CN116162695B - Use of peripheral whole blood has_circ_0008261 as diagnostic for cognitive impairment associated with early stage cerebrovascular disease - Google Patents

Abstract

The invention belongs to the technical field of in-vitro diagnosis and detection, and particularly relates to application of peripheral whole blood has_circ_0008261 as a diagnostic agent for early-stage cerebral small vessel disease related cognitive disorder. The invention provides application of a reagent for detecting has_circ_0008261 in preparing a product for diagnosing cerebral small vascular disease related cognitive disorder, and the has_circ_0008261 is used as a peripheral biological molecular marker for diagnosing early cerebral small vascular disease related cognitive disorder because of the specific low expression of the has_circ_0008261 in peripheral whole blood of cerebral small vascular disease patients accompanied with cognitive disorder, and a kit for diagnosing cerebral small vascular disease related cognitive disorder is constructed based on the peripheral biological molecular marker.

Description

Peripheral whole blood has_circ_0008261 is used as a relevant identification in the diagnosis of early cerebral small vessel disease Uses for cognitive disabilities

technical field

The invention belongs to the technical field of in vitro diagnosis and detection, and specifically relates to the use of peripheral whole blood has_circ_0008261 for diagnosing cognitive impairment related to early cerebral small vessel disease.

Background technique

Cerebral small vessel disease (CSVD) is considered to be the most common cause of vascular cognitive impairment, accounting for 36% to 67% of vascular dementia, with a high incidence and heavy social burden. Early detection and reasonable diagnosis and treatment are very important in practice. CSVD-associated cognitive impairment is a continuously developing disease spectrum, which has experienced a process from no cognitive impairment to cognitive impairment and further aggravation, that is, no cognitive impairment symptoms in the preclinical stage, early mild cognitive impairment and late stage dementia.

The "Chinese Guidelines for Diagnosis and Treatment of Cognitive Impairment Related to Cerebral Small Vessel Disease (2019)" pointed out that comprehensive clinical assessment, neuroimaging examination and laboratory examination are important ways to support the diagnosis of cognitive impairment related to CSVD. Although previous studies have found that brain MRI features (such as new small subcortical infarcts, vasogenic white matter hyperintensities, vasogenic spaces, perivascular spaces, cerebral microbleeds, and brain atrophy) are associated with CSVD cognitive There is an important association with impairment, but this method has low sensitivity and cannot accurately detect early CSVD-related cognitive impairment, and the laboratory test items proposed in the "Guidelines" lack specificity for the diagnosis of CSVD-related cognitive impairment. There is a high rate of missed diagnosis and misdiagnosis in clinical practice. Therefore, the development of convenient and highly specific objective biomarker detection has important clinical significance for the early and accurate diagnosis of CSVD-related cognitive impairment.

Contents of the invention

The purpose of the present invention is to provide peripheral whole blood has_circ_0008261 (NC_000002.12:15374608-15427794) as a use for diagnosing cognitive impairment related to early cerebral small vessel disease, has_circ_0008261 in peripheral whole blood of patients with cerebral small vessel disease accompanied by cognitive impairment The specific low expression of , can be used as a peripheral biomolecular marker for the diagnosis of early cerebral small vessel disease-related cognitive impairment.

The invention provides an application of a reagent for detecting has_circ_0008261 in the preparation of a product for diagnosing cognitive impairment related to cerebral small vessel disease.

Preferably, the reagent includes a reagent for detecting the expression level of has_circ_0008261 in peripheral whole blood.

Preferably, the reagent includes a pair of specific primers designed for has_circ_0008261.

Preferably, the specific primer pair includes has_circ_0008261-F and has_circ_0008261-R, the nucleotide sequence of the has_circ_0008261-F is shown in SEQ ID NO.1, and the nucleotide sequence of has_circ_0008261-R is shown in SEQ ID NO. 2.

Preferably, the reagent also includes a pair of specific primers designed for the internal reference gene.

Preferably, the specific primer pair designed for the internal reference gene includes GAPDH-F and GAPDH-R, the nucleotide sequence of the GAPDH-F is shown in SEQ ID NO.3, and the nucleotide sequence of GAPDH-R is shown in SEQ ID NO.3 Shown in ID NO.4.

Beneficial effects: the present invention provides the application of a reagent for detecting has_circ_0008261 in the preparation of products for diagnosing cognitive impairment associated with cerebral small vessel disease, using has_circ_0008261 as a detection marker for cognitive impairment associated with cerebral small vessel disease. In the embodiment of the present invention, whole transcriptome sequencing is performed on the peripheral whole blood of patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment, and the relationship between cerebral small vessel disease and cognition is analyzed. The differentially expressed circRNAs related to disorders were then verified by qRT-PCR in patients with cerebral small vessel disease with cognitive impairment, patients with cerebral small vessel disease without cognitive impairment, and healthy subjects. Finally, a specific low expression of a circRNA (has_circ_0008261) in the peripheral whole blood of patients with CSVD was obtained, which was used as a peripheral biomolecular marker for the diagnosis of early CSVD-related cognitive impairment.

Description of drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some of the present invention. Embodiments, for those of ordinary skill in the art, other drawings can also be obtained according to these drawings without paying creative labor.

Figure 1 is a graph showing the results of whole transcriptome sequencing of the top 50 differentially expressed circRNAs in the peripheral whole blood of patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment;

Figure 2 is a diagram of the repeatable qRT-PCR verification results of the original sequencing samples of has_circ_0008261 of the present invention in patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment;

Figure 3 is the results of independent sample qRT-PCR verification of has_circ_0008261 of the present invention in patients with cerebral small vessel disease with cognitive impairment, patients with cerebral small vessel disease without cognitive impairment, and peripheral whole blood of healthy subjects ;

Figure 4 is the ROC curve of has_circ_0008261 of the present invention between patients with cerebral small vessel disease and healthy subjects with cognitive impairment;

Fig. 5 is the ROC curve of has_circ_0008261 of the present invention between patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment.

Detailed ways

The invention provides an application of a reagent for detecting has_circ_0008261 in preparing a tool for diagnosing cognitive impairment related to cerebral small vessel disease.

The screening method of has_circ_0008261 according to the present invention preferably includes: performing whole transcriptome sequencing on the peripheral whole blood of patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment, and analyzing the brain Differential expression of circRNAs related to cognitive impairment in small vessel disease, and then by qRT-PCR technology in patients with cerebral small vessel disease with cognitive impairment, patients with cerebral small vessel disease without cognitive impairment, and healthy subjects The expanded sample was verified among the patients, and the specific low expression of has_circ_0008261 in the peripheral whole blood of patients with cerebral small vessel disease with cognitive impairment was finally screened (the difference level between groups obtained based on statistical analysis was P<0.05), and it was used as an early brain tumor. Peripheral biomolecular markers for the diagnosis of cognitive impairment associated with small vessel disease.

In the present invention, when detecting the expression level of has_circ_0008261, it is preferable to use cDNA obtained by reverse transcription of whole blood total RNA as a template. The method of extraction and reverse transcription of whole blood total RNA is not particularly limited in the present invention, and can be carried out using conventional reagents in the art.

The present invention preferably detects the expression level of has_circ_0008261 in peripheral whole blood, and the detection method of the expression level preferably includes qRT-PCR, and the specific primer pair designed for has_circ_0008261 preferably includes has_circ_0008261-F and has_circ_0008261-R, the nucleus of the has_circ_0008261-F The nucleotide sequence is shown in SEQ ID NO.1: TCCTGCCTTTGCAAGTTTTTAACG, the nucleotide sequence of has_circ_0008261-R is shown in SEQ ID NO.2: CCATTCTGCAAGCCAACTCCT.

The present invention preferably also includes a specific primer pair designed for an internal reference gene when detecting expression levels, the internal reference gene is preferably GAPDH, and the specific primer pair designed for GAPDH preferably includes a sequence of GAPDH-F (SEQ ID NO.3) : GGAGTCCACTGGCGTCTTCA and GAPDH-R (SEQ ID NO. 4): GCAGAGGGGGCAGAGATGAT.

When the present invention detects the above-mentioned expression level, it is preferred to select the ChamQTM SYBRqPCRMasterMix (High ROX Premixed) kit (Vazyme, Q341-02/03) in the embodiment, according to the cycle conditions recommended by the manufacturer, in Applied Biosystems QuantStudio 6 (Applied Biosystems QuantStudio 6 (Applied Biosystems ) for qRT-PCR reactions. The qRT-PCR reaction system of the present invention is calculated in 20 μL, and preferably includes: 10 μL of 2x ChamQ SYBR qPCR MasterMix (High ROX Premixed), 0.4 μL of Primer 1 (10 μM), 0.4 μL of Primer 2 (10 μM), 2-5 μL of cDNA and the remaining amount of ddH ₂ O. The reaction program of qRT-PCR in the present invention preferably includes: pre-denaturation at 95°C for 30s; cycle reaction: 95°C for 10s, 60°C for 30s, 40 cycles; melting curve: 95°C for 15s, 60°C for 60s, 95°C for 15s.

In order to further illustrate the present invention, the use of peripheral whole blood has_circ_0008261 (NC_000002.12:15374608-15427794) provided by the present invention as a diagnosis of cognitive impairment related to early cerebral small vessel disease will be described in detail below in conjunction with the accompanying drawings and examples, but cannot They are to be understood as limiting the protection scope of the present invention.

Example 1

S1. Strictly match according to age, gender and education level, so that there is no statistical difference between the groups. A total of 10 patients with cerebral small vessel disease with cognitive impairment and 8 patients without cognitive impairment were included. For patients with vascular disease, use EDTA anticoagulant vacuum tube to collect 2ml of fasting venous whole blood, add trizol solution at a ratio of 1:10 (that is, add 100μL of blood to 1000μL of trizol solution), and transport the divided solution to Nanjing Bormes by dry ice Te Biotechnology Co., Ltd. conducts whole-transcriptome sequencing, and uses Deseq2 software to analyze differentially expressed circRNAs between groups, satisfying p-values<0.05 and |log2(fold change)|>1 is a differential gene, where log2(fold change)> 1 is marked as up-regulated genes; log2(fold change)<-1 is marked as down-regulated genes.

S2. According to the results of whole transcription sequencing, the differential expression of circRNA in the peripheral blood of patients with cerebral small vessel disease with cognitive impairment and patients with cerebral small vessel disease without cognitive impairment is screened out. has_circ_0008261 is the position of the box in Figure 1 (here is the physical location of has_circ_0008261 on the chromosome).

S3. Use Primer 6 software to design the primer has_circ_0008261, and entrust Shanghai Sangon Company to synthesize (SEQ ID NO.1 and SEQ ID NO.2).

S4. Re-enroll 55 patients with cerebral small vessel disease with cognitive impairment, 51 patients with cerebral small vessel disease without cognitive impairment and 45 healthy subjects, and collect fasting venous whole blood samples, as shown in the table 1. All subjects were consulted by neurology and radiology chief physicians with rich clinical experience according to the diagnostic criteria in the "Chinese Expert Consensus on Diagnosis and Treatment of Cerebrovascular Disease 2021" and "Chinese Guidelines for Diagnosis and Treatment of Cognitive Impairment Related to Cerebrovascular Disease (2019)" Diagnose and confirm. The above-mentioned healthy subjects mainly come from the clinical subject data database of Department of Neurology/Radiology, Wuxi People's Hospital Affiliated to Nanjing Medical University and subjects recruited from the community through media and advertisements. Patients with cerebral small vessel disease mainly come from Nanjing Medical University Department of Neurology, Wuxi People's Hospital Affiliated to the University.

Table 1 Demographics and Cognitive Function Evaluation of Three Groups of Subjects

Note: The data are expressed as mean ± standard deviation; HC: healthy people; NC-CSVD: patients with CSVD without cognitive impairment; CI-CSVD: patients with CSVD with cognitive impairment.

S5. Take 2 mL of fasting venous whole blood from the subject and collect it using K ₂ EDTA anticoagulant tubes (Xinle). Mix immediately after blood collection, take 100 μL of blood at room temperature (18-25°C), put them into EP tubes containing 1000 μL of trizol solution, shake them immediately until there is no obvious sediment in the tube, and store them at -80°C for later use.

S6. Whole blood RNA extraction and RNA quality control after extraction are entrusted to Nanjing Boermeister Biotechnology Co., Ltd., and the agarose gel electrophoresis of RNA is required to have clear 5s, 18s, and 28s bands without obvious degradation; RNA sample concentration ≥ 50ng/μL, total amount ≥ 1μg, A ₂₆₀ / ₂₈₀ between 1.8 and 2.2.

S7. To expand the sample verification, use the HiScript III RT SuperMix for qPCR (+gDNAwiper) kit (Vazyme, R323-01) to perform RNA reverse transcription. The product was stored at -80°C for subsequent qRT-PCR reactions.

S8. Using the ChamQTM SYBR qPCR Master Mix (High ROX Premixed) kit (Vazyme, Q341-02/03), perform qRT-PCR reaction on Applied Biosystems QuantStudio 6 (Applied Biosystems) according to the cycle conditions recommended by the manufacturer.

qRT-PCR reaction system (20 μL): 10 μL of 2x ChamQ SYBR qPCR MasterMix (High ROXPremixed), 0.4 μL of Primer 1 (10 μM), 0.4 μL of Primer 2 (10 μM), 2-5 μL of cDNA and the rest of ddH ₂ O.

The reaction program of qRT-PCR: pre-denaturation at 95°C for 30s; cycle reaction: 95°C for 10s, 60°C for 30s, 40 cycles; melting curve: 95°C for 15s, 60°C for 60s, 95°C for 15s.

The results are shown in Figures 1-5. Whole transcript sequencing data showed that the expression level of has_circ_0008261 in peripheral whole blood was significantly reduced in patients with cerebral small vessel disease with cognitive impairment (Table 1); the expression level of has_circ_0008261 in peripheral whole blood The trend of change in small sequencing samples and independent large samples is consistent, and its expression level is specifically reduced in patients with cerebral small vessel disease with cognitive impairment (Figure 2 and Figure 3); qRT-PCR data show that peripheral whole blood has_circ_0008261 In the differential diagnosis of patients with cerebral small vessel disease with cognitive impairment and healthy people, patients with cerebral small vessel disease without cognitive impairment have a relatively ideal ability to distinguish, calculated by Youden index, the area under the ROC curve (AUC ) were 0.772 (specificity of 94.55%, sensitivity of 48.89%); 0.806 (specificity of 96.36%, sensitivity of 52.94%) (Figure 4 and Figure 5).

Although the foregoing embodiment has described the present invention in detail, it is only a part of the embodiments of the present invention, rather than all embodiments, and people can also obtain other embodiments according to the present embodiment without inventive step, these embodiments All belong to the protection scope of the present invention.

Claims (6)

1. Application of a reagent for detecting has_circ_0008261 in preparing a product for diagnosing cerebral small vessel disease related cognitive dysfunction.

2. The use according to claim 1, wherein the reagent comprises a reagent for detecting the expression level of peripheral whole blood has_circle_ 0008261.

3. The use according to claim 1 or 2, wherein the reagent comprises a specific primer pair designed for has_circle_ 0008261.

4. The use according to claim 3, wherein the specific primer pair comprises has_circ_0008261-F and has_circ_0008261-R, the nucleotide sequence of has_circ_0008261-F is shown in SEQ ID NO.1, and the nucleotide sequence of has_circ_0008261-R is shown in SEQ ID NO. 2.

5. The use according to claim 3, wherein the reagent further comprises a specific primer pair designed for a reference gene.

6. The method according to claim 5, wherein the specific primer pair designed for the reference gene comprises GAPDH-F and GAPDH-R, the nucleotide sequence of the GAPDH-F is shown as SEQ ID NO.3, and the nucleotide sequence of the GAPDH-R is shown as SEQ ID NO. 4.