CN105949292B - Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity - Google Patents
Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity Download PDFInfo
- Publication number
- CN105949292B CN105949292B CN201610459682.1A CN201610459682A CN105949292B CN 105949292 B CN105949292 B CN 105949292B CN 201610459682 A CN201610459682 A CN 201610459682A CN 105949292 B CN105949292 B CN 105949292B
- Authority
- CN
- China
- Prior art keywords
- plant
- protein
- contain
- sequence
- disease resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Abstract
The invention discloses application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity.In application disclosed by the invention, Protein L MM5.4 is following A1), A2) or A3): A1) amino acid sequence is the protein of sequence 5；A2) by amino acid sequence shown in sequence 5 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues and protein with the same function；A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.It is demonstrated experimentally that LMM5.4 of the invention is related to the disease resistance of plant, the hypersensitivity of plant can also be regulated and controled, can use the disease resistance and hypersensitivity of LMM5.4 and its gene regulation plant.
Description
Technical field
The present invention relates to Protein L MM5.4 in field of biotechnology in regulation disease resistance of plant and hypersensitivity
Using.
Background technique
In order to cope with the attack of pathogen in natural environment, plant evolution goes out complicated defense mechanism.Wherein, most effective
Mode first is that hypersensitivity (Hypersensitive response, HR).Hypersensitivity refers to when plant is by non-affine disease
It after opportunistic pathogen infects, is infected that position cell is dead rapidly, to limit a kind of defense response of pathogen proliferation, belongs to cell journey
Sequence death (programmed cell death, PCD) (Greenberg, 1997).Lesion mimic (lesion mimic
Mutants) in the case where no pathogen infection, the necrotic plaque (lesion) of the similar hypersensitivity of formation that can be spontaneous,
Therefore lesion mimic is the important materials for studying plant cell death, hypersensitivity and defense response.Lesion mimic
Most early in report (Hoisington et al., 1982) in corn, then in barley (Wolter et al., 1993), quasi- south
Mustard (Dietrich et al., 1994；Greenberg and Ausubel,1993；Greenberg et al., 1994), water
It is found in the species such as rice (Takahashi et al., 1999).Rice is right as important cereal crops and model plant
Its cell death and the research of disease resistance mechanisms have great importance.
Summary of the invention
The technical problem to be solved by the present invention is to how regulate and control the disease resistance of plant and hypersensitivity.
In order to solve the above technical problems, present invention firstly provides Protein L MM5.4 regulation disease resistance of plant and/or
Regulate and control the application in plant hypersensitivity；The Protein L MM5.4 is following A1), A2) or A3):
A1) amino acid sequence is the protein of sequence 5；
A2) by amino acid sequence shown in sequence 5 in sequence table by one or several amino acid residues substitution and/or
Deletion and/or addition and protein with the same function；
A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.
Wherein, sequence 5 is made of 656 amino acid residues.
In order to make A1) in protein convenient for purifying, amino acid sequence shown in sequence 5 can be formed in by sequence table
The amino terminal or carboxyl terminal of protein connect upper label as shown in Table 1.
The sequence of table 1, label
Above-mentioned A2) in, the substitution and/or deletion and/or addition of one or several amino acid residues is no more than 10
The substitution and/or deletion and/or addition of a amino acid residue.
Above-mentioned A2) in LMM5.4 can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression and obtain.
Above-mentioned A2) in the encoding gene of LMM5.4 can be by the way that one or several ammonia will be lacked in DNA sequence dna shown in sequence 4
The codon of base acid residue, and/or the missense mutation of one or several base-pairs is carried out, and/or connect at its 5 ' end and/or 3 ' ends
The coded sequence of label shown in upper table 1 obtains.
In order to solve the above technical problems, the present invention also provides biomaterials relevant to LMM5.4 in regulation plant disease-resistant
Property and/or regulation plant hypersensitivity in application；The biomaterial is any one of following B1) to B14):
B1 the nucleic acid molecules of LMM5.4) are encoded；
B2) contain B1) expression cassettes of the nucleic acid molecules；
B3) contain B1) recombinant vectors of the nucleic acid molecules；
B4) contain B2) recombinant vector of the expression cassette；
B5) contain B1) recombinant microorganisms of the nucleic acid molecules；
B6) contain B2) recombinant microorganism of the expression cassette；
B7) contain B3) recombinant microorganism of the recombinant vector；
B8) contain B4) recombinant microorganism of the recombinant vector；
B9) contain B1) the transgenic plant cells systems of the nucleic acid molecules；
B10) contain B2) the transgenic plant cells system of the expression cassette；
B11) contain B1) Transgenic plant tissues of the nucleic acid molecules；
B12) contain B2) Transgenic plant tissue of the expression cassette；
B13) contain B1) the genetically modified plants organs of the nucleic acid molecules；
B14) contain B2) the genetically modified plants organ of the expression cassette.
In above-mentioned application, B1) nucleic acid molecules are following b1)-b3) and in it is any:
B1) nucleotide sequence is the cDNA molecule or DNA molecular of sequence 4 in sequence table；
B2 the nucleotide sequence) and b1) limited has 75% or 75% or more identity, and encodes cDNA points of LMM5.4
Son or genomic DNA molecule；
B3) the nucleotide sequence hybridization limited under strict conditions with b1), and encode the cDNA molecule or gene of LMM5.4
Group DNA molecular.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, sequence 4 is made of 1971 nucleotide, protein shown in coded sequence 5.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding LMM5.4 of the invention.Those have and the present invention point by manually modified
The nucleotide of nucleotide sequence 75% or higher identity from obtained LMM5.4, as long as encoding LMM5.4 and having
LMM5.4 function is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Amino acid sequence shown in bright coded sequence 5 composition protein nucleotide sequence have 75% or higher or 85% or
Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software
It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with
For evaluating the identity between correlated series.
In above-mentioned application, the stringent condition is to hybridize at 68 DEG C in 2 × SSC, the solution of 0.1%SDS and wash film
2 times, each 5min, but in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, each 15min；
Or, hybridizing under the conditions of 65 DEG C in the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS and washing film.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
In above-mentioned application, B2) described in the nucleic acid molecules containing coding LMM5.4 expression cassette (LMM5.4 gene expression
Box), it is the DNA for referring to express LMM5.4 in host cell, which not only may include starting opening for LMM5.4 genetic transcription
Mover may also include the terminator for terminating LMM5.4 genetic transcription.Further, the expression cassette may also include enhancer sequence.
Promoter for use in the present invention includes but is not limited to: constitutive promoter, organizes, the promoter that organ and development are special, and
Inducible promoter.The example of promoter includes but is not limited to: constitutive promoter 35S: Lai Zixi of cauliflower mosaic virus
The wound-inducible promoter of red persimmon, leucine aminopeptidase (" LAP ", Chao et al. (1999) Plant Physiol 120:
979-992)；Chemical inducible promoter from tobacco, pathogenesis correlation 1 (PR1) is (by salicylic acid and BTH (benzo thiophene two
Azoles -7- carbothioic acid S-methyl ester) induction)；Tomato protease inhibitors II promoter (PIN2) or LAP promoter are (available
Methyl jasmonate induction)；Heat-shock promoters (United States Patent (USP) 5,187,267)；Tetracycline inducible promoter (United States Patent (USP)
5,057,422)；Seed specific promoters, such as Millet Seed specificity promoter pF128 (CN101063139B (Chinese patent
200710099169.7)), the special promoter of seed storage protein matter (for example, phaseolin, napin, oleosin and big
The promoter (Beachy et al. (1985) EMBO is J.4:3047-3053) of beans beta conglycin).They can be used alone
Or it is used in combination with other plant promoters.All references cited herein is cited in full text.Suitable tanscription termination
Son includes but is not limited to: Agrobacterium nopaline syntase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S are terminated
Son, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g.: Odell
Et al. (I985)Nature 313:810；Rosenberg et al. (1987) Gene, 56:125；Guerineau et al. (1991)
Mol.Gen.Genet,262:141；Proudfoot(1991)Cell,64:671；Sanfacon et al. Genes Dev., 5:
141；Mogen et al. (1990) Plant Cell, 2:1261；Munroe et al. (1990) Gene, 91:151；Ballad et al.
(1989)Nucleic Acids Res.17:7891；Joshi et al. (1987) Nucleic Acid Res., 15:9627).
The recombinant vector of LMM5.4 expression casette can be contained with existing expression vector establishment.The plant expression vector
Including double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438, pCAMBIA1302,
PCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb
(CAMBIA company) etc..The plant expression vector also may include 3 ' end untranslated regions of foreign gene, that is, include poly- adenosine
Acid signal and any other DNA fragmentation for participating in mRNA processing or gene expression.Poly- adenosine may be guided in the polyadenylation signals
Acid be added to mRNA precursor 3 ' end, as Agrobacterium crown gall nodule induction (Ti) plasmid gene (such as rouge alkali synthetase gene Nos),
The non-translational region of the end of plant gene (such as soybean storage protein genes) 3 ' transcription all has similar functions.Use gene of the invention
When constructing plant expression vector, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can
To be ATG initiation codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, it is whole to guarantee
The correct translation of a sequence.The source of the translation control signal and initiation codon be it is extensive, can be it is natural, can also
To be synthesis.Translation initiation region can come from transcription initiation region or structural gene.For the ease of thin to genetically modified plants
Born of the same parents or plant identify and screen, and can process to plant expression vector used, as the volume that can be expressed in plant is added
Code can produce the label base of the enzyme of color change or the gene (gus gene, luciferase genes etc.) of luminophor, antibiotic
Because (if assigned the nptII gene to kanamycins and associated antibiotic resistance, assigning the bar to herbicide phosphinothricin resistance
Gene assigns the hph gene to antibiotic hygromycin resistance, and assigns the dhfr gene to methotrexate resistance, assigns to grass
The EPSPS gene of sweet phosphorus resistance) or anti-chemical reagent marker gene etc. (such as anti-herbicide gene), provide metabolism mannose energy
The mannose-6-phosphate isomerase gene of power.From the security consideration of genetically modified plants, any selected marker base can be not added
Cause directly screens transformed plant with adverse circumstance.
In above-mentioned application, the carrier can be plasmid, sticking grain, bacteriophage or viral vectors.The plasmid is concretely
PCAMBIA1300 or pTCK303.
B3) recombinant vector contains the DNA sequence dna for being used to encode LMM5.4 shown in sequence 4；Further B3) it is described
Recombinant vector concretely pUbi::LMM5.4.The pUbi::LMM5.4 is that Kpn I and the Spe I of pTCK303 is identified position
DNA sequence dna between point replaces with the recombinant vector of LMM5.4 shown in the expressed sequence 5 that DNA sequence dna shown in sequence 4 obtains.
In above-mentioned application, the microorganism can be yeast, bacterium, algae or fungi.The bacterium concretely Agrobacterium, such as
Agrobacterium EHA105.
In above-mentioned application, the transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ are not wrapped
Include propagation material.
In order to solve the above technical problems, the present invention also provides following any applications of LMM5.4 or the biomaterial:
H1, the application in disease resistance reduction plant is being cultivated；
H2, the application in disease resistance of plant product is reduced in preparation；
H3, the application in hypersensitivity reduction plant is being cultivated；
H4, the application in plant hypersensitivity product is reduced in preparation.
In order to solve the above technical problems, the present invention also provides regulation disease resistance of plant or hypersensitivity product, it is described
Product contains LMM5.4 or the biomaterial.
In the said goods, the product can also be incited somebody to action using LMM5.4 or the biomaterial as active constituent
The composition that LMM5.4 or the biomaterial and other disease resistance substances are combined is as active constituent.
In order to solve the above technical problems, the present invention also provides following M1) or M2):
M1 the method for) cultivating the genetically modified plants that disease resistance reduces, including import into recipient plant it is following 1) or 2)
To genetically modified plants；
1) encoding gene of LMM5.4；
2) expression cassette of the encoding gene containing LMM5.4；
Genetically modified plants disease resistance compared with the recipient plant reduces；
M2 the method for) cultivating the genetically modified plants that hypersensitivity reduces, including import into recipient plant it is described 1) or
It is described 2) to obtain genetically modified plants；Genetically modified plants hypersensitivity compared with the recipient plant reduces.
In an embodiment of the present invention, the encoding gene (i.e. DNA molecular shown in sequence 4) of the LMM5.4 is by containing
The LMM5.4 gene recombinant vectors of LMM5.4 expression casette import in purpose plant.
In the above method, wherein the LMM5.4 gene can be modified first as follows, then import in receptor seed plant, with
Reach better expression effect:
1) it modifies and optimizes according to actual needs, so that gene efficient expression；For example, can be according to recipient plant institute partially
The codon of love changes its codon while keeping the amino acid sequence of LMM5.4 gene of the present invention to meet plant
Preferences；In optimization process, it is desirable that certain G/C content is kept in the coded sequence after optimization, to be best implemented with plant
The high level expression of middle quiding gene, wherein G/C content can be 35%, be more than 45%, more than 50% or more than about 60%；
2) gene order of neighbouring initial methionine is modified, so that translation effectively starting；For example, using in plant
The effective sequence known is modified；
3) it is connect with the promoter of various plants expression, in favor of its expression in plant；The promoter may include
Composing type, induction type, timing adjusting, growth adjustment, Chemical Regulation, tissue are preferably and tissue-specific promoter；Promoter
Selection will need with expression time and space and be changed, and also depend on target kind；Such as the specificity of tissue or organ
Promoter is expressed, receptor as needed is depending on what period of development；Although demonstrating many from dicotyledon
Promoter can act in monocotyledon, and vice versa, but it is desirable to select dicot promoters are used for
Expression in dicotyledon, monocotyledonous promoter is for the expression in monocotyledon；
4) it is connect with suitable transcription terminator, can also be improved the expression efficiency of gene of the present invention；Such as from
The tml of CaMV, from the E9 of rbcS；Any known available terminator to work in plant can be with the present invention
Gene is attached；
5) enhancer sequence is introduced, such as intron sequences (such as from Adhl and bronzel) and viral leader sequence
(such as from TMV, MCMV and AMV).
The LMM5.4 expression vector can be turned by using Ti-plasmids, Ri plasmid, plant viral vector, direct DNA
The conventional biology methods such as change, microinjection, conductance, mediated by agriculture bacillus, particle gun convert plant cell or tissue, and will conversion
Plant tissue cultivate at plant.
The method also includes the screening expression volumes from the plant of encoding gene for importing LMM5.4 shown in sequence 4
The plant of code gene, obtains genetically modified plants.
In the present invention, the genetically modified plants are interpreted as not only comprising obtaining the LMM5.4 genetic transformation purpose plant
First generation genetically modified plants, also include its filial generation.For genetically modified plants, the gene can be bred in the species, it can also
The gene transfer is entered to other kinds of same species with traditional breeding techniques, particularly including in commercial variety.It is described to turn base
Because plant includes seed, callus, intact plant and cell.
In the present invention, the plant can be monocotyledon or dicotyledon；The purpose plant and the receptor are planted
Object can be monocotyledon or dicotyledon.The monocotyledon is gramineae plant, such as rice.
In the present invention, the disease resistance can be bacterial blight-resisting or blast resisting.The bacterial leaf-blight can be by bacterial leaf-blight
Bacterium causes, and the rice blast can be caused by Pyricularia oryzae.The leaf spot bacteria can be bacterial leaf-blight biological strain PXO145, institute
Stating Pyricularia oryzae can be rice blast biological strain JL062401, JL021605, G9, G11, B8 and/or B23.
It is demonstrated experimentally that LMM5.4 of the invention is related to the disease resistance of plant.LMM5.4 can reduce the disease resistance of plant:
It is infected with leaf spot bacteria and turns LMM5.4 gene plant, turn the bacterial leaf spot scab length (6.6 ± 1.7cm) of LMM5.4 gene plant
LMM5.4 gene plant (1.3 ± 0.8cm) is not turned considerably longer than.LMM5.4 of the invention can regulate and control the hypersensitivity of plant
Property.LMM5.4 can reduce the hypersensitivity of plant: LMM5.4 gene gone in the plant that hypersensitivity occurs, it is super quick anti-
Answering property declines.It is demonstrated experimentally that can use the disease resistance and hypersensitivity of LMM5.4 and its gene regulation plant.
Biomaterial preservation explanation
The classification naming of biomaterial: rice (Oryza sativa)
The strain number of biomaterial: lmm5
Depositary institution's title of biomaterial: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Depositary institution's abbreviation of biomaterial: CGMCC
The depositary institution address of biomaterial: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Chinese Academy of Sciences microorganism
Research institute, postcode: 100101
The preservation date of biomaterial: on May 27th, 2016
The collection of biomaterial is registered on the books number: CGMCC No.11947
Detailed description of the invention
Fig. 1 is the structural schematic diagram between the LB and RB of pTCK300-RNAi.
Fig. 2 is expression of the lmm5 in RNAi inhibition transgenic plant.
Fig. 3 is the phenotypic evaluation of mutant lmm5.Wherein, A is whole strain phenotype, and B is leaf morphology, and C is leaf sheath phenotype.
Fig. 4 is platform phenol indigo plant coloration result.
Fig. 5 is that RNAi inhibits transgenic plant Nip.LMM5.1iPhenotype.
Fig. 6 is the bacterial leaf spot scab length that RNAi inhibits transgenic plant.
Fig. 7 is the resistance investigation of OryzasativaLcv.Nipponbare and lmm5 to rice blast.
Fig. 8 is the resistance investigation of OryzasativaLcv.Nipponbare and lmm5 to 5 bacterial leaf-blight microspecies.
Fig. 9 is the structure between the LB and RB of expression vector pLMM5.1::LMM5.1.
Figure 10 is the structure between the LB and RB of expression vector pUbi::LMM5.4.
Figure 11 is the phenotype of transgenic plant.
Figure 12 is the bacterial leaf spot scab length of transgenic plant.
Wherein, Nip. indicates OryzasativaLcv.Nipponbare.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
In following embodiments pTCK303 (Wang, M., Chen, C., Xu, Y.Y., Jiang, R.X., Han, Y., Xu,
Z.H.,and Chong,K.(2004).A practical vector for efficient knockdown of gene
expression in rice(Oryza sativa L.).Plant Molecular Biology Reporter 22,409-
417.) public can obtain the biomaterial from applicant, which only attaches most importance to used in the related experiment of duplicate invention, no
It can be used as other purposes to use.
In following embodiments bacterial leaf-blight biological strain PXO145 (Chen, H., Li, C., Liu, L., Zhao, J.,
Cheng,X.,Jiang,G.,and Zhai,W.(2016).The Fd-GOGAT1mutant gene lc7confers
Resistance to Xanthomonas oryzae pv.Oryzae in rice.Scientific reports 6.) public
It can be obtained from applicant, which only attaches most importance to used in the related experiment of duplicate invention, not can be used as other purposes and uses.
Rice blast biological strain B23 (Sun Yan, Wang Yunyue, He Yueqiu, Li Chengyun, Zhou Jianghong, Zhu You in following embodiments
Bravely, application of the Candidate Disease Resistant Genes in rice varieties Study on Diversity, Scientia Agricultura Sinica, 2005,38 (11): 2227-
2232) public can obtain from applicant, which only attaches most importance to used in the related experiment of duplicate invention, not can be used as other
Purposes uses.
The disease resistance of rice can be improved in the expression of embodiment 1, inhibition LMM5.1 gene
One, the building of LMM5.1 RNAi plasmid pTCK303-LMM5.1i
1, the total serum IgE of rice varieties OryzasativaLcv.Nipponbare, reverse transcription cDNA are extracted.
2, according to CDS the primers RNAi-F and RNAi-R of LMM5.1, wherein Spe is added in the 5 ' ends in RNAi-F
I/BamH of Sac, I restriction enzyme site is added at the 5 ' ends of RNAi-R in I/Kpn, I restriction enzyme site.
RNAi-F:5 '-actagtggtaccAGAATGAGGATGTGGCCCAG-3 '
RNAi-R:5 '-gagctcggatccTTCACTGCTTTCATCCATAGCC-3 '
3, using the cDNA of step 1 as template, PCR amplification is carried out with the primer pair that RNAi-F and RNAi-R is formed, is expanded
Increase production object.
4, amplified production is recycled, is connect with pEASY-Blunt carrier (Beijing Quanshijin Biotechnology Co., Ltd), is obtained
Recombinant vector pEASY-LMM5.1i.
5, with I digested plasmid pEASY-LMM5.1i of restriction enzyme Kpn I and BamH, the digestion of 338bp or so is recycled
Product；With I digestion RNAi binary vector pTCK303 of restriction enzyme Kpn I and BamH, skeleton carrier is recycled；It will be above two
Recovery product is connected, and the correct carrier of sequence is named as intermediate vector pTCK303-LMM5.1i-reverse by sequencing.
6, with I digestion pEASY-LMM5.1i of restriction enzyme Spe I and Sac, the digestion products of 350bp or so are recycled；
With I digestion intermediate vector pTCK303-LMM5.1i-reverse of restriction enzyme Spe I and Sac；Above two recycling is produced
Object is connected, and the correct carrier of sequence is named as pTCK303-LMM5.1i by sequencing.
It is identified, the structure of pTCK303-RNAi is described as follows: after plant Zea mays Ubiquitin promoter according to sequencing
BamHI and KpnI recognition site between nucleotides sequence shown in the 515bp to 840bp of sequence 1 in reversed insetion sequence table
Column are followed by the included rice introne of a carrier, the positive insertion between SpeI the and SacI recognition site after introne
Nucleotide sequence shown in 1 515bp to 840bp of sequence in sequence table.Between the LB and RB of recombinant plasmid pTCK300-RNAi
Structural schematic diagram see Fig. 1.
Two, the acquisition of genetically modified plants
PTCK303-RNAi is imported in Agrobacterium EHA105, turning for obtained recombinational agrobacterium and mediated by agriculture bacillus is utilized
Genetic method (Kumar et al., 2005) conversion OryzasativaLcv.Nipponbare, obtains 47 T0For positive transgenic plant (Nip.LMM5.1i)。
PTCK303 is imported in Agrobacterium EHA105, OryzasativaLcv.Nipponbare is converted, obtains turning empty carrier plant.
In 47 T0For positive transgenic plant (Nip.LMM5.1i) in randomly select 15 plants (line1-line15), using drawing
Object is right on rna level to (LMM-F:CTTGACTCTCCAGGCCATAAA and LMM-R:GTCCATGCCAGCTTCAAATG)
The expression quantity of LMM5.1 gene is detected, as a result as indicated with 2, the results show that compared with wild type (Nip.), respectively
Nip.LMM5.1iThe expression quantity of LMM5.1 gene in strain is remarkably decreased.
Three, the phenotypic evaluation and Disease Resistance Identification of transgenic plant
Mutant lmm5 spontaneously forms the spot of brown since seedling stage on the mutant blade, when complete leaf extract out with
Afterwards, it also will appear similar spot on leaf sheath, these spots are in distribute shape to be individually present, and be continued until plant natural death
Die (Fig. 3).
It is whether dead with the cell on blue (Trypan Blue) the decoration method detection lmm5 blade of platform phenol at brown spot.Platform
Phenol indigo plant is a kind of cell activity dyestuff, normal living cells after birth structural integrity, and platform phenol indigo plant not can enter intracellular, and cell can not be by
Dyeing；And when cell death or the cell membrane irreversible damage of appearance, the permeability of after birth increases, and cell can be dyed by platform phenol indigo plant
Blue.It is found after the dyeing of platform phenol indigo plant, without the generation of blue spot on the blade of OryzasativaLcv.Nipponbare, and spot on mutant lmm5 blade
There are navy blue colored spots around place and spot, illustrates in the dead or dead process of the cell at the position (Fig. 4).
And in 47 T0For Nip.LMM5.1iIn positive transgenic plant, 43 plants of blade is shown and lmm5 phase with leaf sheath
With phenotype (Fig. 5), blade and leaf sheath form the spot of brown, and on platform phenol indigo plant dyeing discovery plant at spot and spot week
Navy blue colored spots are with, are shown in the dead or dead progress of the cell at spot position；Turn empty carrier plant with
The basic indifference of the phenotype of OryzasativaLcv.Nipponbare, without brown spot.
By above-mentioned 43 plants of T0For Nip.LMM5.1iPositive transgenic plant is selfed, and obtains that trait segregation no longer occurs
Nip.LMM5.1i T2For positive transgenic plant (i.e. homozygous transgenic plant), invaded with bacterial leaf-blight biological strain PXO145
Dye with OryzasativaLcv.Nipponbare, turns empty carrier plant and lmm5 as control, it is as follows specifically to infect method:
The bacterial leaf-blight biological strain PXO145 for being stored in -70 DEG C is inoculated into PSA culture medium (potato 300g/L, Ca
(NO3)2·4H2O 0.5g/L, Na2HPO4·12H2O 2.0g/L, sucrose 15g/L, agar powder 15g/L) on recover, save to 4
It is spare in DEG C refrigerator.After detecting it with standard toxicity on identification rice varieties, drawn on PSA culture medium before inoculation
Line, 28 DEG C are cultivated 72 hours.Concentration is adjusted to 10 with pure water eluting bacterial to the dense and uniform of bacterium length9Cfu/ml into
Row inoculation.Bacterium (bacterium is infected) method is connect using artificial leaf-cutting inocalation method (Kauffman, H., Reddy, A., Hsiek, S.and
Merca,S.(1973).An improved technique for evaluating resistance of rice
Varieties to Xanthomonas oryzae pv.oryzae.Plant Dis.Rep.57,537-541.), every plant of inoculation
3-5 blade, each blade subtract top 1-2cm.Inoculation after two weeks, is investigated, often when scab length is obvious and stablizes
One plant measures 3-5 blade, and minimum 10 plants of investigation is averaged and calculates positive and negative deviation as Resistant index.
The state of an illness is investigated after two weeks.The results show that Nip.LMM5.1iTransgenic plant bacterial leaf spot scab length (0.7 ±
0.6cm) with lmm5 (1.3 ± 0.8cm) without significant difference, but considerably shorter than OryzasativaLcv.Nipponbare (6.5 ± 1.6cm) (Fig. 6), turn empty carrier
The bacterial leaf spot scab length and OryzasativaLcv.Nipponbare of plant are without significant difference.
These results suggest that being interfered by the expression to LMM5.1 in OryzasativaLcv.Nipponbare, no matter transgenic plant is in phenotype
Above or in disease resistance, consistent with lmm5 mutant, the disease resistance enhancing of rice after the expression of LMM5.1 is interfered.
Above, lmm5 (lesion mimic mutant 5) is by OryzasativaLcv.Nipponbare (Oryza sativa
Ssp.japonica the stable lesion mimic of the character) obtained, during lmm5 has been preserved on May 27th, 2016
State's Microbiological Culture Collection administration committee common micro-organisms center, collection are registered on the books number: CGMCC No.11947.
Using seedling stage spray-on process and tillering stage injection method to OryzasativaLcv.Nipponbare and lmm5 be inoculated with 6 rice blast biological strain JL062401,
JL021605, G9, G11, B8 and B23 carry out resistance investigation respectively at three days and after a week.The results show that no matter going back in seedling stage
It is to have apparent rice blast scab on the OryzasativaLcv.Nipponbare blade for take over bacterium in tillering stage, illustrates that this six microspecies are OryzasativaLcv.Nipponbare
Affine microspecies；On the lmm5 blade for taking over bacterium, although there is the brown necrotic plaque spontaneously formed, it is almost absent Pyricularia oryzae and invades
The trace (Fig. 7) of dye.Therefore, lmm5 has higher resistance to all rice blast microspecies for detection.Divided with leaf-cutting method
The tiller phase is inoculated with 5 bacterial leaf-blights biological strain PXO86, PXO71, PXO99, PXO145 and PXO280 to OryzasativaLcv.Nipponbare and lmm5, connects
Kind carries out Disease investigation after two weeks.The results show that OryzasativaLcv.Nipponbare has this 5 microspecies different degrees of susceptible, and lmm5 is right
Each microspecies show highly resistance (Fig. 8).The above results show that lmm5 is small to all rice blast for inoculation and bacterial leaf-blight
Kind resistance is significantly increased.
Embodiment 2, LMM5.1 and LMM5.4 can reduce the disease resistance of rice
One, the building of expression vector pLMM5.1::LMM5.1
1, the DNA of rice varieties OryzasativaLcv.Nipponbare is extracted.
2, using the DNA of step 1 as template, PCR is carried out with the primer pair that LMM5.1com1-F and LMM5.1com1-R is formed
Amplification, obtains the amplified production " segment a " of 5181bp.
LMM5.1com1-F:5 '-GGTTAATGTTGGCGCCGCTGGTGGTATTCATC-3 '
LMM5.1com1-R:5 '-CCAGGTAACAGATGAATCTTTGAAGTTGCATG-3 '
Amplified production is recycled, is connect with pEASY-Blunt carrier, construction recombination plasmid pEASY-a.
3, using the DNA of step 1 as template, PCR is carried out with the primer pair that LMM5.1com2-F and LMM5.1com2-R is formed
Amplification, obtains the amplified production " segment b " of 3196bp, wherein I restriction enzyme site of Xba is added in 5 ' ends.
LMM5.1com2-F:5 '-tctagaAGACTTTGGTGGTGACCCTGAGATA-3 '
LMM5.1com2-R:5 '-CAAATAACTAAAAGAGTGACGG-3 '
Amplified production is recycled, is connect with pEASY-Blunt carrier, construction recombination plasmid pEASY-b.
4, using the DNA of step 1 as template, PCR is carried out with the primer pair that LMM5.1com3-F and LMM5.1com3-R is formed
Amplification, obtains the amplified production " segment c " of 3342bp, wherein III restriction enzyme site of Hind is added in 3 ' ends.
LMM5.1com3-F:5 '-AAGCTTCGGCGTTGAACAGCTTATTGTT-3 '
LMM5.1com3-R:5 '-aagcttTGATCCCTCAACACCCCGATGAAAGAACAG-3 '
Amplified production is recycled, is connect with pEASY-Blunt carrier, construction recombination plasmid pEASY-c.
5, with the recombinant plasmid pEASY-c in III digestion step 4 of restriction enzyme Pst I and Hind, recycle 1742bp's
Insert Fragment；With III digestion binary expression vector pCAMBIA1300 of restriction enzyme Pst I and Hind, skeleton segment is recycled；
Above two recovery product is connected, middle interstitial granules pCAMBIA1300-c is obtained.
6, with the recombinant plasmid pEASY-b in I digestion step 3 of restriction enzyme Xba I and Pst, inserting for 3057bp is recycled
Enter segment；With the intermediate vector pCAMBIA1300-c in I digestion step 5 of restriction enzyme Xba I and Pst, recycles digestion and produce
Object；Above two recovery product is connected, middle interstitial granules pCAMBIA1300- (b+c) is obtained.
7, with the recombinant plasmid pEASY-a in I digestion step 2 of restriction enzyme BamH I and Mfe, recycle 3905bp's
Insert Fragment；With the middle interstitial granules pCAMBIA1300- (b+c) in I digestion step 6 of restriction enzyme BamH I and Mfe, recycling
Digestion products；Above two recovery product is connected, recombinant plasmid pCAMBIA1300- (a+b+c) is obtained, i.e., complementary expression carries
Body pLMM5.1::LMM5.1.
Identified according to sequencing, be described as follows to the structure of pLMM5.1::LMM5.1: pLMM5.1::LMM5.1 is in double base
The recombination that DNA molecular shown in sequence 3 obtains is inserted between III restriction enzyme site of BamH I and Hind of carrier pCAMBIA1300
Carrier, structural schematic diagram is shown in Fig. 9 between the LB and RB of recombinant plasmid pLMM5.1::LMM5.1.
1490-6521 of sequence 3 are the sequence of LMM5.1 gene, LMM5.1 protein shown in coded sequence 2,
The CDS sequence of LMM5.1 gene is as shown in sequence 1.In recombinant plasmid pLMM5.1::LMM5.1,1-1489 of sequence 3 are opened
The expression of dynamic LMM5.1 gene, the expression of 6522-8075 termination LMM5.1 genes of sequence 3.
Two, the building of expression vector pUbi::LMM5.4
1, bright extensive 63 total serum IgE of rice varieties, reverse transcription cDNA are extracted.
2, using the cDNA of step 1 as template, PCR expansion is carried out with the primer pair that LMM5.4OE1-F and LMM5.4OE1-R is formed
Increase, obtain the amplified production " segment d " of 1988bp, wherein being separately added into I digestion of Kpn I and Spe at 5 ' ends and 3 ' ends by primer
Site and protection base.
LMM5.4OE1-F:5 '-CGGggtaccATGCCACGCAAGGTTGTCTC-3 '
LMM5.4OE1-R:5 '-GGactagtTCAGTTCTGATCTTGCCGGAGTAC-3 '
3, with " the segment d " in I digestion step 2 of restriction enzyme Kpn I and Spe, recovery product.
4, with I digestion pTCK303 of restriction enzyme Kpn I and Spe, digestion skeleton carrier is recycled.
5, step 3 is connected with the recovery product in step 4, obtains recombinant vector, obtained recombinant vector is named as
pUbi::LMM5.4。
Identified according to sequencing, be described as follows to the structure of pUbi::LMM5.4: pUbi::LMM5.4 is in binary vector
It is inserted between Spe I and Kpn I recognition site after the Ubiquitin promoter of pTCK303 in sequence table shown in sequence 4
The recombinant vector that 1971bp LMM5.4 gene obtains.Structural schematic diagram between the LB and RB of recombinant plasmid pUbi::LMM5.4 is shown in
LMM5.4 protein shown in Figure 10, pUbi::LMM5.4 energy expressed sequence 5.
Three, the acquisition of genetically modified plants
PLMM5.1::LMM5.1 is imported in Agrobacterium EHA105, obtained recombinational agrobacterium and mediated by agriculture bacillus is utilized
Transgenic method (Kumar et al., 2005) conversion lmm5 (lmm5 has been preserved in the micro- life of China on May 27th, 2016
Object culture presevation administration committee common micro-organisms center, collection are registered on the books number: CGMCC No.11947), being obtained
41 T0For positive transgenic plant (lmm5LMM5.1)。
Plant expressing vector pCAMBIA1300 is imported in Agrobacterium EHA105, obtained recombinational agrobacterium and agriculture is utilized
Transgenic method (Kumar et al., 2005) the conversion lmm5 that bacillus mediates, obtains turning empty carrier rice, as transgenosis water
The control of rice.40 T0 are obtained altogether for positive transgenic plant (lmm51300)。
PUbi::LMM5.4 is imported in Agrobacterium EHA105, turning for obtained recombinational agrobacterium and mediated by agriculture bacillus is utilized
Genetic method (Kumar et al., 2005) conversion lmm5, obtains 33 T0For positive transgenic plant (lmm5LMM5.4OE)。
PTCK303 is imported in Agrobacterium EHA105, the transgenosis of obtained recombinational agrobacterium and mediated by agriculture bacillus is utilized
Method (Kumar et al., 2005) conversion lmm5, obtains turning empty carrier rice, the control as transgenic paddy rice.It obtains altogether
40 T0 are for positive transgenic plant (its entitled lmm51300Ubi)。
Four, the phenotypic evaluation and Disease Resistance Identification of transgenic plant
It tests in triplicate:
All 41 lmm5LMM5.1With 33 lmm5LMM5.4OE T0For on plant leaf and leaf sheath without the generation of uneven class sizes
(Figure 11), phenotype is identical as OryzasativaLcv.Nipponbare.lmm5LMM5.1And lmm5LMM5.4OET1Generation and T2The positive transgenic plant in generation is also without class
The generation of scab.And 40 lmm51300And lmm51300UbiPhenotype with lmm5 is without significantly different, equal spottiness, and through platform phenol
Indigo plant dyeing finds there are navy blue colored spots at spot and around spot, illustrates that the cell at the position is dead or dead
Process in, lmm51300And lmm51300UbiWith Nip.LMM5.1iStill maintain class lesion phenotype (Figure 11).Illustrate LMM5.1 and
LMM5.4 can have complementary functions cell death phenotype caused by the expression by inhibitation system of LMM5.1 gene.
By above-mentioned T0For lmm5LMM5.1And lmm5LMM5.4OEPositive transgenic plant is selfed, and obtains that shape no longer occurs
Isolated lmm5LMM5.1T2For positive transgenic plant (i.e. homozygous transgenic plant) and lmm5LMM5.4OET2It is planted for positive transgenic
Strain (i.e. homozygous transgenic plant), is infected with bacterial leaf-blight biological strain PXO145, with OryzasativaLcv.Nipponbare, Nip.LMM5.1i、
lmm51300And lmm51300UbiFor control, it is as follows specifically to infect method:
The bacterial leaf-blight biological strain PXO145 for being stored in -70 DEG C is inoculated into PSA culture medium (potato 300g/L, Ca
(NO3)2·4H2O 0.5g/L, Na2HPO4·12H2O 2.0g/L, sucrose 15g/L, agar powder 15g/L) on recover, save to 4
It is spare in DEG C refrigerator.After detecting it with standard toxicity on identification rice varieties, drawn on PSA culture medium before inoculation
Line, 28 DEG C are cultivated 72 hours.Concentration is adjusted to 10 with pure water eluting bacterial to the dense and uniform of bacterium length9Cfu/ml into
Row inoculation.Bacterium (bacterium is infected) method is connect using artificial leaf-cutting inocalation method (Kauffman, H., Reddy, A., Hsiek, S.and
Merca,S.(1973).An improved technique for evaluating resistance of rice
Varieties to Xanthomonas oryzae pv.oryzae.Plant Dis.Rep.57,537-541.), every plant of inoculation
3-5 blade, each blade subtract top 1-2cm.Inoculation after two weeks, is investigated, often when scab length is obvious and stablizes
One plant measures 3-5 blade, and minimum 10 plants of investigation is averaged and calculates positive and negative deviation as Resistant index.
The state of an illness is investigated after two weeks.The results show that the bacterial leaf spot scab length of two kinds of transgenic plants is basic with OryzasativaLcv.Nipponbare
Without significant difference, and it is considerably longer than lmm5 and lmm5 respectively1300(Figure 12): lmm5LMM5.1T2For positive transgenic plant,
lmm5LMM5.4OET2For positive transgenic plant, OryzasativaLcv.Nipponbare, lmm5 and lmm51300Bacterial leaf spot scab length be respectively 6.8 ±
1.7cm, 6.6 ± 1.7cm, 6.5 ± 1.6cm, 1.3 ± 0.8cm and 1.0 ± 0.6cm, lmm5LMM5.1T2For positive transgenic plant
Bacterial leaf spot scab length be respectively OryzasativaLcv.Nipponbare, lmm5 and lmm513001.0 times, 5.2 times and 6.8 times, lmm5LMM5.4OET2Generation
The bacterial leaf spot scab length of positive transgenic plant is respectively OryzasativaLcv.Nipponbare, lmm5 and lmm513001.0 times, 5.1 times and 6.5 times.
Illustrate that LMM5.1 and LMM5.4 can reply the enhancing phenotype of the plant disease resistance as caused by the expression by inhibitation system of LMM5.1 gene,
LMM5.1 and LMM5.4 can reduce the disease resistance of rice.
Claims (10)
1. application of the Protein L MM5.4 in regulation disease resistance of plant and/or regulation plant hypersensitivity；The protein
LMM5.4 is protein shown in sequence 5.
2. biomaterial relevant to Protein L MM5.4 described in claim 1 is planted in regulation disease resistance of plant and/or regulation
Application in object hypersensitivity；The biomaterial is any one of following B1) to B14):
B1 the nucleic acid molecules of Protein L MM5.4 described in claim 1) are encoded；
B2) contain B1) expression cassettes of the nucleic acid molecules；
B3) contain B1) recombinant vectors of the nucleic acid molecules；
B4) contain B2) recombinant vector of the expression cassette；
B5) contain B1) recombinant microorganisms of the nucleic acid molecules；
B6) contain B2) recombinant microorganism of the expression cassette；
B7) contain B3) recombinant microorganism of the recombinant vector；
B8) contain B4) recombinant microorganism of the recombinant vector；
B9) contain B1) the transgenic plant cells systems of the nucleic acid molecules；
B10) contain B2) the transgenic plant cells system of the expression cassette；
B11) contain B1) Transgenic plant tissues of the nucleic acid molecules；
B12) contain B2) Transgenic plant tissue of the expression cassette；
B13) contain B1) the genetically modified plants organs of the nucleic acid molecules；
B14) contain B2) the genetically modified plants organ of the expression cassette.
3. applying according to claim 2, it is characterised in that: B1) nucleic acid molecules are cDNA points of sequence 4 in sequence table
Son or DNA molecular.
4. any application in -3 according to claim 1, it is characterised in that: the plant is monocotyledon or dicotyledonous plant
Object.
5. applying according to claim 4, it is characterised in that: the monocotyledon is gramineae plant.
6. any application in -3 according to claim 1, it is characterised in that:
The disease resistance is bacterial blight-resisting or blast resisting；
The bacterial leaf-blight is caused by leaf spot bacteria, and the rice blast is caused by Pyricularia oryzae.
7. the method for cultivating the genetically modified plants that disease resistance reduces, including imports into recipient plant and following to obtain 1) or 2) turning base
Because of plant；
1) encoding gene of Protein L MM5.4 described in claim 1；
2) expression cassette of the encoding gene containing Protein L MM5.4 described in claim 1；
Genetically modified plants disease resistance compared with the recipient plant reduces；
The recipient plant is rice mutant lmm5.
1) or 2) it 8. the method for cultivating the genetically modified plants that hypersensitivity reduces, including imports into recipient plant and following to obtain
Genetically modified plants；
1) encoding gene of Protein L MM5.4 described in claim 1；
2) expression cassette of the encoding gene containing Protein L MM5.4 described in claim 1；
Genetically modified plants hypersensitivity compared with the recipient plant reduces；
The recipient plant is rice mutant lmm5.
9. method according to claim 7 or 8, it is characterised in that: the coding of Protein L MM5.4 described in claim 1
Gene is B1 in Claims 2 or 3) nucleic acid molecules；The expression cassette is B2 in Claims 2 or 3) expression cassette.
10. according to claim 7 or 8 the methods, it is characterised in that:
The disease resistance is bacterial blight-resisting or blast resisting；
The bacterial leaf-blight is caused by leaf spot bacteria, and the rice blast is caused by Pyricularia oryzae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459682.1A CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459682.1A CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105949292A CN105949292A (en) | 2016-09-21 |
| CN105949292B true CN105949292B (en) | 2019-11-01 |
Family
ID=56903746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610459682.1A Expired - Fee Related CN105949292B (en) | 2016-06-22 | 2016-06-22 | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105949292B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104558130A (en) * | 2015-01-06 | 2015-04-29 | 中国农业大学 | Resistance-related protein and encoding gene thereof, and application of resistance-related protein and encoding gene for regulating and controlling plant disease resistance |
| CN105481958A (en) * | 2016-01-14 | 2016-04-13 | 扬州大学 | Application of protein OsOSM1 to regulation and control over plant disease resistance |
-
2016
- 2016-06-22 CN CN201610459682.1A patent/CN105949292B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104558130A (en) * | 2015-01-06 | 2015-04-29 | 中国农业大学 | Resistance-related protein and encoding gene thereof, and application of resistance-related protein and encoding gene for regulating and controlling plant disease resistance |
| CN105481958A (en) * | 2016-01-14 | 2016-04-13 | 扬州大学 | Application of protein OsOSM1 to regulation and control over plant disease resistance |
Non-Patent Citations (5)
| Title |
|---|
| AK100658;Kikuchi.S等;《GenBank》;20081204;CDS，ORIGIN * |
| LMM5.1 and LMM5.4, two eukaryotic translation elongation factor 1A-like gene family members, negatively affect cell death and disease resistance in rice;Jiying Zhao等;《Journal of Genetics and Genomics》;20161227;第44卷;第107-118页 * |
| The Fd-GOGAT1 mutant gene lc7 confers resistance to Xanthomonas oryzae pv. Oryzae inrice;Honglin Chen等;《Scientific Reports》;20160523;6:26411 * |
| XM_015778041.1;GenBank;《GenBank》;20160301;CDS，ORIGIN * |
| 两个抗病性增强的水稻类病变突变体基因的图位克隆及其功能的初步分析;程晨;《万方数据》;20160330;摘要，第四章 突变体Z1828候选基因的克隆 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105949292A (en) | 2016-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105037521B (en) | A kind of and plant adversity resistance related protein TaWrky48 and its encoding gene and application | |
| CN105859860A (en) | Application of disease resistance-related protein to regulation and control of plant disease resistance | |
| CN102140443B (en) | Plant stress-resistant associated protein, and encoding gene and application thereof | |
| CN107653262B (en) | Application of the ZmCCT9 in regulation corn Characteristics in florescence | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| CN105566463B (en) | One kind albumen relevant to Chlorophyll synthesis and its encoding gene and application | |
| CN103224555B (en) | Plant development associated protein GhSOC1 and encoding gene thereof and application | |
| CN112457380A (en) | Protein for regulating and controlling content of fruit shape and/or fruit juice of plant, related biological material and application thereof | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN106047833B (en) | The application of OsCIPK31 and its encoding gene in regulation plant herbicide resistance | |
| CN105713079B (en) | Protein and its relevant biological material are improving the application in plant products | |
| CN105504031B (en) | From the grain weight GAP-associated protein GAP and its relevant biological material of soybean and application | |
| CN105949292B (en) | Application of the Protein L MM5.4 in regulation disease resistance of plant and hypersensitivity | |
| CN102021181B (en) | Application of paddy gene KT488 in improvement on stress resistance of plants | |
| CN107022011B (en) | A kind of soybean transcription factor GmDISS1 and its encoding gene and application | |
| CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
| CN103172717A (en) | Plant low potassium stress resistant related protein GmWRKY50 as well as encoding gene and application thereof | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN105713078A (en) | Application of drought-tolerance-related protein in regulating drought tolerance of plants | |
| CN103397048B (en) | Method for cultivation of transgenic wheat resisting take-all and sharp eyespot and related biological materials thereof | |
| CN106084022B (en) | Application of protein LMM5.1 in regulation and control of plant disease resistance and hypersensitive response | |
| CN106336453B (en) | A kind of verticillium wilt resistance of cotton by same GAP-associated protein GAP GaRPL18 and its encoding gene and application | |
| CN109811005A (en) | The application of plant type GAP-associated protein GAP OsSLA1 and its encoding gene in adjusting and controlling rice Leaf inclination | |
| CN105087591B (en) | Paddy rice root tip specific expression promoter POsRo3 | |
| CN103923197B (en) | Derive from the disease resistance associated protein TaVIP2 of wheat and relevant biological material thereof and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191101 Termination date: 20210622 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |