CN112176055B

CN112176055B - Application of hsa _ circ _0069922 as marker

Info

Publication number: CN112176055B
Application number: CN202011162682.8A
Authority: CN
Inventors: 邓齐文; 周俊山; 施洪超; 孙慧玲; 李烁
Original assignee: Nanjing First Hospital
Current assignee: Nanjing First Hospital
Priority date: 2020-10-27
Filing date: 2020-10-27
Publication date: 2022-06-24
Anticipated expiration: 2040-10-27
Also published as: CN112176055A

Abstract

The invention discloses application of hsa _ circ _0069922 as a marker in preparation of products for stroke-related infection screening. That is, products for stroke-related infection screening include reagents or drugs that detect the expression level of hsa _ circ _0069922 in individual nucleated cells in the peripheral blood of a patient. The invention develops a new molecular marker hsa _ circ _0069922 for SAI screening diagnosis, and provides a new reference for SAI screening; the marker hsa _ circ _0069922 has high diagnostic value, ROC curve analysis shows that SAI patients can be well screened, the areas under the curves are 0.832 respectively, and the marker has good sensitivity and specificity and is expected to become an important index applied to SAI clinical diagnosis and treatment evaluation.

Description

Application of hsa _ circ _0069922 as marker

Technical Field

The invention relates to application of hsa _ circ _0069922 as a marker in preparation of products or medicines for stroke-related infection screening, belongs to the technical field of biomedicine and molecular biology, and particularly relates to the field of clinical screening of SAI.

Background

Stroke, as a global public health problem, can not only cause permanent disability of the body, but also is the second leading cause of human death. In the past 30 years, the incidence rate of cerebral apoplexy rapidly rises in China and has leap forward to be the first cause of death of China. The stroke includes ischemic stroke and hemorrhagic stroke, wherein the ischemic stroke accounts for about 85% of all strokes. Although the development of therapeutic regimens for ischemic stroke has been rapid in recent years, there are some pending clinical problems in treating ischemic stroke, in which stroke-associated infection (SAI) is of great interest. SAI is one of the most common complications of patients with acute stroke, especially patients with severe stroke, has the disadvantages of pneumonia and urinary infection, is difficult to control clinically, often causes the patients to have acute exacerbation and even death, seriously influences the early control and functional rehabilitation of the patients with stroke, brings heavy economic burden to families and society, and becomes a clinically significant problem to be solved urgently in the field of current cerebrovascular diseases. At present, the SAI still lacks accurate early prediction indexes and effective prevention strategies, such as preventive antibiotic application, prevention of aspiration, respiratory tract management and other measures are proved to fail to effectively reduce the incidence rate of the SAI and improve the clinical prognosis of SAI patients. Therefore, the early-warning diagnosis factor for exploring SAI early specificity can realize early clinical intervention treatment so as to reduce the fatality rate and disability rate caused by stroke.

More and more studies in recent years have shown that acute stroke can lead to immunosuppressive syndromes, significantly increasing the risk of SAI. Studies have shown that inoculation of 200 colony forming units of Streptococcus pneumoniae to the nasal cavity of mice in the Middle Cerebral Artery Occlusion (MCAO) model leads to bacteremia and pneumonia, while infection in sham mice requires 1000-fold more Streptococcus pneumoniae, suggesting that stroke may exacerbate pulmonary infection. Clinical studies have shown that the expression levels of IL-4 and TGF- β, peripheral blood inflammatory cytokines, continue to increase in stroke patients, but there is no significant difference in the expression levels of IL-4 in stroke-infected and non-infected patients.

With the rapid development of molecular biology technology and the intensive research on SAI mechanism, more and more related biomarkers are discovered and reported continuously. From the research progress of epigenetics, some non-coding RNAs have application prospects as disease biomarkers. The circRNA is a non-coding RNA which is widely present in organisms, and is different from the traditional linear RNA, the circRNA molecule is in a closed ring structure, is not influenced by RNA exonuclease, is stable and not easy to degrade, and can be combined with miRNA to play a sponge adsorption role in function, so that the inhibition effect of miRNA on the target gene is relieved, and the important regulation and control effect is played in diseases.

Various circrnas have also been found to be associated with stroke. For example, circHECTD1 can compete with miR-142 to cause the expression of a downstream target gene TIPARP of miR-142 to be increased, so that astrocytes are activated, and cerebral apoplexy is aggravated. However, there are still few screening assays for SAI, and there is a need to further explore new effective markers and assess their specificity and accuracy.

Disclosure of Invention

The first purpose of the invention is to provide application of hsa _ circ _0069922 as a marker in preparing a product for stroke-related infection screening, wherein the sequence of the product is shown as SEQ NO. 1.

The product comprises an agent or drug for detecting the expression level of hsa _ circ _0069922 in individual nucleated cells in the peripheral blood of a patient. The product can screen SAI by detecting the expression level of hsa _ circ _0069922 in PBMCs of patients, and the detection result shows that the expression of hsa _ circ _0069922 is obviously up-regulated compared with that of patients without stroke infection.

In addition, the invention also discloses a SAI screening method, which predicts the SAI risk through the relative expression of hsa _ circ _ 0069922.

Further, the product contained fluorescent quantitative PCR primers for the circRNA marker for SAI screening, which were used to amplify hsa _ circ _ 0069922.

The Primer sequence is Forward Primer sequence (5 '-3'): TCACAAGAGAAAGACAGGGCA (SEQ NO: 2); reverse Primer sequence (5 '-3'): GACAGCTTCATCCTCCATCTGAG (SEQ NO: 3).

The second purpose of the invention is to provide a kit for stroke-related infection screening, which comprises the PCR primer and a primer for amplifying a reference gene.

Further, the reference gene is GAPDH. The Primer sequences used for amplification of GAPDH were Forward Primer sequence (5 '-3'): GGGAGCCAAAAGGGTCATCA, (SEQ NO: 4); reverse Primer sequence (5 '-3'): TGATGGCATGGACTGTGGTC, (SEQ NO: 5).

The kit disclosed by the invention predicts the risk of SAI through the relative expression of hsa _ circ _ 0069922. SAI was screened by detecting the level of hsa _ circ _0069922 expression in PBMCs of patients, and the results showed that hsa _ circ _0069922 expression was significantly upregulated compared to uninfected individuals, indicating the occurrence of SAI.

A third object of the invention is the use of hsa _ circ _0069922 as a marker for the preparation of a medicament for the prognosis or treatment of SAI. Generally, the relative expression of circRNA from SAI is also correlated with the prognosis or treatment of SAI patients, and products of SAI prognosis or treatment include: the products of hsa _ circ _0069922 expression levels were detected by fluorescent quantitative PCR, in situ hybridization or high throughput sequencing.

The beneficial effects of the invention are:

(1) the invention develops a new molecular marker hsa _ circ _0069922 for SAI screening diagnosis, and provides a new reference for SAI screening;

(2) the marker hsa _ circ _0069922 has high diagnostic value, ROC curve analysis shows that SAI patients can be well screened, the areas under the curves are 0.832 respectively, and the marker has good sensitivity and specificity and is expected to become an important index applied to SAI clinical diagnosis and treatment evaluation.

Drawings

FIG. 1 is a functional annotation of hsa _ circ _0069922 in the parental gene;

FIG. 2 is a graph of the relative expression levels of hsa _ circ _0069922 in stroke-associated infected and uninfected patients;

FIG. 3 is a ROC curve for hsa _ circ _0069922 for diagnostics.

Detailed Description

The invention is further described below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and the protection scope of the present invention is not limited thereby.

The invention provides application of hsa _ circ _0069922 as a marker in preparation of products for stroke-related infection screening, wherein the position in a genome is chr4:72102292-72121116, and functional annotations in parent genes are shown in figure 1.

Examples

The gene topic group is screened through SAI in the early stage, 5 pairs of PBMCs of SAI and stroke uninfected patients are selected to carry out high-throughput sequencing, and circRNA molecules with high expression difference are screened out to be screened, verified and analyzed. The invention selects hsa _ circ _0069922, and combines with statistical analysis through subsequent verification to be used for SAI screening.

Study subject and sample

60 total SAI cases and 30 non-infected patients who are collected from the first hospital of Nanjing from 2018 to 2020 and 3 are selected, wherein 30 SAI cases and 30 non-infected patients are confirmed by imaging examination, 3ml to 5ml of human peripheral blood is obtained by using an EDTA (ethylene diamine tetraacetic acid) anticoagulation tube before and during treatment, and the sample is stored by adopting a proper method and treated in 2h (RNA degradation is avoided).

PBMCs isolation

Peripheral blood was transferred to a 15ml centrifuge tube, diluted with PBS of equal volume, and human PBMCs separation medium (Tianjin restricted biologic products science, Inc.) of equal volume to peripheral blood was added to another 15ml centrifuge tube.

Slowly superposing the diluted peripheral blood on the separation liquid, keeping a clear interface, centrifuging at room temperature of 450 Xg for 30min, and separating the liquid into four layers after centrifugation.

And (3) sucking the middle leucocyte layer into another clean 15ml centrifuge tube, adding PBS to 10-15ml, rotating at 1,500rpm, centrifuging for 10min, removing supernatant, and repeating twice to obtain PBMCs cell sediment.

RNA extraction

The lysed cells were fully blown out by adding 1ml of TRIzol LS Reagent to the 15ml centrifuge tube containing the PBMCs cell pellet, and transferred to a 1.5ml centrifuge tube after lysis.

0.2ml of chloroform was added to turn into a pink emulsion, which was shaken on a vortex shaker for 15 seconds and allowed to stand at room temperature for 10 min.

After centrifugation at 12000 Xg for 15min at 4 ℃ the sample will separate into three layers: the red organic phase, the middle layer and the upper colorless aqueous phase, with RNA predominantly in the aqueous phase, was transferred to a new tube (about 500 ul).

500ul of isopropanol was added to the resulting aqueous solution, and the mixture was mixed by inversion and allowed to stand at room temperature for 10 min.

Centrifugation was carried out at 12000 Xg for 10min at 4 ℃ to remove the supernatant, leaving an RNA gel.

Adding 1ml 75% ethanol (prepared with DEPC water), washing, precipitating, mixing, centrifuging at 4 deg.C 12000 Xg for 5min, removing supernatant, standing at room temperature for 10min, air drying, adding 10-20ul DEPC water, beating, incubating at 55-60 deg.C for 10min, and standing on ice.

Taking 1ul of sample, measuring purity and concentration by using a spectrophotometer, and storing the sample to-80 ℃.

cDNA Synthesis

A reaction mixture (Takara) from which genomic DNA was removed was prepared on ice according to the components shown in Table 1, and 1. mu.g of RNA was pipetted and mixed into the reaction mixture at 42 ℃ for 2min or at room temperature for 5 min.

TABLE 1 reaction mixture for removing genomic DNA

A reverse transcription reaction mixture (Takara) was prepared on ice according to the components shown in Table 2, and after mixing, reverse transcription was carried out at 37 ℃ for 15min, 85 ℃ for 5second, and 4 ℃ for hold. The reversed cDNA was placed on ice for further reaction or stored at-20 ℃.

TABLE 2 reverse transcription reaction System

Fluorescent quantitative PCR

A fluorescent quantitative PCR reaction mixture (Takara) is prepared on ice according to the components in the table 3, after the mixture is mixed, a PCR plate is placed on an Applied Biosystems 7500Real-Time PCR System instrument for PCR reaction, the PCR reaction is carried out according to the following procedures of 30second at 95 ℃, 40 reaction cycles (5 second at 95 ℃ and 34second at 60 ℃), a PCR product melting curve is established after the amplification, and the corresponding Ct value is obtained according to the procedures of 15second at 95 ℃, 1min at 60 ℃ and 15second at 95 ℃. The remaining PCR instruments (Applied Biosystems 7300/7500Fast Real-Time PCR System and StepOneNus Real-Time PCR System) were programmed accordingly to the instructions. GAPDH as internal reference, 2^－ΔΔCtAnd calculating the relative expression amount.

TABLE 3 fluorescent quantitative PCR reaction System

Specific primers for PCR:

a forward primer: 5'-TCACAAGAGAAAGACAGGGCA-3'

Reverse primer: 5'-GACAGCTTCATCCTCCATCTGAG-3' are provided.

The internal reference gene is GAPDH specific PCR primer:

a forward primer: 5'-GGGAGCCAAAAGGGTCATCA-3'

Reverse primer: 5'-TGATGGCATGGACTGTGGTC-3' are provided.

Statistics and results analysis

The statistical analysis was performed using SPSS20.0 and GraphPad Prism 8. The difference between the two groups was examined by t-test. Receiver operating characteristic curve (ROC) analysis was used to determine the diagnostic value of circRNA. P <0.05 was considered to be of particular statistical significance. Fluorescent quantitative PCR revealed that the expression of hsa _ circ _0069922 was clearly up-regulated in SAI compared to stroke-uninfected patients, see FIG. 2.

The diagnostic performance of differentially expressed circrnas was measured by ROC curve analysis and calculation of the area under the ROC curve (AUC). The AUC of hsa _ circ _0069922 was 0.832, and the 95% CI was 0.727-0.937 (FIG. 3). The results show that hsa _ circ _0069922 can be used as a marker for SAI diagnosis.

The above embodiments are disclosed as preferred embodiments of the present disclosure, but the disclosed embodiments are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present disclosure should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present disclosure.

Sequence listing

<110> Jiangyin city people hospital

<120> application of hsa _ circ _0069922 as marker

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 254

<212> DNA

<213> Homo sapiens

<400> 1

gatggaggat gaagctgtcc tggacagagg ggcttccttc ctcaagcatg tgtgtgatga 60

agaagaagta gaaggccacc ataccattta catcggagtc catgtgccga agagttacag 120

gagaaggaga cgtcacaaga gaaagacagg gcacaaagaa aagaaggaaa aggagagaat 180

ctctgagaac tactctgaca aatcagatat tgaaaatgct gatgaatcca gcagcagcat 240

cctaaaacct ctca 254

<210> 2

<211> 21

<212> DNA

<213> Homo sapiens

<400> 2

tcacaagaga aagacagggc a 21

<210> 3

<211> 23

<212> DNA

<213> Homo sapiens

<400> 3

gacagcttca tcctccatct gag 23

<210> 4

<211> 20

<212> DNA

<213> Homo sapiens

<400> 4

gggagccaaa agggtcatca 20

<210> 5

<211> 20

<212> DNA

<213> Homo sapiens

<400> 5

tgatggcatg gactgtggtc 20

Claims

1. The application of a reagent or a medicament for detecting the expression level of hsa _ circ _0069922 in single nucleated cells in peripheral blood of a patient in preparing a product for stroke-related infection screening is characterized in that the sequence of hsa _ circ _0069922 is shown as SEQ NO: 1.

2. The use according to claim 1, wherein the product for stroke-related infection screening comprises an agent or drug for detecting the expression level of hsa _ circ _0069922 in individual nucleated cells in the peripheral blood of a patient.

3. The use according to claim 1, wherein the reagent or medicament for detecting the expression level of hsa _ circ _0069922 in individual nucleated cells of peripheral blood of a patient comprises a PCR primer for detecting the amount of hsa _ circ _0069922 in the preparation of a product for screening stroke-related infections.

4. The use of claim 3, wherein the primer has the sequence shown in SEQ NO 2 and SEQ NO 3.

5. A kit for stroke-related infection screening, comprising the PCR primer of claim 3 or 4 and a primer for amplifying an internal reference gene.

6. The kit of claim 5, wherein the internal reference gene is GAPDH.

7. The kit of claim 6, wherein the primer sequences for amplifying GAPDH are shown in SEQ ID NO. 4 and SEQ ID NO. 5.