, utilization is being planted
In thing, known effective sequence is modified；
3) promoter expressed with various plants is connected, and is beneficial to its expression in plant；Described promoter can
Including composing type, induction type, sequential regulation, Growth adjustment, Chemical Regulation, tissue preferably and tissue specificity
Promoter；The selection of promoter will change along with expression time and space requirement, and also depend on target kind；
Such as tissue or the specific expressing promoter of organ, receptor is depending on what period grown as required；To the greatest extent
Pipe demonstrates and derives from many promoteres of dicotyledon is operational in monocotyledon, otherwise also
So, but it is desirable to select dicot promoters expression in the dicotyledon, monocotyledon
Promoter expression in the monocotyledon；
4) it is connected with the transcription terminator being suitable for, it is also possible to improve the expression efficiency of gene of the present invention；Such as originate
In the tml of CaMV, derive from the E9 of rbcS；Any known available terminator worked in plant
Can be attached with gene of the present invention；
5) enhancer sequence is introduced, before intron sequences (such as deriving from Adhl and bronzel) and virus
Lead sequence (such as deriving from TMV, MCMV and AMV).
Described LMM5.4 expression vector can be by using Ti-plasmids, Ri plasmid, plant viral vector, direct DNA
The conventional biology methods such as conversion, microinjection, conductance, agriculture bacillus mediated, particle gun convert plant cell or tissue,
And the plant tissue of conversion is cultivated into plant.
Described method also includes that described volume is expressed in screening from the plant of the encoding gene importing the LMM5.4 shown in sequence 4
The plant of code gene, obtains transgenic plant.
In the present invention, described transgenic plant is interpreted as not only comprising described LMM5.4 gene transformation purpose plant
The first generation transgenic plant obtained, also includes its filial generation.For transgenic plant, can be numerous in these species
Grow this gene, it is also possible to this gene is transitioned into other kind of same species by traditional breeding method, wraps especially
Include in commercial variety.Described transgenic plant includes seed, callus, whole plant and cell.
In the present invention, described plant can be monocotyledon or dicotyledon；Described purpose plant and described receptor are planted
Thing can be all monocotyledon or dicotyledon.Described monocotyledon is grass, such as Oryza sativa L..
In the present invention, described disease resistance can be bacterial blight-resisting or blast resisting.Described bacterial leaf-blight can be by bacterial leaf-blight
Bacterium causes, and described rice blast can be caused by Pyricularia oryzae.Described leaf spot bacteria can be bacterial leaf-blight biological strain
PXO145, described Pyricularia oryzae can be rice blast biological strain JL062401, JL021605, G9, G11, B8 and/
Or B23.
It is demonstrated experimentally that the LMM5.4 of the present invention is relevant to the disease resistance of plant.LMM5.4 can reduce the disease-resistant of plant
Property: infect with leaf spot bacteria and turn LMM5.4 gene plant, turn the bacterial leaf spot scab length (6.6 of LMM5.4 gene plant
± 1.7cm) considerably longer than do not turn LMM5.4 gene plant (1.3 ± 0.8cm).The LMM5.4 of the present invention can regulate and control
The allergy of plant.LMM5.4 can reduce the allergy of plant: goes to LMM5.4 gene occur to surpass
In the plant of quick reaction, allergy declines.It is demonstrated experimentally that LMM5.4 and gene regulation plant thereof can be utilized
Disease resistance and allergy.
Biomaterial preservation explanation
The Classification And Nomenclature of biomaterial: Oryza sativa L. (Oryza sativa)
The strain number of biomaterial: lmm5
Depositary institution's title of biomaterial: China Committee for Culture Collection of Microorganisms's common micro-organisms center
The depositary institution of biomaterial is called for short: CGMCC
The depositary institution address of biomaterial: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, the micro-life of the Chinese Academy of Sciences
Thing institute, postcode: 100101
The preservation date of biomaterial: on 05 27th, 2016
Register on the books numbering in the preservation center of biomaterial: CGMCC No.11947
Accompanying drawing explanation
Fig. 1 is the structural representation between LB and RB of pTCK300-RNAi.
Fig. 2 is lmm5 expression in RNAi suppression transfer-gen plant.
Fig. 3 is the phenotypic evaluation of mutant lmm5.Wherein, A is whole strain phenotype, and B is leaf morphology, and C is sheath
Phenotype.
Fig. 4 is platform phenol indigo plant coloration result.
Fig. 5 is that RNAi suppresses transfer-gen plant Nip.LMM5.1iPhenotype.
Fig. 6 is the bacterial leaf spot scab length of RNAi suppression transfer-gen plant.
Fig. 7 is the Japanese warm and fine lmm5 resistance investigation to rice blast.
Fig. 8 is the Japanese warm and fine lmm5 resistance investigation to 5 bacterial leaf-blight microspecies.
Fig. 9 is the structure between LB and RB of expression vector pLMM5.1::LMM5.1.
Figure 10 is the structure between LB and RB of expression vector pUbi::LMM5.4.
Figure 11 is the phenotype of transfer-gen plant.
Figure 12 is the bacterial leaf spot scab length of transfer-gen plant.
Wherein, Nip. represents that Japan is fine.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is further described in detail, the embodiment be given only for
Illustrate the present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
PTCK303 in following embodiment (Wang, M., Chen, C., Xu, Y.Y., Jiang, R.X., Han,
Y.,Xu,Z.H.,and Chong,K.(2004).A practical vector for efficient knockdown
of gene expression in rice(Oryza sativa L.).Plant Molecular Biology Reporter
22,409-417.) public can obtain this biomaterial at applicant, and this biomaterial only attaches most importance to what duplicate was invented
Used by related experiment, can not use as other purposes.
Bacterial leaf-blight biological strain PXO145 in following embodiment (Chen, H., Li, C., Liu, L., Zhao,
J.,Cheng,X.,Jiang,G.,and Zhai,W.(2016).The Fd-GOGAT1mutant gene lc7
confers resistance to Xanthomonas oryzae pv.Oryzae in rice.Scientific reports
6.) public can obtain at applicant, this biomaterial only attach most importance to duplicate invention related experiment used by, can not make
Use for other purposes.
Rice blast biological strain B23 in following embodiment (Sun Yan, Wang Yunyue, He Yueqiu, Li Chengyun, Zhou Jianghong,
Zhu Youyong, Candidate Disease Resistant Genes application in rice varieties Study on Diversity, Scientia Agricultura Sinica, 2005,38 (11):
2227-2232) public can obtain at applicant, this biomaterial only attach most importance to duplicate invention related experiment used by,
Can not use as other purposes.
Embodiment 1, the expression of suppression LMM5.1 gene can improve the disease resistance of Oryza sativa L.
One, the structure of LMM5.1RNAi plasmid pTCK303-LMM5.1i
1, extracting the total serum IgE that rice varieties Japan is fine, reverse transcription is cDNA.
2, according to CDS primers RNAi-F and RNAi-R of LMM5.1, wherein at the 5 ' ends of RNAi-F
Adding Spe I/Kpn I restriction enzyme site, the 5 ' ends at RNAi-R add Sac I/BamH I restriction enzyme site.
RNAi-F:5 '-actagtggtaccAGAATGAGGATGTGGCCCAG-3 '
RNAi-R:5 '-gagctcggatccTTCACTGCTTTCATCCATAGCC-3 '
3, with the cDNA of step 1 as template, with the primer of RNAi-F and RNAi-R composition to carrying out PCR amplification,
Obtain amplified production.
4, reclaim amplified production, be connected with pEASY-Blunt carrier (Beijing Quanshijin Biotechnology Co., Ltd),
Obtain recombinant vector pEASY-LMM5.1i.
5, with restricted enzyme Kpn I and BamH I digested plasmid pEASY-LMM5.1i, about 338bp is reclaimed
Digestion products；With restricted enzyme Kpn I and BamH I enzyme action RNAi binary vector pTCK303, reclaim skeleton
Carrier；Above two being reclaimed product be connected, order-checking, by the named intermediate carrier of carrier correct for sequence
pTCK303-LMM5.1i-reverse。
6, with restricted enzyme Spe I and Sac I enzyme action pEASY-LMM5.1i, the enzyme action of about 350bp is reclaimed
Product；With restricted enzyme Spe I and Sac I enzyme action intermediate carrier pTCK303-LMM5.1i-reverse；Will
Above two reclaims product and is connected, and order-checking, by the named pTCK303-LMM5.1i of carrier correct for sequence.
Identify according to order-checking, the structure of pTCK303-RNAi is described as follows: in plant Zea mays Ubiquitin promoter
After BamHI and KpnI recognition site between reversely in insertion sequence table the 515bp of sequence 1 to shown in 840bp
Nucleotide sequence, be followed by the Oryza sativa L. intron that a carrier carries, SpeI and SacI after intron knows
Between other site in forward insertion sequence table sequence 1 515bp to the nucleotide sequence shown in 840bp.Restructuring matter
Structural representation between LB and RB of grain pTCK300-RNAi is shown in Fig. 1.
Two, the acquisition of transgenic plant
PTCK303-RNAi is imported in Agrobacterium EHA105, utilize the recombinational agrobacterium obtained with agriculture bacillus mediated
It is fine that transgenic method (Kumar et al., 2005) converts Japan, it is thus achieved that 47 T0For positive transgenic plant
(Nip.LMM5.1i)。
PTCK303 is imported in Agrobacterium EHA105, convert Japan fine, obtain turning empty carrier plant.
At 47 T0For positive transgenic plant (Nip.LMM5.1i15 strains (line1-line15) are randomly selected, profit in)
With primer to (LMM-F:CTTGACTCTCCAGGCCATAAA and LMM-R:GTCCATGCCAGCTTCAAATG) at RNA
In level, the expression to LMM5.1 gene detects, and as indicated with 2, result shows result, compared with wild type
(Nip.), each Nip.LMM5.1iThe expression of the LMM5.1 gene in strain is all remarkably decreased.
Three, the phenotypic evaluation of transfer-gen plant and Disease Resistance Identification
Mutant lmm5 spontaneously forms the speckle of brown on seedling stage, this mutant blade, when complete leaf extract out with
After, sheath also there will be similar speckle, these speckles are individually present in distributing shape, and are continued until plant
Natural death (Fig. 3).
The most dead with the cell at brown speckle on platform phenol blue (Trypan Blue) staining detection lmm5 blade.Platform
Phenol indigo plant is a kind of cytoactive dyestuff, and normal living cells after birth structural integrity, platform phenol indigo plant can not enter intracellular, cell
Cannot be colored；And when cell death or the irreversible damage of cell membrane appearance, the permeability of after birth increases, cell is permissible
Blueness is dyed by platform phenol indigo plant.Find after platform phenol indigo plant dyes, without the generation of blue spot on the blade that Japan is fine, and dash forward
There is navy blue colored spots at speckle and around speckle on variant lmm5 blade, illustrate that the cell at this position is dead or just
In dead process (Fig. 4).
And at 47 T0For Nip.LMM5.1iIn positive transgenic plant, the blade of 43 strains and sheath all show and lmm5
On identical phenotype (Fig. 5), blade and the speckle of sheath formation brown, and platform phenol indigo plant dyeing discovery plant at speckle
And around speckle, have navy blue colored spots, show in the most dead or death the carrying out of cell at speckle position；Turn
The basic zero difference of phenotype that empty carrier plant is fine with Japan, all without brown speckle.
By above-mentioned 43 strain T0For Nip.LMM5.1iPositive transgenic plant carries out selfing, and trait segregation is no longer occurred
Nip.LMM5.1i T2For positive transgenic plant (i.e. homozygous transgenic plant), enter with bacterial leaf-blight biological strain PXO145
Row infect, with Japan fine, turn empty carrier plant and lmm5 for comparison, specifically infect method as follows:
The bacterial leaf-blight biological strain PXO145 being stored in-70 DEG C is inoculated into PSA culture medium (Rhizoma Solani tuber osi 300g/L,
Ca(NO3)2·4H2O 0.5g/L, Na2HPO4·12H2O 2.0g/L, sucrose 15g/L, agar powder 15g/L) on
Recovery, preserves to standby in 4 DEG C of refrigerators.Through after identifying that detecting it on rice varieties has standard toxicity, in connecing
Rule in PSA culture medium before kind, cultivate 72 hours for 28 DEG C.Treat the dense and uniform of antibacterial length, use pure washing
De-antibacterial, regulation concentration is to 109Cfu/ml inoculates.Connect bacterium (bacterium is infected) method and use artificial leaf-cutting inocalation method
(Kauffman,H.,Reddy,A.,Hsiek,S.and Merca,S.(1973).An improved technique
for evaluating resistance of rice varieties to Xanthomonas oryzae pv.oryzae.
Plant Dis.Rep.57,537-541.), every strain 3-5 blade of inoculation, each blade deducts top 1-2cm.
After inoculating two weeks, investigating when scab length is obvious and stablizes, each plant measures 3-5 blade, minimum tune
Look into 10 strains, seek its meansigma methods and calculate positive and negative deviation as Resistant index.
Two weeks " Invest, Then Investigate " state of an illness.Result shows, Nip.LMM5.1iBacterial leaf spot scab length (0.7 ± 0.6cm) of transfer-gen plant
With lmm5 (1.3 ± 0.8cm) without significant difference, but it is considerably shorter than Japan fine (6.5 ± 1.6cm) (Fig. 6), turns sky
The bacterial leaf spot scab length of carrier plant is fine without significant difference with Japan.
These results suggest that, by disturbing the expression of the fine middle LMM5.1 of Japan, no matter transfer-gen plant is in phenotype
Upper or in disease resistance, all consistent with lmm5 mutant, the expression of LMM5.1 be interfered after the disease resistance of Oryza sativa L.
Strengthen.
Above, lmm5 (lesion mimic mutant 5) is by Japan fine (Oryza sativa ssp.japonica)
The lesion mimic that a character obtaining is stable, lmm5 was preserved in Chinese micro-life on 05 27th, 2016
Thing culture presevation administration committee's common micro-organisms center, preservation center registers on the books numbering: CGMCC No.11947.
Utilize nebulization in seedling stage and injection in tillering stage Japanese warm and fine lmm5 is inoculated 6 rice blast biological strain JL062401,
JL021605, G9, G11, B8 and B23, carry out resistance investigation behind three days and one week.Result shows no matter
In seedling stage still in tillering stage, take over and on the fine blade of Japan of bacterium, have obvious rice blast scab, illustrate these six little
Planting is Japanese fine affine microspecies；On the lmm5 blade taking over bacterium, although have the brown ecthyma gangrenosa spontaneously formed, but
The vestige (Fig. 7) infected almost without Pyricularia oryzae.Therefore, all rice blast microspecies for detection are all had by lmm5
Higher resistance.With leaf-cutting method tillering stage Japanese warm and fine lmm5 inoculated 5 bacterial leaf-blight biological strain PXO86,
PXO71, PXO99, PXO145 and PXO280, carry out Disease investigation after inoculating two weeks.Result shows, Japan is fine to this
It is susceptible that 5 microspecies all have in various degree, and lmm5 shows high anti-(Fig. 8) to each microspecies.Result above
Display, all rice blast for inoculation and bacterial leaf-blight microspecies resistance are significantly increased by lmm5.
Embodiment 2, LMM5.1 and LMM5.4 can reduce the disease resistance of Oryza sativa L.
One, the structure of expression vector pLMM5.1::LMM5.1
1, the DNA that rice varieties Japan is fine is extracted.
2, with the DNA of step 1 as template, with the primer of LMM5.1com1-F and LMM5.1com1-R composition to carrying out
PCR expands, and obtains the amplified production " fragment a " of 5181bp.
LMM5.1com1-F:5 '-GGTTAATGTTGGCGCCGCTGGTGGTATTCATC-3 '
LMM5.1com1-R:5 '-CCAGGTAACAGATGAATCTTTGAAGTTGCATG-3 '
Reclaim amplified production, be connected with pEASY-Blunt carrier, construction recombination plasmid pEASY-a.
3, with the DNA of step 1 as template, with the primer of LMM5.1com2-F and LMM5.1com2-R composition to carrying out
PCR expands, and obtains the amplified production " fragment b " of 3196bp, and wherein 5 ' ends add Xba I restriction enzyme site.
LMM5.1com2-F:5 '-tctagaAGACTTTGGTGGTGACCCTGAGATA-3 '
LMM5.1com2-R:5 '-CAAATAACTAAAAGAGTGACGG-3 '
Reclaim amplified production, be connected with pEASY-Blunt carrier, construction recombination plasmid pEASY-b.
4, with the DNA of step 1 as template, with the primer of LMM5.1com3-F and LMM5.1com3-R composition to carrying out
PCR expands, and obtains the amplified production " fragment c " of 3342bp, and wherein 3 ' ends add Hind III restriction enzyme site.
LMM5.1com3-F:5 '-AAGCTTCGGCGTTGAACAGCTTATTGTT-3 '
LMM5.1com3-R:5 '-aagcttTGATCCCTCAACACCCCGATGAAAGAACAG-3 '
Reclaim amplified production, be connected with pEASY-Blunt carrier, construction recombination plasmid pEASY-c.
5, with the recombiant plasmid pEASY-c in restricted enzyme Pst I and Hind III enzyme action step 4,1742bp is reclaimed
Insert Fragment；With restricted enzyme Pst I and Hind III enzyme action binary expression vector pCAMBIA1300, reclaim
Skeleton fragment；Above two is reclaimed product be connected, obtain middle interstitial granules pCAMBIA1300-c.
6, with the recombiant plasmid pEASY-b in restricted enzyme Xba I and Pst I enzyme action step 3,3057bp is reclaimed
Insert Fragment；With the intermediate carrier pCAMBIA1300-c in restricted enzyme Xba I and Pst I enzyme action step 5,
Reclaim digestion products；Above two is reclaimed product be connected, obtain middle interstitial granules pCAMBIA1300-(b+c).
7, with the recombiant plasmid pEASY-a in restricted enzyme BamH I and Mfe I enzyme action step 2,3905bp is reclaimed
Insert Fragment；With the middle interstitial granules in restricted enzyme BamH I and Mfe I enzyme action step 6
PCAMBIA1300-(b+c), reclaims digestion products；Above two is reclaimed product be connected, obtain recombiant plasmid
PCAMBIA1300-(a+b+c), i.e. complementary expression vector pLMM5.1::LMM5.1.
Identify according to order-checking, the structure of pLMM5.1::LMM5.1 is described as follows: pLMM5.1::LMM5.1 is for double
Insert the DNA molecular shown in sequence 3 between BamH I and Hind III restriction enzyme site of unit carrier pCAMBIA1300 to obtain
The recombinant vector arrived, between LB and RB of recombiant plasmid pLMM5.1::LMM5.1, structural representation is shown in Fig. 9.
The sequence that 1490-6521 position is LMM5.1 gene of sequence 3, the LMM5.1 albumen shown in coded sequence 2
Matter, the CDS sequence of LMM5.1 gene is as shown in sequence 1.In recombiant plasmid pLMM5.1::LMM5.1, sequence 3
1-1489 position starts the expression of LMM5.1 gene, and the 6522-8075 position of sequence 3 terminates the table of LMM5.1 gene
Reach.
Two, the structure of expression vector pUbi::LMM5.4
1, extracting the bright total serum IgE of extensive 63 of rice varieties, reverse transcription is cDNA.
2, with the cDNA of step 1 as template, with the primer of LMM5.4OE1-F and LMM5.4OE1-R composition to carrying out
PCR expands, and obtains the amplified production " fragment d " of 1988bp, is wherein added respectively at 5 ' ends and 3 ' ends by primer
Enter Kpn I and Spe I restriction enzyme site and protection base.
LMM5.4OE1-F:5 '-CGGggtaccATGCCACGCAAGGTTGTCTC-3 '
LMM5.4OE1-R:5 '-GGactagtTCAGTTCTGATCTTGCCGGAGTAC-3 '
3, by " fragment d " in restricted enzyme Kpn I and Spe I enzyme action step 2, product is reclaimed.
4, with restricted enzyme Kpn I and Spe I enzyme action pTCK303, enzyme action skeleton carrier is reclaimed.
5, the recovery product in step 3 and step 4 is connected, it is thus achieved that recombinant vector, the recombinant vector name that will obtain
For pUbi::LMM5.4.
Identify according to order-checking, the structure of pUbi::LMM5.4 is described as follows: pUbi::LMM5.4 is at binary vector
Sequence 4 in sequence table is inserted between Spe I after the Ubiquitin promoter of pTCK303 and Kpn I recognition site
The recombinant vector that shown 1971bp LMM5.4 gene obtains.LB and RB of recombiant plasmid pUbi::LMM5.4
Between structural representation see that Figure 10, pUbi::LMM5.4 can the LMM5.4 protein shown in expressed sequence 5.
Three, the acquisition of transgenic plant
PLMM5.1::LMM5.1 is imported in Agrobacterium EHA105, utilize the recombinational agrobacterium obtained with agriculture bacillus mediated
Transgenic method (Kumar et al., 2005) convert lmm5 (lmm5 was preserved on 05 27th, 2016
China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation center registers on the books numbering: CGMCC No.
11947), it is thus achieved that 41 T0For positive transgenic plant (lmm5LMM5.1)。
Plant expressing vector pCAMBIA1300 is imported in Agrobacterium EHA105, utilize the recombinational agrobacterium and agriculture obtained
The transgenic method (Kumar et al., 2005) of bacillus mediation converts lmm5, obtains turning empty carrier Oryza sativa L., as turning
The comparison of trans-genetic hybrid rice.Obtain 40 T0 altogether for positive transgenic plant (lmm51300)。
PLMM5.1::LMM5.1 is imported in Agrobacterium EHA105, utilize the recombinational agrobacterium obtained with agriculture bacillus mediated
Transgenic method (Kumar et al., 2005) convert lmm5, it is thus achieved that 33 T0For positive transgenic plant
(lmm5LMM5.4OE)。
PTCK303 is imported in Agrobacterium EHA105, utilize the recombinational agrobacterium and agriculture bacillus mediated transgenic obtained
Method (Kumar et al., 2005) converts lmm5, obtains turning empty carrier Oryza sativa L., as the comparison of transgenic paddy rice.
Obtain 40 T0 altogether for positive transgenic plant (its entitled lmm51300Ubi)。
Four, the phenotypic evaluation of transfer-gen plant and Disease Resistance Identification
Test in triplicate:
All 41 lmm5LMM5.1With 33 lmm5LMM5.4OE T0For on plant leaf and sheath all without uneven class sizes generation (figure
11), phenotype is fine with Japan identical.lmm5LMM5.1And lmm5LMM5.4OET1Generation and T2The positive transgenic plant in generation also without
The generation of uneven class sizes.And 40 lmm51300And lmm51300UbiWith the phenotype of lmm5 without significantly different, equal spottiness, and
And dye through platform phenol indigo plant, find there is navy blue colored spots at speckle and around speckle, illustrate that the cell at this position is the most dead
Die or in the process of death, lmm51300And lmm51300UbiWith Nip.LMM5.1iRemain in that class pathological changes phenotype (Figure 11).
Illustrate that LMM5.1 and LMM5.4 all can have complementary functions the expression by inhibitation system of LMM5.1 gene and the cell death table that causes
Type.
By above-mentioned T0For lmm5LMM5.1And lmm5LMM5.4OEPositive transgenic plant carries out selfing, is no longer occurred shape to divide
From lmm5LMM5.1T2For positive transgenic plant (i.e. homozygous transgenic plant) and lmm5LMM5.4OET2For positive transgenic
Plant (i.e. homozygous transgenic plant), infects with bacterial leaf-blight biological strain PXO145, fine with Japan,
Nip.LMM5.1i、lmm51300And lmm51300UbiFor comparison, specifically infect method as follows:
The bacterial leaf-blight biological strain PXO145 being stored in-70 DEG C is inoculated into PSA culture medium (Rhizoma Solani tuber osi 300g/L,
Ca(NO3)2·4H2O 0.5g/L, Na2HPO4·12H2O 2.0g/L, sucrose 15g/L, agar powder 15g/L) on
Recovery, preserves to standby in 4 DEG C of refrigerators.Through after identifying that detecting it on rice varieties has standard toxicity, in connecing
Rule in PSA culture medium before kind, cultivate 72 hours for 28 DEG C.Treat the dense and uniform of antibacterial length, use pure washing
De-antibacterial, regulation concentration is to 109Cfu/ml inoculates.Connect bacterium (bacterium is infected) method and use artificial leaf-cutting inocalation method
(Kauffman,H.,Reddy,A.,Hsiek,S.and Merca,S.(1973).An improved technique
for evaluating resistance of rice varieties to Xanthomonas oryzae pv.oryzae.
Plant Dis.Rep.57,537-541.), every strain 3-5 blade of inoculation, each blade deducts top 1-2cm.
After inoculating two weeks, investigating when scab length is obvious and stablizes, each plant measures 3-5 blade, minimum tune
Look into 10 strains, seek its meansigma methods and calculate positive and negative deviation as Resistant index.
Two weeks " Invest, Then Investigate " state of an illness.Result shows, the bacterial leaf spot scab length of two kinds of transfer-gen plants is all fine with Japan substantially
Without significant difference, and it is considerably longer than lmm5 and lmm5 respectively1300(Figure 12): lmm5LMM5.1T2For positive transgenic
Plant, lmm5LMM5.4OET2For positive transgenic plant, fine, lmm5 and lmm5 of Japan1300Bacterial leaf spot scab length respectively
It is 6.8 ± 1.7cm, 6.6 ± 1.7cm, 6.5 ± 1.6cm, 1.3 ± 0.8cm and 1.0 ± 0.6cm, lmm5LMM5.1T2Generation
The bacterial leaf spot scab length of positive transgenic plant is respectively fine, lmm5 and lmm5 of Japan13001.0 times, 5.2 times and
6.8 times, lmm5LMM5.4OET2Bacterial leaf spot scab length for positive transgenic plant is respectively fine, lmm5 and lmm5 of Japan1300
1.0 times, 5.1 times and 6.5 times.Illustrate that LMM5.1 and LMM5.4 all can reply to be subject to by the expression of LMM5.1 gene
The plant disease resistance suppressed and cause strengthens phenotype, LMM5.1 and LMM5.4 all can reduce the disease resistance of Oryza sativa L..
Claims (10)
1. Protein L MM5.4 application in regulation and control disease resistance of plant and/or regulation and control plant allergy；Described egg
White matter LMM5.4 is following A1), A2) or A3):
A1) aminoacid sequence is the protein of sequence 5；
A2) by shown in sequence in sequence table 5 aminoacid sequence through one or several amino acid residue replacement and/
Or lack and/or add and have the protein of identical function；
A3) at A1) or N end A2) or/and C end connects the fused protein that label obtains.
2. the biomaterial relevant to Protein L MM5.4 described in claim 1 is at regulation and control disease resistance of plant and/or tune
Application in control plant allergy；Described biomaterial is following B1) to B14) in any one:
B1) nucleic acid molecules of Protein L MM5.4 described in coding claim 1；
B2) containing B1) expression cassette of described nucleic acid molecules；
B3) containing B1) recombinant vector of described nucleic acid molecules；
B4) containing B2) recombinant vector of described expression cassette；
B5) containing B1) recombinant microorganism of described nucleic acid molecules；
B6) containing B2) recombinant microorganism of described expression cassette；
B7) containing B3) recombinant microorganism of described recombinant vector；
B8) containing B4) recombinant microorganism of described recombinant vector；
B9) containing B1) the transgenic plant cells system of described nucleic acid molecules；
B10) containing B2) the transgenic plant cells system of described expression cassette；
B11) containing B1) Transgenic plant tissue of described nucleic acid molecules；
B12) containing B2) Transgenic plant tissue of described expression cassette；
B13) containing B1) the transgenic plant organ of described nucleic acid molecules；
B14) containing B2) the transgenic plant organ of described expression cassette.
Apply the most according to claim 2, it is characterised in that: B1) described nucleic acid molecules is following b1)-b3)
In any one:
B1) the cDNA molecule of sequence 4 or DNA molecular during nucleotide sequence is sequence table；
B2) nucleotide sequence and b1) limited has in 75% or more than 75% homogeneity, and coding claim 1
The cDNA molecule of described Protein L MM5.4 or genomic DNA molecule；
B3) under strict conditions with b1) nucleotide sequence hybridization that limits, and albumen described in coding claim 1
The cDNA molecule of matter LMM5.4 or genomic DNA molecule.
4. following of biomaterial described in Protein L MM5.4 described in claim 1 or Claims 2 or 3
One application:
H1, reduce the application in plant cultivating disease resistance；
H2, reduce the application in disease resistance of plant product in preparation；
H3, reduce the application in plant cultivating allergy；
H4, reduce the application in plant allergy product in preparation.
5. regulation and control disease resistance of plant or allergy product, containing Protein L MM5.4 described in claim 1 or
Biomaterial described in Claims 2 or 3.
The most following M1) or M2):
M1) method cultivating the transgenic plant that disease resistance reduces, including importing following 1 in recipient plant) or 2)
Obtain transgenic plant；
1) encoding gene of Protein L MM5.4 described in claim 1；
2) expression cassette of the encoding gene containing Protein L MM5.4 described in claim 1；
Described transgenic plant disease resistance compared with described recipient plant reduces；
M2) method cultivating the transgenic plant that allergy reduces, including importing described 1 in recipient plant)
Or described 2) obtain transgenic plant；The allergy compared with described recipient plant of described transgenic plant reduces.
Method the most according to claim 6, it is characterised in that: Protein L MM5.4 described in claim 1
Encoding gene be B1 in Claims 2 or 3) described nucleic acid molecules；Described expression cassette is in Claims 2 or 3
B2) described expression cassette.
8. according to product or claim 6 or 7 described in described application arbitrary in claim 1-4, claim 5
Described method, it is characterised in that: in claim 1-5, arbitrary described plant is monocotyledon or dicotyledon；
Purpose plant described in claim 6 or 7 and described recipient plant are monocotyledon or dicotyledon.
Application, described product or described method the most according to claim 8, it is characterised in that: described unifacial leaf is planted
Thing is grass.
10. according to described application arbitrary in claim 1-4, product described in claim 5, claim 6 or 7
Described method, or application, described product or described method described in claim 8 or 9, it is characterised in that:
Described disease resistance is bacterial blight-resisting or blast resisting；
And/or, described bacterial leaf-blight is caused by leaf spot bacteria, and described rice blast is caused by Pyricularia oryzae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459682.1A CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459682.1A CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105949292A true CN105949292A (en) | 2016-09-21 |
| CN105949292B CN105949292B (en) | 2019-11-01 |
Family
ID=56903746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610459682.1A Expired - Fee Related CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105949292B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104558130A (en) * | 2015-01-06 | 2015-04-29 | 中国农业大学 | Resistance-related protein and encoding gene thereof, and application of resistance-related protein and encoding gene for regulating and controlling plant disease resistance |
| CN105481958A (en) * | 2016-01-14 | 2016-04-13 | 扬州大学 | Application of protein OsOSM1 to regulation and control over plant disease resistance |
-
2016
- 2016-06-22 CN CN201610459682.1A patent/CN105949292B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104558130A (en) * | 2015-01-06 | 2015-04-29 | 中国农业大学 | Resistance-related protein and encoding gene thereof, and application of resistance-related protein and encoding gene for regulating and controlling plant disease resistance |
| CN105481958A (en) * | 2016-01-14 | 2016-04-13 | 扬州大学 | Application of protein OsOSM1 to regulation and control over plant disease resistance |
Non-Patent Citations (5)
| Title |
|---|
| GENBANK: "XM_015778041.1", 《GENBANK》 * |
| HONGLIN CHEN等: "The Fd-GOGAT1 mutant gene lc7 confers resistance to Xanthomonas oryzae pv. Oryzae inrice", 《SCIENTIFIC REPORTS》 * |
| JIYING ZHAO等: "LMM5.1 and LMM5.4, two eukaryotic translation elongation factor 1A-like gene family members, negatively affect cell death and disease resistance in rice", 《JOURNAL OF GENETICS AND GENOMICS》 * |
| KIKUCHI.S等: "AK100658", 《GENBANK》 * |
| 程晨: "两个抗病性增强的水稻类病变突变体基因的图位克隆及其功能的初步分析", 《万方数据》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105949292B (en) | 2019-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
| CN105859860A (en) | Application of disease resistance-related protein to regulation and control of plant disease resistance | |
| CN107653262B (en) | Application of the ZmCCT9 in regulation corn Characteristics in florescence | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN110078807A (en) | Promote the protein and its encoding gene of potassium ion efficient absorption | |
| CN101139385B (en) | Vegetable stress-resistant related protein and its coding gene and application | |
| CN103290014B (en) | Adversity inducible expression gene promoter and application thereof | |
| CN105713079B (en) | Protein and its relevant biological material are improving the application in plant products | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN106047833A (en) | OsCIPK31 and application of coding gene thereof in regulation of herbicide resistance of plants | |
| CN103088022B (en) | Plant-salt-induced expression promoter | |
| CN103588867B (en) | Soybean transcription factor GmMYB174a, and coding gene and applications thereof | |
| CN101704884B (en) | Plant drought resistance and salt tolerance associated protein EeABF6, coding gene and application thereof | |
| CN105820220A (en) | Stress resistance relevant protein and application of coding gene in regulating alkali resistance of plants | |
| CN105859858A (en) | Application of TaNAC47 protein derived from wheat and related biological materials thereof in improving plant resistance | |
| CN105949292A (en) | Application of protein LMM5.4 in regulating disease resistance and hypersensitivity of plants | |
| CN105713078A (en) | Application of drought-tolerance-related protein in regulating drought tolerance of plants | |
| CN106011098A (en) | Resistance-related cotton protein GaGSTF2, as well as coding gene and application thereof | |
| CN106084022A (en) | Protein L MM5.1 is in regulation and control disease resistance of plant and the application in allergy | |
| CN102140133B (en) | Protein ErABF1 related to drought resistance and salt tolerance of plant and encoding gene and application thereof | |
| CN109811005A (en) | The application of plant type GAP-associated protein GAP OsSLA1 and its encoding gene in adjusting and controlling rice Leaf inclination | |
| CN104087587A (en) | Plant drought stress induction expression promoter and application thereof | |
| CN103614385A (en) | Application of gene KT525 to improvement of stress tolerance of plants | |
| WO2003018818A2 (en) | Method and means for modulating plant cell cycle proteins and their use in plant cell growth control | |
| CN103923197B (en) | Derive from the disease resistance associated protein TaVIP2 of wheat and relevant biological material thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191101 Termination date: 20210622 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |