CN105925677A - Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction - Google Patents
Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction Download PDFInfo
- Publication number
- CN105925677A CN105925677A CN201610285932.4A CN201610285932A CN105925677A CN 105925677 A CN105925677 A CN 105925677A CN 201610285932 A CN201610285932 A CN 201610285932A CN 105925677 A CN105925677 A CN 105925677A
- Authority
- CN
- China
- Prior art keywords
- mir
- serum
- cerebral infarction
- exosomes
- acute
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses an application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction, wherein sequences of the miR-9-3p and miR-124-3p are shown as AUAAAGCUAGAUAACCGAAAGU and UAAGGCACGCGGUGAAUGCC. The exosomes in serum are precipitated by virtue of a high-molecular polyme, and the expression and differences of the brain tissue specific miR-9-3p and miR-124-3p in serum exosomes of a patient with stroke and a healthy person are analyzed by virtue of a real-time fluorescent quantitative polymerase chain reaction (PCR) technology. In the case of acute stroke, the brain tissue specific miR-9-3p and miR-124-3p enter peripheral blood in the form of the exosomes, with a level obviously increased in comparison with a control group, and expression quantities are positively correlated to a degree of brain injury; therefore, the miR-9-3p and miR-124-3p can be used as the markers for judging cerebral ischemic injury and degree.
Description
Technical field
The invention belongs to biotechnology and medical domain, be specifically related to outside a kind of serum secrete body miR-9-3p and miR-124-3p
Application as the diagnosis marker of acute cerebral infarction.
Background technology
Apoplexy is one of sickness rate and the higher disease of mortality rate in world wide, is the primary factor causing adult to be disabled.
Possess the feature of " five is high ", i.e. high incidence, high mortality, high disability rate, high relapse rate, great number diagnosis and treatment expense, to state
Family and patient home cause heavy financial burden.Ischemic Stroke (Ischemic stroke, IS) accounts for whole apoplexy
80% [Donnan GA, Fisher M, Macleod M, et al.Stroke [J] .Lancet, 2008,371 (9624): 1612-1623.], uses tectotype fine
The thromboembolism treatment of fibrillarin plasminogen-activating dose (t-PA), so that the revascularization of obturation is to save cerebral ischemic penumbra
For effective treatment means, but this is limited to narrow thrombolytic time window, the intravenous thrombolysis time of usual acute cerebral infarction at 4.5h,
This also becomes the bottleneck of current thromboembolism treatment, and therefore, early diagnosis has become the key of cerebral infarction successful treatment.Nuclear magnetic resonance, NMR
It is the maximally efficient method of current clinical diagnosis, but the inspection that the method there is also some problems, such as iconography is the most stagnant
After, the nuclear magnetic resonance check of acute cerebral infarction patients is without substantially changing in early days, this decision-making that all can have influence on clinic and treatment.
Additionally, due to the cost issues of this equipment have impact on its popularization, and the time delays checked also drastically influence patient and controls
Treat.Therefore the mark looking for diagnosis cerebral ischemia early diagnosis is the important topic of clinical apoplexy research.Study and sent out
Show the multiple protein marker that may be used for diagnosis of cerebral infarction, such as S-100 β [Dassan P, Keir G, Brown MM.Criteria for
a clinically informative serum biomarker in acute ischaemic stroke:a review of S100β[J].Cerebrovasc Dis,2009,
27 (3): 295-302.] and NSE [Anand N, Stead LG.Neuron-specific enolase as a marker for acute ischemic stroke:a
Systematic review [J] .Cerebrovasc Dis, 2005,20 (4): 213-219.], but they and NBD specific proteins, some its
He disease such as melanoma or tissue injury also can make it express increase, thus these protein are not preferable mark.
MicroRNA is the little molecule single stranded RNA of a kind of endogenic 22 nucleotide, by the 3`UTR of targeting mRNA
Degraded mRNA, or suppress its translation thus realization regulation [Wevers KP, Kruijff S, Speijers MJ, the et al. to gene expression
S-100B:a stronger prognostic biomarker than LDH in stage IIIB-C melanoma[J].Ann Surg Oncol,2013,20(8):
2772-2779.].There is also microRNAs in blood, they have higher stability and certain tissue specificity, are
The ideal chose of clinical diagnosis mark [Bartel DP.MicroRNAs:genomics, biogenesis, mechanism, andfunction [J] .Cell,
2004,116(2):281-297.].Study recently in discovery, acute cerebral infarction patients or cerebral ischemia animal model blood
MicroRNA expresses notable change, as let-7e in cerebral ischemia and atherosclerotic's serum [Creemers EE, Tijsen AJ,
Pinto YM.Circulating microRNAs:novel biomarkers and extracellular communicators in cardiovascular disease？[J].
Circ Res,2012,110(3):483-495.]、miR-21[Creemers EE,Tijsen AJ,Pinto YM.Circulating microRNAs:novel
biomarkers and extracellular communicators in cardiovascular disease？[J] .Circ Res, 2012,110 (3): 483-495.] and
miR-145[Peng G,Yuan Y,Wu S,et al.MicroRNA let-7e Is a Potential Circulating Biomarker of Acute Stage
Ischemic Stroke [J] .Transl Stroke Res, 2015,6 (6): 437-445.] level increases, and mirR-221 [Creemers EE, Tijsen AJ,
Pinto YM.Circulating microRNAs:novel biomarkers and extracellular communicators in cardiovascular disease？[J].
Circ Res, 2012,110 (3): 483-495.] and miR-210 [Tsai PC, Liao YC, Wang YS, et al.Serum microRNA-21 and
MicroRNA-221 as potential biomarkers for cerebrovascular disease [J] .J Vasc Res, 2013,50 (4): 346-354.] the most notable
Reduce, it is taken as that they can be as the blood markers thing of cerebral infarction early diagnosis.But they same inorganizable specificitys,
MiR-145 be mainly distributed on vascular smooth muscle cell [Creemers EE, Tijsen AJ, Pinto YM.Circulating microRNAs:
novel biomarkers and extracellular communicators in cardiovascular disease？[J].Circ Res,2012,110(3):483-495.]
MiRNA-210 is then oxygen sensitivity microRNA [Creemers EE, Tijsen AJ, Pinto YM.Circulating microRNAs:novel
biomarkers and extracellular communicators in cardiovascular disease？[J].Circ Res,2012,110(3):483-495.].
MiR-9-3p is one of microRNA of brain specificity and high expressed [Jia L, Hao F, Wang W, et al.Circulating
miR-145 is associated with plasma high-sensitivity C-reactive protein in acute ischemic stroke
patients[J].Cell Biochem Funct,2015,33(5):314-319.].Recently studying display, serum miR-9-3p can make
The mark of neurologic impairment is evaluated for Noninvasive.At animal model and the neurodegenerative diseases of nerve injury, such as AD
That all observes miR-9-3p level in patients serum increases [Zeng L, Liu J, Wang Y, et al.MicroRNA-210 as a
novel blood biomarker in acute cerebral ischemia[J].Front Biosci(Elite Ed),2011,3:
1265-1272.], and the level of miR-9-3p is relevant to degree of injury.It has also been found that serum in chmice acute spinal cord injury model
The level of middle miR-9-3p increases, it is believed that its can as assessment degree of injury and therapeutic effect mark [Cheng Y, Liu X,
Yang J,et al.MicroRNA-145,a novel smooth muscle cell phenotypic marker and modulator,
controls vascular neointimal lesion formation[J].Circ Res,2009,105(2):158-166.].With trimethyl
In the rat toxic model that stannic chloride (trimethyltin chloride TMT) is set up, TMT can cause neuronal death
With glial cell react, now in serum the level of miR-9-3p significantly increase [Mathew LK, Simon MC.mir-210:
a sensor for hypoxic stress during tumorigenesis[J].Mol Cell,2009,35(6):737-738.]。MiR-124
One of miRNA that in brain, content is the abundantest, express almost brain regional [Laterza OF, Lim L,
Garrett-Engele PW,et al.Plasma MicroRNAs as sensitive and specific biomarkers of tissue
injury[J].Clin Chem,2009,55(11):1977-1983.].In existing clinic and Research of Animal Model for Study display blood plasma
The horizontal compared with normal matched group of miR-124 dramatically increases [Weng H, Shen C, Hirokawa G, et al.Plasma miR-124
as a biomarker for cerebral infarction[J].Biomed Res,2011,32(2):135-141.,Rainer TH,Leung
LY,Chan CP,et al.Plasma miR-124-3p and miR-16 concentrations as prognostic markers in acute
stroke[J].Clin Biochem,2016.].Therefore secrete outside the present invention analyzes blood of patients with cerebral infarction miR-9-3p in body and
The level change of miR-124-3p, and provide and secrete body miR-9-3p and miR-124-3p outside serum as diagnosis of acute cerebral infarction
The application of mark.
Summary of the invention
Goal of the invention: it is an object of the invention to overcome the deficiency to diagnosis of acute cerebral infarction in prior art, it is provided that a kind of serum
Secrete outward body miR-9-3p and the miR-124-3p application as the diagnosis marker of acute cerebral infarction.
Technical scheme: in order to realize object above, the technical scheme that the present invention takes is:
The present invention provides the application secreting body miR-9-3p and miR-124-3p outside serum as the diagnosis marker of acute cerebral infarction,
The sequence of described miR-9-3p and miR-124-3p be respectively AUAAAGCUAGAUAACCGAAAGU and
UAAGGCACGCGGUGAAUGCC。
Secreting outward the duplicature vesicles that body is a kind of diameter about 30-100nm, Various Tissues and cell all can be secreted formation, deposit
It is in the body fluid such as serum, cerebrospinal fluid, saliva and urine.They contain the microRNA from host cell and protein
Deng Multiple components, it is the important communication for information medium of iuntercellular, is also the ideal of non-invasive disease diagnosis marker research simultaneously
Object.This invention is secreted analyzing specific miR-9-3p and miR-124-3p of cerebral tissue outside Serum of Cerebral Infarction Patients
Expression in body, and inquire into its probability as Acute cerebral ischemia mark.
Employing is secreted based on high molecular polymer precipitation solution China and foreign countries and is secreted body outside the Exoquick method separation and Extraction serum of body, the most glimmering
Specific miR-9-3p and miR-124-3p of light quantitative polyase chain reaction (PCR) technical Analysis cerebral tissue is at apoplexy
The expression in body and difference is secreted outside patient and healthy population serum.
Beneficial effect: be successfully separated and secrete body outside surveyor's serum.Secrete outside patients with cerebral apoplexy serum in body miR-9-3p and
The level of miR-124-3p relatively matched group dramatically increases (P ＜ 0.001), and the content of its expression and IL-6 is proportionate
(r=0.741, P ＜ 0.001).Therefore, after acute cerebral infarction, cerebral tissue specificity miR-9-3p and miR-124-3p with
Secreting outward bodily form formula and enter peripheral blood, its level relatively matched group dramatically increases, and the degree of expression and brain injury is proportionate,
AUC (the area under curve) value of miR-9-3p and miR-124-3p be respectively 0.8689 (95%CI:
0.7779 0.9600) and 0.7083 (95%CI:0.5866 0.8301), therefore they can lack as one judge brain
Courageous and upright damage and the mark of degree.During secreting the extraction of body outside, overwhelming majority serum compositions are removed, therefore
Secrete outward body microRNA and can more precisely reflect the degree of cerebral ischemia compared with serum microRNA.MiR-9-3p and
The specificity of miR-124-3p and sensitivity are significantly higher than existing protein marker such as S100 β, CRP.
Accompanying drawing explanation
Fig. 1 be the present invention serum outside secrete separation and the qualification of body.A. the outer of transmission electron microscope observing separation secretes body size and form
(Bar=200nm)；The detection of B.Western blotting is outer secretes body mark PROTEIN C D9, CD63 and CD81 is at matched group and grinds
Study carefully the expression secreting in body outside group serum.The grain size distribution of body is secreted outside C.NTA detection serum；The outer of D.NTA secretes body picture.
Fig. 2 is to secrete the expression of miR-9-3p and miR-124-3p in body outside two groups of serum, note: two groups are compared, * P ＜ 0.001.
Fig. 3 is the dependency that miR-9-3p and miR-124-3p expresses with IL-6 level
Fig. 4. it is ROC (the Receiver operation Characterization) analysis result of miR-9-3p and miR-124-3p.
Detailed description of the invention
In order to deepen the understanding of the present invention, below in conjunction with embodiment and accompanying drawing, the invention will be further described, this enforcement
Example is only used for explaining the present invention, is not intended that limiting the scope of the present invention.
Embodiment
One, 1. object of study: choose what in January, 2015 in December, 2015 Hospital Attached to Nantong Univ. Neurology Department was in hospital
Acute cerebral infarction patients 32 example is set to seminar.The maleest 20 examples, female 12 example.Age 40～76 years old, average (61.3 ± 10.3)
Year.All check through head CT or MRI and confirm, meet the diagnosis of cerebral infarction of the 4th national cerebrovascular academic conference revision
Standard.Disease time 48-72 hour, the median (interquartile range) of NIHSS scoring is 8 (8-12).Except dislike
Property tumor, myocardial infarction or heart failure, blood, endocrine, metabolism or digestive system disease, malnutrition, severe lung sense
Dye, hepatic and kidney function obstacle person, and other illness neural.Hospital Physical Examination same period center is made a definite diagnosis healthy volunteer
33 examples are set to matched group, the maleest 18 examples, female 15 example, age 46～79 years old, average (60.25 ± 8.0) year.This research
Obtain Hospital Ethical Committee's approval.
2. serum collection and preservation: healthy volunteer adopts next day of being admitted to hospital on an empty stomach in MEC blood sampling on an empty stomach, Patients with Cerebral Infarction
Venous blood 3ml, separates serum, and-80 DEG C frozen.The amount of IL-6, S100 β and CRP in ELISA method detection blood: use
The double sandwich assay of antibody, the concentration of IL-6, S100 β and CRP in detection blood.
Seminar and matched group are at sex, no difference of science of statistics (P ＞ 0.05) between the age；IL-6, CRP, S-100 in serum
The expression of β relatively matched group increases, difference statistically significant (P ＜ 0.05).Refer to table 1.
| Group | Number of cases | Age | Male | IL-6 | CRP | S-100β |
| Seminar | 32 | 61.3±10.3 | 20 | 64.9±6.26 | 7.58±5.97 | 0.18±0.04 |
| Matched group | 33 | 60.25±8.0 | 18 | 35.6±5.21 | 5.12±3.13 | 0.13±0.16 |
| T value | 0.56 | 0.42 | 11.2 | 7.86 | 8.55 | |
| P value | 0.58 | 0.52 | 0.0006 | 0.0045 | 0.001 |
Two. secrete the separation of body outside serum: 1. will be stored in the serum of-80 degree at thawed on ice, 21000g, 4 DEG C of centrifugal 15min.
Supernatant is transferred in new EP pipe, adds the ExoQuick solution reverse mixing gently of 1/4 volume, hatch 2h for 4 DEG C,
1500g is centrifuged 30min, removes supernatant, retains precipitation standby.Use the Exoquick test kit (System of SBI company
Biosciences Inc., Mountain View, CA, USA) separate in serum outer secrete body.2.. analyze the outer particle diameter secreting body and
Concentration: use Nanoparticle-tracking analysis (NTA) to analyze the Number and size distribution of granule.By above-mentioned heavy
Form sediment resuspended without granule PBS with 30 μ l, before test, dilute 1000 times again.3. the form of body is secreted outside transmission electron microscope observing: according to
(Thery C, Amigorena S, Raposo G, the et al.Isolation and characterization of exosomes such as Thery
from cell culture supernatants and biological fluids[J].Curr Protoc Cell Biol,2006,Chapter 3:
Unit 3 22.) described by method prepare electron microscopic observation sample.By the resuspended precipitation of 30ul PBS, add isopyknic 4%w/v
Paraformaldehyde is fixed.Being dripped on Formvar/carbon-coated nickel screen by the 10ul outer liquid solution of secreting after fixing, air is dried
20min.After PBS washing for several times, fixing 5min with the glutaraldehyde of 1%v/v, pure water cleans and uses 4%w/v acetic acid the most afterwards
Uranium dyeing 5min, acetic acid uranium and the embedding of methylcellulose mixing liquid, suck surplus liquid air drying for standby with filter paper.
Transmission electron microscope (JEM-2100JEOL, Tokyo, Japan) observes outer form and the size secreting body.4. Westen blot detection
Secrete outward body mark thing: use RIPA (Pierce, USA) lysate to secrete body protein, BCA (Pierce, the U.S.) outside extracting
Measure protein concentration.12%SDS-PAGE separates albumen, and per pass applied sample amount is 40 μ g total proteins.Wet robin is by protein delivery
On pvdf membrane, 5% defatted milk powder room temperature closes 1h, is separately added into CD63 (SBI System Biosciences, USA),
CD9 (Abcam, USA) and CD81 (Abcam, USA) antibody (1:1000), close overnight for 4 DEG C, and TBST washes
3 times, add HRP labelling 2 resist (1:1000), incubated at room 1h, Enhanced chemiluminescence colour developing (ECL) (Pierce,
USA), Film Recording.
Minimum owing to secreting outward body particle diameter, traditional supercentrifugation is time-consuming, laborious and separation efficiency is relatively low, then uses by height
Exoquick method [Thery C, Amigorena S, Raposo G, the et al.Isolation of body secretes in Molecularly Imprinted Polymer precipitation solution China and foreign countries
and characterization of exosomes from cell culture supernatants and biological fluids[J].Curr
Protoc Cell Biol,2006,Chapter 3:Unit 3 22.].Body is secreted substantially in circle outside the serum that this experiment is obtained by the method
Shape, part have depression, and particle diameter, at below 100nm (Figure 1A), expresses the outer mark secreting body such as CD9, CD63 and CD81
Will molecule, and no significant difference (Figure 1B) between seminar and matched group.Further NTA analyzes display, outside being separated to
Secrete body particle diameter heterogeneity, be mainly distributed near 100nm (Fig. 1 C and D), illustrate to be successfully separated and outside human serum, secrete body.
Three. secrete outward body RNA extracting and quantitative and real-time quantitative PCR: use mirVana (Ambion, TX, USA) test kit
The total serum IgE of body is secreted outside extracting serum.Bioanalyzer 2000 (Agilent, CA) detects the quality of extracted RNA and dense
Degree.Use miDETECT A Track based on poly-A tailing methodTMMiRNA qRT-PCR test kit (Guangzhou is sharp rich)
MiR-9-3p, each sample duplicate detection 3 times is detected with CFX96PCR instrument (Biorad).
Secrete the expression of miR-9-3p in body outside seminar's serum: use secrete outside Q-PCR detection serum in body miR-9-3p and
MiR-124-3p, its relative expression levels represents with 40-CT.As in figure 2 it is shown, miR-9-3p and miR-124-3p of matched group
Expression close to background level, and (P ＜ 0.001) is significantly increased in the expression of seminar patient miR-9-3p and miR-124-3p.
The relation between the level of IL-6 in miR-9-3p and the miR-124-3p expression in body and blood is secreted: for inquiring into blood outside serum
Relation between clear outer level and the severity of brain injury secreting miR-9-3p and miR-124-3p in body, to miR-9-3p and
The level of miR-124-3p carries out linear regression analysis (Fig. 3) with the level of proinflammatory inflammation factor IL-6 in blood and shows between the two
The most relevant (P ＜ 0.001).As shown in Figure 4, the AUC (area under curve) of miR-9-3p and miR-124-3p
Value be respectively 0.8689 (95%CI:0.7779 0.9600) and 0.7083 (95%CI:0.5866 0.8301), therefore they
Can be as a kind of mark passing judgment on cerebral ischemic injury and degree.
This group cerebral infarction case only has 15 example S100 β expressions increase, and miR-9-3p and miR-124-3pp is all
Case significantly increases, simultaneously the dependency with cerebral ischemia be also higher than CRP, cerebral tissue specificity miR-9-3p and
Secreting bodily form formula beyond miR-124-3p and enter peripheral blood, its level relatively matched group dramatically increases, and the journey of expression and brain injury
Degree is proportionate, can be as a kind of mark passing judgment on cerebral ischemic injury and degree.
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, all spirit in the present invention and
Within principle, any modification, equivalent substitution and improvement etc. made, should be included within the scope of the present invention.
Claims (1)
1. outside serum, secrete body miR-9-3p and the miR-124-3p application as the diagnosis marker of acute cerebral infarction, described
The sequence of miR-9-3p and miR-124-3p be respectively AUAAAGCUAGAUAACCGAAAGU and
UAAGGCACGCGGUGAAUGCC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610285932.4A CN105925677B (en) | 2016-04-29 | 2016-04-29 | Applications of the 3p and 3p of miR 124 of serum excretion body miR 9 as the diagnosis marker of acute cerebral infarction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610285932.4A CN105925677B (en) | 2016-04-29 | 2016-04-29 | Applications of the 3p and 3p of miR 124 of serum excretion body miR 9 as the diagnosis marker of acute cerebral infarction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105925677A true CN105925677A (en) | 2016-09-07 |
| CN105925677B CN105925677B (en) | 2018-02-06 |
Family
ID=56834157
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610285932.4A Active CN105925677B (en) | 2016-04-29 | 2016-04-29 | Applications of the 3p and 3p of miR 124 of serum excretion body miR 9 as the diagnosis marker of acute cerebral infarction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105925677B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107625781A (en) * | 2017-10-11 | 2018-01-26 | 苏州大学 | MiRNA repressors are preparing the application in preventing and treating myocardial infarction medicine |
| CN108070650A (en) * | 2018-02-09 | 2018-05-25 | 深圳承启生物科技有限公司 | MicroRNA is in the purposes of diagnosing ischemia cerebral apoplexy disease in excretion body |
| CN109266739A (en) * | 2018-11-29 | 2019-01-25 | 成都仕康美生物科技有限公司 | It is a kind of to detect the miRNA marker of cerebral injury, kit, application |
| CN111534584A (en) * | 2020-06-10 | 2020-08-14 | 南通大学 | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof |
| CN111621558A (en) * | 2020-06-10 | 2020-09-04 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN112176055A (en) * | 2020-10-27 | 2021-01-05 | 江阴市人民医院 | Application of hsa _ circ _0069922 as marker |
| CN112599239A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Metabolite marker and application thereof in cerebral infarction diagnosis |
| CN113082216A (en) * | 2021-04-25 | 2021-07-09 | 吉林大学 | Glioma cell exosome containing miR-124 and preparation method and application thereof |
| CN114350789A (en) * | 2022-01-14 | 2022-04-15 | 南京鼓楼医院 | Application of miRNA marker in preparation of diabetes cognitive disorder diagnosis product and method |
-
2016
- 2016-04-29 CN CN201610285932.4A patent/CN105925677B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GEORGIOS KOUTSIS等: "The Emerging Role of microRNA in Stroke", 《CURRENT TOPICS IN MEDICINAL CHEMISTRY》 * |
| LING YAN LEUNG等: "Comparison of miR-124-3p and miR-16 for early diagnosis of hemorrhagic and ischemic stroke.", 《CLINICA CHIMICA ACTA》 * |
| YANPING LIU等: "Downregulation of serum brain specific microRNA is associated with inflammation and infarct volume in acute ischemic stroke.", 《JOURNAL OF CLINICAL NEUROSCIENCE》 * |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107625781B (en) * | 2017-10-11 | 2020-05-22 | 苏州大学 | Application of miRNA inhibitor in preparation of medicine for preventing and treating myocardial infarction |
| CN107625781A (en) * | 2017-10-11 | 2018-01-26 | 苏州大学 | MiRNA repressors are preparing the application in preventing and treating myocardial infarction medicine |
| CN108070650A (en) * | 2018-02-09 | 2018-05-25 | 深圳承启生物科技有限公司 | MicroRNA is in the purposes of diagnosing ischemia cerebral apoplexy disease in excretion body |
| CN108070650B (en) * | 2018-02-09 | 2021-02-12 | 深圳承启生物科技有限公司 | Application of microRNA in exosome in diagnosis of ischemic stroke disease |
| CN109266739A (en) * | 2018-11-29 | 2019-01-25 | 成都仕康美生物科技有限公司 | It is a kind of to detect the miRNA marker of cerebral injury, kit, application |
| CN111621558B (en) * | 2020-06-10 | 2023-04-07 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN111534584A (en) * | 2020-06-10 | 2020-08-14 | 南通大学 | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof |
| CN111621558A (en) * | 2020-06-10 | 2020-09-04 | 南通大学 | Application of blood brain barrier damage degree-related serum exosome miR-410-3p and detection method thereof |
| CN112176055A (en) * | 2020-10-27 | 2021-01-05 | 江阴市人民医院 | Application of hsa _ circ _0069922 as marker |
| CN112176055B (en) * | 2020-10-27 | 2022-06-24 | 南京市第一医院 | Application of hsa _ circ _0069922 as marker |
| CN112599239A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Metabolite marker and application thereof in cerebral infarction diagnosis |
| CN113082216A (en) * | 2021-04-25 | 2021-07-09 | 吉林大学 | Glioma cell exosome containing miR-124 and preparation method and application thereof |
| CN113082216B (en) * | 2021-04-25 | 2022-07-01 | 吉林大学 | Glioma cell exosome containing miR-124 and preparation method and application thereof |
| CN114350789A (en) * | 2022-01-14 | 2022-04-15 | 南京鼓楼医院 | Application of miRNA marker in preparation of diabetes cognitive disorder diagnosis product and method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105925677B (en) | 2018-02-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105925677A (en) | Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction | |
| Gong et al. | Exosomes derived from SDF1‐overexpressing mesenchymal stem cells inhibit ischemic myocardial cell apoptosis and promote cardiac endothelial microvascular regeneration in mice with myocardial infarction | |
| Wu et al. | Exosomes derived from endothelial progenitor cells ameliorate acute lung injury by transferring miR-126 | |
| Kumar et al. | Are circulating microRNAs peripheral biomarkers for Alzheimer's disease? | |
| Zhang et al. | Microenvironment-induced PTEN loss by exosomal microRNA primes brain metastasis outgrowth | |
| Yan et al. | Cancer‐associated fibroblasts–derived exosomes‐mediated transfer of LINC00355 regulates bladder cancer cell proliferation and invasion | |
| Ding et al. | LncRNA BDNF-AS as ceRNA regulates the miR-9-5p/BACE1 pathway affecting neurotoxicity in Alzheimer's disease | |
| Su et al. | Exosomal miRNAs as potential biomarkers for acute myocardial infarction | |
| Priglinger et al. | SVF-derived extracellular vesicles carry characteristic miRNAs in lipedema | |
| CN103805696A (en) | Micro RNA (Ribonucleic Acid) molecular marker for diagnosing rheumatoid arthritis and detection kit thereof | |
| Ali Sheikh et al. | Diagnostic, prognostic, and therapeutic value of circulating miRNAs in heart failure patients associated with oxidative stress | |
| Xie et al. | The relationship between amniotic fluid miRNAs and congenital obstructive nephropathy | |
| CN111455056A (en) | lncRNA marker derived from adipose cell exosome and application and product thereof | |
| Cavallini et al. | High degradation and no bioavailability of artichoke miRNAs assessed using an in vitro digestion/Caco-2 cell model | |
| Wu et al. | MicroRNA-200c-5p targets NIMA Related Kinase 7 (NEK7) to inhibit NOD-like receptor 3 (NLRP3) inflammasome activation, MODE-K cell pyroptosis, and inflammatory bowel disease in mice | |
| CN107557472B (en) | Glioma diagnosis marker circ9:135881633|135883078 and application | |
| CN107937532B (en) | Glioma diagnosis marker hsa _ circ _0021827 and application | |
| CN109402262A (en) | The PCR detection kit of auxiliary diagnosis neuroblastoma and the method for detecting miR-199a-3p expression | |
| Ghasemi et al. | MicroRNAs dysregulation as potential biomarkers for early diagnosis of endometriosis | |
| Zhang et al. | Single-cell analysis of the miRNA activities in tuberculous meningitis (TBM) model mice injected with the BCG vaccine | |
| CN110229898A (en) | It is a kind of detect nasopharyngeal carcinoma marker and application | |
| CN108342487A (en) | The specific expressed collection of illustrative plates of esophagus cancer diagnosis based on serum exosomallncRNAs and testing and analysis system | |
| Ezzat et al. | Expression of micro RNA192 in type 2 diabetes mellitus relation to glycemic control, metabolic abnormalities, renal and ocular complications | |
| CN110616262A (en) | Application of microRNA in exosome in evaluation of brain glioma radiotherapy effect | |
| Zeng et al. | Profiling of circulating serum exosomal microRNAs in elderly patients with infectious stress hyperglycaemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200415 Address after: 510000 a910, No. 3, Juquan Road, Guangzhou City, Guangdong Province Patentee after: Guangzhou isoda Biomedical Technology Co., Ltd Address before: 226000 Jiangsu Province, Nantong City West Temple Road No. 20 Patentee before: AFFILIATED HOSPITAL OF NANTONG University |