CN111534584A - Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof - Google Patents
Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof Download PDFInfo
- Publication number
- CN111534584A CN111534584A CN202010523816.8A CN202010523816A CN111534584A CN 111534584 A CN111534584 A CN 111534584A CN 202010523816 A CN202010523816 A CN 202010523816A CN 111534584 A CN111534584 A CN 111534584A
- Authority
- CN
- China
- Prior art keywords
- serum
- mir
- exosome
- mirnas
- exosomes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 210000001808 exosome Anatomy 0.000 title claims abstract description 86
- 210000002966 serum Anatomy 0.000 title claims abstract description 69
- 108091029369 miR-410 stem-loop Proteins 0.000 title claims abstract description 52
- 206010008118 cerebral infarction Diseases 0.000 title claims abstract description 32
- 208000026106 cerebrovascular disease Diseases 0.000 title claims abstract description 32
- 238000003745 diagnosis Methods 0.000 title claims abstract description 31
- 230000001154 acute effect Effects 0.000 title claims abstract description 28
- 239000003550 marker Substances 0.000 title claims abstract description 22
- 238000001514 detection method Methods 0.000 title abstract description 8
- 108091070501 miRNA Proteins 0.000 claims abstract description 66
- 239000002679 microRNA Substances 0.000 claims abstract description 65
- 230000014509 gene expression Effects 0.000 claims abstract description 34
- 208000006011 Stroke Diseases 0.000 claims abstract description 16
- 210000005013 brain tissue Anatomy 0.000 claims abstract description 12
- 239000000090 biomarker Substances 0.000 claims abstract description 7
- 238000005516 engineering process Methods 0.000 claims abstract description 7
- 238000012216 screening Methods 0.000 claims abstract description 6
- 238000012167 Small RNA sequencing Methods 0.000 claims abstract description 5
- 238000003766 bioinformatics method Methods 0.000 claims abstract description 5
- 238000001228 spectrum Methods 0.000 claims abstract description 5
- 238000012339 Real-time fluorescence quantitative polymerase chain reaction Methods 0.000 claims abstract description 4
- 238000012163 sequencing technique Methods 0.000 claims description 20
- 108091032973 (ribonucleotides)n+m Proteins 0.000 claims description 17
- 108091032955 Bacterial small RNA Proteins 0.000 claims description 16
- 238000000034 method Methods 0.000 claims description 12
- 238000003752 polymerase chain reaction Methods 0.000 claims description 10
- 108091070482 Caenorhabditis elegans miR-39 stem-loop Proteins 0.000 claims description 6
- 238000011529 RT qPCR Methods 0.000 claims description 6
- 239000006228 supernatant Substances 0.000 claims description 6
- 238000001914 filtration Methods 0.000 claims description 5
- 238000002123 RNA extraction Methods 0.000 claims description 4
- 238000010276 construction Methods 0.000 claims description 4
- 238000007405 data analysis Methods 0.000 claims description 4
- 239000002244 precipitate Substances 0.000 claims description 4
- 108090000623 proteins and genes Proteins 0.000 claims description 4
- 102000007999 Nuclear Proteins Human genes 0.000 claims description 3
- 108010089610 Nuclear Proteins Proteins 0.000 claims description 3
- 108020004417 Untranslated RNA Proteins 0.000 claims description 3
- 102000039634 Untranslated RNA Human genes 0.000 claims description 3
- 238000004458 analytical method Methods 0.000 claims description 3
- 230000008859 change Effects 0.000 claims description 3
- 239000002299 complementary DNA Substances 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 238000012165 high-throughput sequencing Methods 0.000 claims description 3
- 108091090568 miR-39 stem-loop Proteins 0.000 claims description 3
- 108091056739 miR-39-1 stem-loop Proteins 0.000 claims description 3
- 108091039160 miR-39-2 stem-loop Proteins 0.000 claims description 3
- 238000010606 normalization Methods 0.000 claims description 3
- 230000003252 repetitive effect Effects 0.000 claims description 3
- 238000010839 reverse transcription Methods 0.000 claims description 3
- 108020004418 ribosomal RNA Proteins 0.000 claims description 3
- 238000000926 separation method Methods 0.000 claims description 3
- 108020004566 Transfer RNA Proteins 0.000 claims description 2
- 239000003153 chemical reaction reagent Substances 0.000 claims description 2
- 238000002156 mixing Methods 0.000 claims description 2
- 238000010257 thawing Methods 0.000 claims description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 claims 2
- 230000002490 cerebral effect Effects 0.000 abstract description 5
- 238000011160 research Methods 0.000 abstract description 4
- 208000037906 ischaemic injury Diseases 0.000 abstract description 3
- 210000005259 peripheral blood Anatomy 0.000 abstract description 3
- 239000011886 peripheral blood Substances 0.000 abstract description 3
- 206010008190 Cerebrovascular accident Diseases 0.000 abstract description 2
- 208000032382 Ischaemic stroke Diseases 0.000 description 9
- 108020003224 Small Nucleolar RNA Proteins 0.000 description 6
- 102000042773 Small Nucleolar RNA Human genes 0.000 description 6
- 210000004369 blood Anatomy 0.000 description 6
- 239000008280 blood Substances 0.000 description 6
- 201000010099 disease Diseases 0.000 description 5
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 5
- 239000000499 gel Substances 0.000 description 5
- 210000003169 central nervous system Anatomy 0.000 description 4
- 210000001124 body fluid Anatomy 0.000 description 3
- 239000010839 body fluid Substances 0.000 description 3
- 238000002591 computed tomography Methods 0.000 description 3
- 238000013399 early diagnosis Methods 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 230000008499 blood brain barrier function Effects 0.000 description 2
- 210000001218 blood-brain barrier Anatomy 0.000 description 2
- 210000004556 brain Anatomy 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 210000001175 cerebrospinal fluid Anatomy 0.000 description 2
- 230000006378 damage Effects 0.000 description 2
- 239000003814 drug Substances 0.000 description 2
- 238000002595 magnetic resonance imaging Methods 0.000 description 2
- 238000002493 microarray Methods 0.000 description 2
- 239000008188 pellet Substances 0.000 description 2
- 238000004393 prognosis Methods 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 239000013049 sediment Substances 0.000 description 2
- 210000002784 stomach Anatomy 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 210000002700 urine Anatomy 0.000 description 2
- 201000006474 Brain Ischemia Diseases 0.000 description 1
- 206010008120 Cerebral ischaemia Diseases 0.000 description 1
- 206010019280 Heart failures Diseases 0.000 description 1
- 208000016988 Hemorrhagic Stroke Diseases 0.000 description 1
- 208000000857 Hepatic Insufficiency Diseases 0.000 description 1
- 208000032376 Lung infection Diseases 0.000 description 1
- 108091007774 MIR107 Proteins 0.000 description 1
- 208000002720 Malnutrition Diseases 0.000 description 1
- 208000037273 Pathologic Processes Diseases 0.000 description 1
- 238000003559 RNA-seq method Methods 0.000 description 1
- 208000001647 Renal Insufficiency Diseases 0.000 description 1
- 238000012300 Sequence Analysis Methods 0.000 description 1
- 102000039471 Small Nuclear RNA Human genes 0.000 description 1
- 108020004688 Small Nuclear RNA Proteins 0.000 description 1
- 208000007536 Thrombosis Diseases 0.000 description 1
- 102000003978 Tissue Plasminogen Activator Human genes 0.000 description 1
- 108090000373 Tissue Plasminogen Activator Proteins 0.000 description 1
- 108091023045 Untranslated Region Proteins 0.000 description 1
- 208000027418 Wounds and injury Diseases 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000013060 biological fluid Substances 0.000 description 1
- 210000004958 brain cell Anatomy 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 208000015114 central nervous system disease Diseases 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 210000003040 circulating cell Anatomy 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000000104 diagnostic biomarker Substances 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 210000002249 digestive system Anatomy 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 230000002124 endocrine Effects 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000007901 in situ hybridization Methods 0.000 description 1
- 208000014674 injury Diseases 0.000 description 1
- 208000020658 intracerebral hemorrhage Diseases 0.000 description 1
- 238000001990 intravenous administration Methods 0.000 description 1
- 108091024449 let-7e stem-loop Proteins 0.000 description 1
- 210000004185 liver Anatomy 0.000 description 1
- 230000002934 lysing effect Effects 0.000 description 1
- 238000012423 maintenance Methods 0.000 description 1
- 230000001071 malnutrition Effects 0.000 description 1
- 235000000824 malnutrition Nutrition 0.000 description 1
- 239000012528 membrane Substances 0.000 description 1
- 230000003340 mental effect Effects 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 108091071817 miR-128b stem-loop Proteins 0.000 description 1
- 108091033783 miR-153 stem-loop Proteins 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000003147 molecular marker Substances 0.000 description 1
- 208000010125 myocardial infarction Diseases 0.000 description 1
- 210000000653 nervous system Anatomy 0.000 description 1
- 230000001537 neural effect Effects 0.000 description 1
- 238000002610 neuroimaging Methods 0.000 description 1
- 210000002569 neuron Anatomy 0.000 description 1
- 102000042567 non-coding RNA Human genes 0.000 description 1
- 108091027963 non-coding RNA Proteins 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 208000015380 nutritional deficiency disease Diseases 0.000 description 1
- 230000009054 pathological process Effects 0.000 description 1
- 230000035790 physiological processes and functions Effects 0.000 description 1
- 210000002381 plasma Anatomy 0.000 description 1
- 230000001124 posttranscriptional effect Effects 0.000 description 1
- 230000001376 precipitating effect Effects 0.000 description 1
- 230000000717 retained effect Effects 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 210000003296 saliva Anatomy 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 210000003625 skull Anatomy 0.000 description 1
- 210000000278 spinal cord Anatomy 0.000 description 1
- 230000008685 targeting Effects 0.000 description 1
- 229960000187 tissue plasminogen activator Drugs 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides application and a detection method of a serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, wherein the sequence of the serum exosome miR-410-3p is as follows: AATATAACACAGATGGCCTGT, biomarkers for the diagnosis and treatment of acute cerebral infarction. The detection method of the serum exosome miR-410-3p comprises the following steps: collecting serum; separating exosomes in serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina, obtaining a miRNAs expression spectrum from the exosomes, and carrying out bioinformatics analysis and screening on differentially expressed miRNAs among samples; the real-time fluorescence quantitative polymerase chain reaction technology is used for analyzing the expression of the brain tissue specific miR-410-3p in the serum exosomes of stroke patients and healthy people. According to the research of the invention, the level of miR-410-3P in the serum exosome of the cerebral apoplexy patient is obviously increased (P is less than 0.001) compared with that of a control group, so after acute cerebral infarction, the brain tissue specificity miR-410-3P enters peripheral blood in an exosome form, and the level is obviously increased compared with that of the control group, so that the miR-410-3P can be used as a diagnostic marker of acute cerebral ischemic injury.
Description
Technical Field
The invention belongs to the fields of biotechnology and medicine, and particularly relates to application of a serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker and a detection method thereof.
Background
Stroke is a common disease of the nervous system, has high morbidity, disability rate and fatality rate, and seriously harms human health and life quality. Currently, the only drug approved by the FDA in the united states for the treatment of acute ischemic stroke is intravenous administration of tissue plasminogen activator by lysing blood clots within 4.5 hours after stroke occurs. However, due to the short treatment time window, only a few patients can receive the treatment, which greatly limits the clinical application of the treatment. Therefore, early and accurate diagnosis of acute ischemic stroke is of great importance. In addition, early diagnosis of ischemic stroke has long relied mainly on clinical physical examination and various neuroimaging techniques, and electroencephalogram Computed Tomography (CT) may effectively eliminate hemorrhagic stroke, but has not strong specificity for ischemic stroke diagnosis, while Magnetic Resonance Imaging (MRI) has important reference value in acute ischemic stroke diagnosis, but is difficult to be widely used due to the low prevalence and high cost of china. Therefore, the development of rapid diagnostic biomarkers has significant clinical application potential.
MiRNAs are a class of non-coding RNAs molecules of about 18-22 nucleotides in length encoded by endogenous genes that regulate gene expression at the post-transcriptional level by targeting the untranslated region of the 3' mRNA transcript, playing an important role in a variety of physiological and pathological processes. Numerous studies have shown that miRNAs can be detected in a variety of body fluids, such as plasma, serum, urine and cerebrospinal fluid, and it is widely believed that miRNAs released from injured cells or circulating cells cause increased expression of serum miRNAs. Based on the stability of miRNAs in body fluid and the tissue specificity of the miRNAs, the miRNAs can be relatively conveniently and quantitatively detected by methods such as real-time PCR (polymerase chain reaction), microarray and the like, and great interest is generated in the utilization of circulating miRNAs as clinical biomarkers. For ischemic stroke, disruption of the blood brain barrier and damage to brain tissue, miRNAs are released into the circulating blood. To some extent, the level of circulating miRNAs, in particular brain-specific or highly brain-expressed miRNAs, may reflect the severity of cerebral infarction. Therefore, a plurality of studies using microarray or RT-PCR methods to screen circulating miRNAs from stroke patients for the diagnosis and prognosis of stroke have been carried out, such as let-7e-5p, miR-107, miR-128b and miR-153 in blood of ischemic stroke patients are significantly higher than those of a control group, so that they can be regarded as blood markers for early diagnosis of cerebral infarction. Although there are many studies on the diagnosis and prognosis of ischemic stroke with circulating miRNAs, most of these miRNAs found so far lack brain tissue specificity, and there is no reliable circulating miRNAs available as a diagnostic marker of acute ischemic stroke.
miR-410 has central nervous system specificity, and the in situ hybridization result shows that miR-410 is specifically expressed in brain and spinal cord (Identification of New central nervous system Specific mousmeicroRNAs) and is enriched in neurons (Comprehensive Expression antibodies of New Cell-Type-Specific miRNAs; Identification New definitions of the specificity and Maintenance of New Neuronal Phenotypes).
In recent years, studies have shown that circulating exosomes have great potential as a diagnostic tool for central nervous system diseases, and not only can exosomes be synthesized and released by brain cells, but also more importantly, exosomes have the ability to penetrate the blood brain barrier in a specific state of the body, and circulating exosomes released from the center to the periphery can reflect information of the state of the central nervous system.
The exosome is a small vesicle with a double-layer membrane with the diameter of about 30-100nm, and various tissues and cells can be secreted and formed in body fluids such as serum, cerebrospinal fluid, saliva, urine and the like. Since exosomes can be isolated relatively easily and non-invasively from readily available biological fluids, and exosome-based biomarker assays have many significant advantages over conventional, exosome-based biomarkers are ideal candidates for early diagnosis of disease, with disease particularly significant in the central nervous system.
Disclosure of Invention
The invention aims to solve the technical problem of providing an application and a detection method of a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker, and providing a novel molecular marker for auxiliary diagnosis of cerebral infarction to make up for the deficiency in the research of the acute cerebral infarction diagnosis marker.
In order to solve the technical problems, the embodiment of the invention provides a serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, wherein the sequence of the serum exosome miR-410-3p is as follows: AATATAACACAGATGGCCTGT are provided.
The invention also provides application of the serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker, and a biomarker for acute cerebral infarction diagnosis and treatment.
The invention also provides a detection method of the serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, which comprises the following steps:
(1) collecting serum;
(2) separating exosomes in serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina, obtaining a miRNAs expression spectrum from the exosomes, and carrying out bioinformatics analysis and screening on differentially expressed miRNAs among samples;
(3) the real-time fluorescence quantitative polymerase chain reaction technology is used for analyzing the expression of the brain tissue specific miR-410-3p in the serum exosomes of stroke patients and healthy people.
Wherein, the specific steps of the step (2) are as follows:
(2-1) extraction of exosome RNA
(2-1-1) thawing 260. mu.l of serum stored at-80 ℃ on ice, and centrifuging at 21000g and 4 ℃ for 15 min;
(2-1-2) transferring the supernatant to a new EP tube, adding 1/4 volumes of ExoQuick solution, slightly inverting and mixing, incubating at 4 ℃ for 30min, centrifuging at 13500g for 5min, removing the supernatant, and keeping the precipitate for later use;
(2-1-3) resuspending the exosome pellet with PBS and adding 3-fold TRIZOL LS assayExtracting RNA with the agent, adding 100fmol miRNA standard Cel-mir-39 into each tube of sample, and finally precipitating the extracted RNA with RNA Free H2Dissolving O;
(2-2) construction of Small RNAs library and on-machine sequencing
(2-2-1) after the sample is qualified, constructing an exosome Small RNAs Library by using a Multiplex Small RNA Library Prep Set for Illumina kit;
(2-2-2) respectively connecting a linker at the 3 'end and the 5' end of the exosome total RNAs, and carrying out reverse transcription to synthesize cDNA;
(2-2-3) after PCR enrichment, screening a target fragment by adopting a gel separation technology, cutting gel from 8% PAGE gel to recover a 140bp strip, and evaluating the quality and the length of the library by using an Agilent Bioanalyzer 2100 chip;
(2-2-4) after the library is qualified, performing high-throughput sequencing on the sample by adopting a single-ended 125 bp sequencing mode of an illumine Hiseq2500 sequencing platform;
(2-3) sequencing data analysis
(2-3-1) converting an original image data file obtained by Illumina HiSeq2500 platform sequencing into an original sequencing sequence through base identification, and storing the result in a FASTQ file format; removing the raw data containing the joint, ploy-N and low-quality Reads, and length filtering to finally obtain Clean Reads; all downstream analyses were based on high quality cleardata; utilizing Bowtie software to respectively carry out sequence comparison on Clean Reads with a Silva database, a GtRNAdb database, a Rfam database and a Repbase database, and filtering ncRNAs such as ribosomal RNA, transfer RNAs, small RNAs in nuclei, nucleolar small RNAs and the like and a repetitive sequence to obtain Unannotated Reads containing the miRNAs; finally, the mirreep 2 software is used for identifying the known miRNAs and predicting the new miRNAs;
(2-3-2) comparing the expression of miRNAs in serum exosomes of stroke patients and healthy people to find differentially expressed miRNAs: normalizing the expression of the miRNAs of the two groups of samples, namely normalizing the number of reads of miR-39 by 10000; when the normalized expression of a certain miRNA is zero, modifying the expression value of the certain miRNA to 0.01; after normalization of miRNA reads number, calculating log2fold change and P value using the normalized data; miRNAs are defined as differentially expressed when the p-value of the miRNAs is 0.05 or less and log2fold-change is 1 or more.
Wherein, the step (3) is exosome RNA extraction and real-time quantitative PCR, and the concrete steps are as follows:
(3-1) extracting total RNA of the serum exosomes by a trizol method: using an ultramicro ultraviolet spectrophotometer to carry out quantitative determination and purity determination on RNAs; detecting miR-410-3p by using a poly-A tailing method-based miDEECT A Track miRNA qRT-PCR kit and a CFX 96 PCR instrument;
(3-2) study of expression of miR-410-3p in serum exosomes: detecting miR-410-3p in serum exosome by adopting Q-PCR (Q-polymerase chain reaction), and taking added Cel-miR-39 as an external reference 2-ΔΔCTIndicating the relative expression level of the gene of interest.
The technical scheme of the invention has the following beneficial effects: according to the research of the invention, the level of miR-410-3P in the serum exosome of the cerebral apoplexy patient is obviously increased (P is less than 0.001) compared with that of a control group, so after acute cerebral infarction, the brain tissue specificity miR-410-3P enters peripheral blood in an exosome form, and the level is obviously increased compared with that of the control group, so that the miR-410-3P can be used as a diagnostic marker of acute cerebral ischemic injury. Because most serum components are removed in the extraction process of the exosomes, the exosome miRNA can more accurately reflect the degree of cerebral ischemia injury than the serum miRNA.
Drawings
FIG. 1 is a schematic diagram of miR-410-3p expression in serum exosomes of stroke patients and healthy people in the invention.
Detailed Description
In order to make the technical problems, technical solutions and advantages of the present invention more apparent, the following detailed description is given with reference to the accompanying drawings and specific embodiments.
The invention provides a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker, wherein the sequence of the serum exosome miR-410-3p is as follows: AATATAACACAGATGGCCTGT are provided.
The serum exosome miR-410-3p provided by the invention can be used as a biomarker for acute cerebral infarction diagnosis and treatment.
The invention also provides a detection method of the serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, which comprises the following steps:
(1) collecting serum;
(2) separating exosomes in serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina, obtaining a miRNAs expression spectrum from the exosomes, and carrying out bioinformatics analysis and screening on differentially expressed miRNAs among samples;
(3) the expression of brain tissue-specific miR-410-3p in serum exosomes of stroke patients and healthy people is analyzed by a real-time fluorescent quantitative Polymerase Chain Reaction (PCR) technology.
The technical solution of the present invention is further illustrated by the following specific examples.
Firstly, determining a research object and collecting and storing serum
1. Study subjects: 40 cases of acute cerebral infarction patients who were admitted to the neurology department of the university of southeast university in 2018, 1 month to 2018 month were selected as study groups, wherein 23 cases of men and 17 cases of women were aged 42-78 years and the average (60.5 +/-10.1) years. The diagnosis result is verified by the CT or MRI examination of the skull, and the diagnosis result accords with the cerebral infarction diagnosis standard revised by the fourth national cerebrovascular disease academic conference. The time of onset was 12-24h, and the median (interquartile range) in the NIHSS score was 8 (8-12). Except malignant tumors, myocardial infarction or heart failure, diseases of blood, endocrine, metabolism or digestive system, malnutrition, serious lung infection, liver and kidney insufficiency and other diseases of mental system. 38 healthy volunteers diagnosed in the hospital examination center at the same period were set as a control group, wherein 20 men and 18 women were aged 45-76 years old and the average (61.25 + -9) years old. The study was approved by the hospital ethics committee.
2. Collecting and preserving serum: healthy volunteers take blood on an empty stomach in a physical examination center, cerebral infarction patients take 3ml of venous blood on an empty stomach on the next day of admission, and serum is separated and frozen at-80 ℃.
The study combination control group had no statistical difference between gender and age (P > 0.05), as detailed in table 1:
table 1:
second, exosome RNA extraction, small RNAs library construction, on-machine sequencing and sequencing data analysis
1. Extraction of exosome RNA
250 μ l of serum stored at-80 ℃ was thawed on ice and centrifuged at 21000g for 15min at 4 ℃. The supernatant was transferred to a new EP tube, and 1/4 volumes of ExoQuick solution were added and mixed by gentle inversion, incubated at 4 ℃ for 30min, centrifuged at 13500g for 5min, the supernatant removed and the pellet kept for use. Adding PBS to resuspend the exosome sediment, adding 3 times TRIZOL LS reagent to extract RNA, adding 100fmol miRNA standard Cel-mir-39 into each tube of sample, and finally extracting RNA sediment by RNA Free H2And dissolving the O.
2. Construction of small RNAs library and on-machine sequencing
After the sample is qualified, constructing the exosome Small RNAs Library by using NEB Next Multiplex Small RNA Library Prep Set for Illumina kit. Respectively connecting a linker at the 3 'end and the 5' end of the total RNAs of the exosomes, and carrying out reverse transcription to synthesize cDNA. After PCR enrichment, the fragments of interest were screened by gel separation techniques, bands of 140bp were recovered by gel-cutting from 8% PAGE gels, and library quality and length were assessed using an Agilent Bioanalyzer 2100 chip. And after the library is qualified, performing high-throughput sequencing on the sample by adopting a single-ended 125 bp sequencing mode of an illumine Hiseq2500 sequencing platform.
3. Sequencing data analysis
The original image data file obtained by Illumina HiSeq2500 platform sequencing is converted into an original sequencing sequence (Raw Reads) through base recognition (BaseCall), and the result is stored in a FASTQ file format. These raw data are stripped of the linker, ploy-N and low quality Reads, and length filtered (18 nt-30nt retained), resulting in Clean Reads. All downstream analyses were based on high quality clean data. Utilizing Bowtie software to respectively carry out sequence alignment on Clean Reads with a Silva database, a GtRNAdb database, a Rfam database and a Repbase database, filtering ncRNAs such as ribosomal RNA (s rRNAs), transport RNAs (tRNAs), intranuclear small RNAs (snRNAs) and nucleolar small RNAs (snornas) and repetitive sequences to obtain Unannotated Reads containing the miRNAs. Finally, the mirreep 2 software was used for the identification of known miRNAs and prediction of new miRNAs.
The expression of miRNAs in serum exosomes of stroke patients and healthy people is compared to find miRNAs with differential expression. The expression of miRNAs in the two groups of samples is normalized, namely the number of reads of miR-39 is normalized by 10000. When the normalized expression of a certain miRNA is zero, its expression value is modified to 0.01. After normalization of miRNA reads numbers, we used the normalized data to calculate log2fold change and P values. miRNAs are defined as differentially expressed when the p-value of the miRNAs is 0.05 or less and log2fold-change is 1 or more.
Third, exosome RNA extraction and real-time quantitative PCR
Total RNA of serum exosomes was extracted using trizol method. The RNAs were quantified and purity determined using a ultramicro UV spectrophotometer. MiDETECT A Track miRNA qRT-PCR kit (Sharp, Guangzhou) based on poly-A tailing method and CFX 96 PCR instrument (Biorad) were used to detect miR-410-3 p.
Expression of miR-410-3p in group serum exosomes: detecting miR-410-3p in serum exosome by adopting Q-PCR (Q-polymerase chain reaction), and taking added Cel-miR-39 as an external reference 2-ΔΔCTIndicating the relative expression level of the gene of interest. As shown in figure 1, compared with a control group, the expression of miR-410-3P of a patient with stroke is remarkably increased (P is less than 0.01), so that the miR-410-3P can be used as a marker for judging cerebral ischemic injury.
Table 2 shows the original miR-410-3p values and corrected miR-410-3p values detected by RNA sequencing of serum exosomes small in the study group and the control group.
Table 2:
the invention discloses application of a serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, wherein an Exoquick kit (System Biosciences Inc., Mountain View, CA, USA) of SBI company is adopted to separate exosomes in serum, small RNA sequencing is carried out on the exosomes in the serum through Illumina, a miRNAs expression spectrum is obtained from the sequence, and bioinformatics analysis is carried out to screen differentially expressed miRNAs among samples. The real-time fluorescence quantitative Polymerase Chain Reaction (PCR) technology detects the expression of the brain tissue specific miR-410-3p in the serum exosomes of stroke patients and healthy people. After acute cerebral infarction, the brain tissue specificity miR-410-3p enters peripheral blood in an exocrine form, the level of the brain tissue specificity miR-410-3p is obviously increased compared with that of a control group, and the brain tissue specificity miR-410-3p can be used as a diagnosis marker of acute cerebral infarction.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Claims (5)
1. A serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker, wherein the sequence of the serum exosome miR-410-3p is as follows: AATATAACACAGATGGCCTGT are provided.
2. An application of a serum exosome miR-410-3p as an acute cerebral infarction diagnosis marker is characterized in that the serum exosome is a biomarker for acute cerebral infarction diagnosis and treatment.
3. A method for detecting a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker is characterized by comprising the following steps of:
(1) collecting serum;
(2) separating exosomes in serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina, obtaining a miRNAs expression spectrum from the exosomes, and carrying out bioinformatics analysis and screening on differentially expressed miRNAs among samples;
(3) the real-time fluorescence quantitative polymerase chain reaction technology is used for analyzing the expression of the brain tissue specific miR-410-3p in the serum exosomes of stroke patients and healthy people.
4. The method for detecting the serum exosome miR-410-3p as the acute cerebral infarction diagnosis marker according to claim 3, wherein the specific steps in the step (2) are as follows:
(2-1) extracting exosome RNA;
(2-1-1) thawing 260. mu.l of serum stored at-80 ℃ on ice, and centrifuging at 21000g and 4 ℃ for 15 min;
(2-1-2) transferring the supernatant to a new EP tube, adding 1/4 volumes of ExoQuick solution, slightly inverting and mixing, incubating at 4 ℃ for 30min, centrifuging at 13500g for 5min, removing the supernatant, and keeping the precipitate for later use;
(2-1-3) adding PBS to resuspend the exosome precipitate, adding 3 times TRIZOL LS reagent to extract RNA, adding 100fmol miRNA standard Cel-mir-39 into each tube of sample, and finally extracting RNA precipitate by RNA Free H2Dissolving O;
(2-2) construction of Small RNAs library and on-machine sequencing
(2-2-1) after the sample is qualified, constructing an exosome Small RNAs Library by using a Multiplex Small RNA Library Prep Set for Illumina kit;
(2-2-2) respectively connecting a linker at the 3 'end and the 5' end of the exosome total RNAs, and carrying out reverse transcription to synthesize cDNA;
(2-2-3) after PCR enrichment, screening a target fragment by adopting a gel separation technology, cutting gel from 8% PAGE gel to recover a 140bp strip, and evaluating the quality and the length of the library by using an Agilent Bioanalyzer 2100 chip;
(2-2-4) after the library is qualified, performing high-throughput sequencing on the sample by adopting a single-ended 125 bp sequencing mode of an illumine Hiseq2500 sequencing platform;
(2-3) sequencing data analysis
(2-3-1) converting an original image data file obtained by Illumina HiSeq2500 platform sequencing into an original sequencing sequence through base identification, and storing the result in a FASTQ file format; removing the raw data containing the joint, ploy-N and low-quality Reads, and length filtering to finally obtain Clean Reads; all downstream analyses were based on high quality cleardata; utilizing Bowtie software to respectively carry out sequence comparison on Clean Reads with a Silva database, a GtRNAdb database, a Rfam database and a Repbase database, and filtering ncRNAs such as ribosomal RNA, transfer RNAs, small RNAs in nuclei, nucleolar small RNAs and the like and a repetitive sequence to obtain Unannotated Reads containing the miRNAs; finally, the mirreep 2 software is used for identifying the known miRNAs and predicting the new miRNAs;
(2-3-2) comparing the expression of miRNAs in serum exosomes of stroke patients and healthy people to find differentially expressed miRNAs: normalizing the expression of the miRNAs of the two groups of samples, namely normalizing the number of reads of miR-39 by 10000; when the normalized expression of a certain miRNA is zero, modifying the expression value of the certain miRNA to 0.01; after normalization of miRNA reads number, calculating log2fold change and P value using the normalized data; miRNAs are defined as differentially expressed when the p-value of the miRNAs is 0.05 or less and log2fold-change is 1 or more.
5. The method for detecting the serum exosome miR-410-3p as the acute cerebral infarction diagnosis marker according to claim 3, wherein the step (3) comprises exosome RNA extraction and real-time quantitative PCR, and comprises the following specific steps:
(3-1) extracting total RNA of the serum exosomes by a trizol method: using an ultramicro ultraviolet spectrophotometer to carry out quantitative determination and purity determination on RNAs; detecting miR-410-3p by using a poly-A tailing method-based miDEECT A Track miRNA qRT-PCR kit and a CFX 96 PCR instrument;
(3-2) study of expression of miR-410-3p in serum exosomes: detecting miR-410-3p in serum exosome by adopting Q-PCR (Q-polymerase chain reaction), and taking added Cel-miR-39 as an external reference 2-ΔΔCTIndicating the relative expression level of the gene of interest.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010523816.8A CN111534584A (en) | 2020-06-10 | 2020-06-10 | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010523816.8A CN111534584A (en) | 2020-06-10 | 2020-06-10 | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111534584A true CN111534584A (en) | 2020-08-14 |
Family
ID=71974335
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010523816.8A Pending CN111534584A (en) | 2020-06-10 | 2020-06-10 | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111534584A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112599237A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Biomarker and application thereof in cerebral infarction diagnosis |
CN112599239A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Metabolite marker and application thereof in cerebral infarction diagnosis |
CN113430261A (en) * | 2021-05-17 | 2021-09-24 | 镇江维思生物科技有限责任公司 | Application of exosome circular RNA (ribonucleic acid) derived from brain cells in serum as cerebral infarction diagnosis marker |
CN114231615A (en) * | 2021-12-29 | 2022-03-25 | 暨南大学附属第一医院(广州华侨医院) | Application of miR-5112 as acute ischemic stroke diagnostic biomarker |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105925677A (en) * | 2016-04-29 | 2016-09-07 | 南通大学附属医院 | Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction |
CN108070650A (en) * | 2018-02-09 | 2018-05-25 | 深圳承启生物科技有限公司 | MicroRNA is in the purposes of diagnosing ischemia cerebral apoplexy disease in excretion body |
CN109006662A (en) * | 2018-07-02 | 2018-12-18 | 中山大学附属第医院 | Acute cerebral ischemia machinery is intracranialed hemorrhage transformation model and its microRNA screening technique and application after leading to again |
-
2020
- 2020-06-10 CN CN202010523816.8A patent/CN111534584A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105925677A (en) * | 2016-04-29 | 2016-09-07 | 南通大学附属医院 | Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction |
CN108070650A (en) * | 2018-02-09 | 2018-05-25 | 深圳承启生物科技有限公司 | MicroRNA is in the purposes of diagnosing ischemia cerebral apoplexy disease in excretion body |
CN109006662A (en) * | 2018-07-02 | 2018-12-18 | 中山大学附属第医院 | Acute cerebral ischemia machinery is intracranialed hemorrhage transformation model and its microRNA screening technique and application after leading to again |
Non-Patent Citations (3)
Title |
---|
GUILONG ZHANG ET AL.: "Comparative Analysis of microRNA Expression Profiles of Exosomes Derived from Normal and Hypoxic Preconditioning Human Neural Stem Cells by Next Generation Sequencing", 《 JOURNAL OF BIOMEDICAL NANOTECHNOLOGY》 * |
SHIFANG ZHANG ET AL.: "Comparison of Ovis aries new identified miRNAs between other literatures and our study. (XLS)--Table S21", 《 RESEARCHGATE》 * |
刘肖肖等: "微小RNA-208b在急性心肌梗死中的诊断价值", 《中华老年心脑血管病杂志》 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112599237A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Biomarker and application thereof in cerebral infarction diagnosis |
CN112599239A (en) * | 2020-12-08 | 2021-04-02 | 河北医科大学第二医院 | Metabolite marker and application thereof in cerebral infarction diagnosis |
CN112599237B (en) * | 2020-12-08 | 2022-05-27 | 河北医科大学第二医院 | Biomarker and application thereof in cerebral infarction diagnosis |
CN112599239B (en) * | 2020-12-08 | 2022-07-19 | 河北医科大学第二医院 | Metabolite marker and application thereof in cerebral infarction diagnosis |
CN113430261A (en) * | 2021-05-17 | 2021-09-24 | 镇江维思生物科技有限责任公司 | Application of exosome circular RNA (ribonucleic acid) derived from brain cells in serum as cerebral infarction diagnosis marker |
CN114231615A (en) * | 2021-12-29 | 2022-03-25 | 暨南大学附属第一医院(广州华侨医院) | Application of miR-5112 as acute ischemic stroke diagnostic biomarker |
CN114231615B (en) * | 2021-12-29 | 2022-08-12 | 暨南大学附属第一医院(广州华侨医院) | Application of miR-5112 as acute ischemic stroke diagnostic biomarker |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111534584A (en) | Application of serum exosome miR-410-3p as acute cerebral infarction diagnosis marker and detection method thereof | |
US11414705B2 (en) | Salivary biomarkers of brain injury | |
CN112899368A (en) | Biomarker for early diagnosis of primary hepatocellular carcinoma, detection reagent and application thereof | |
CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
AU2016351311B9 (en) | SCAP gene mutant and the application thereof | |
CN104428426A (en) | Diagnostic miRNA profiles in multiple sclerosis | |
EP2985351A1 (en) | A circulating non-coding RNA as predictor of mortality in patients with acute kidney injury | |
CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
CN112522391B (en) | Application of hsa_circ_0008961 as gout diagnosis marker | |
CN112266955B (en) | Ankylosing spondylitis diagnostic marker and application thereof | |
CN115927614A (en) | Early intestinal cancer screening detection primer, detection method and kit based on Alu repeat element | |
CN111154880B (en) | Bladder cancer body fluid biopsy biomarker and application thereof | |
CN113025707A (en) | Application of biomarker in preparation of product for diagnosing damp-heat spleen-encumbering type 2 diabetes and kit | |
CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
CN112646876A (en) | MiRNA for psoriasis diagnosis and application thereof | |
CN117305443A (en) | Diagnostic marker of cerebral infarction and application thereof | |
AU2021105761A4 (en) | Use of microRNA markers microRNA-130a and microRNA-130b in diagnosis of Hepatic fibrosis | |
CN113817818B (en) | Tool for diagnosing allergic airway inflammation | |
CN110484620B (en) | Biomarker and application thereof in preparation of product for diagnosing PTMC (ptm-associated tumor cell) | |
CN112795640B (en) | Application of three microRNAs as RA markers and kit thereof | |
CN111518894B (en) | Reagent for detecting rs9273471 locus polymorphism and application thereof | |
CN117344005B (en) | lncRNA and application thereof in preparation of products for diagnosing, screening or evaluating coronary atherosclerosis | |
CN116162695B (en) | Use of peripheral whole blood has_circ_0008261 as diagnostic for cognitive impairment associated with early stage cerebrovascular disease | |
CN108277268B (en) | Peripheral blood marker-plasma free DNA for diagnosing schizophrenia | |
CN109266737B (en) | Exosome biomarker for auxiliary diagnosis of SCA3/MJD and screening and identifying method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200814 |
|
RJ01 | Rejection of invention patent application after publication |