CN105886614A - Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method - Google Patents
Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method Download PDFInfo
- Publication number
- CN105886614A CN105886614A CN201610246829.9A CN201610246829A CN105886614A CN 105886614 A CN105886614 A CN 105886614A CN 201610246829 A CN201610246829 A CN 201610246829A CN 105886614 A CN105886614 A CN 105886614A
- Authority
- CN
- China
- Prior art keywords
- sub
- leaf
- chicken foot
- primer
- identification method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an identification method of upland cotton sub-okra leaf germplasm materials and special primers of the identification method. With the adoption of the identification method and the special primers of the identification method, early rapid identification can be performed on sub-okra leaf characters of the upland cotton sub-okra leaf germplasm materials, and the breeding process is accelerated. Genome DNA of to-be-tested upland cotton is taken as templates, the specific primers are used for PCR (polymerase chain reaction) amplification, judgment is performed according to banding patterns of PCR products on gel, the materials only containing the 230-bp banding pattern are sub-okra leaf homozygotes, the materials containing the 200-bp banding pattern are normal broad leaves, and the materials containing both the 230-bp banding pattern and the 200-bp banding pattern are sub-okra leaf heterozygotes. With the adoption of the identification method and the special primers of the identification method, the purity of the sub-okra leaf germplasm materials can be identified indoors by the aid of seeds or plantlets, the breeding process can be accelerated, and the selection efficiency of excellent sub-okra leaf homozygous materials can be improved.
Description
Technical field
The present invention relates to authentication method and the primer special thereof of a kind of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials, belong to cotton
Flower molecular biology application.
Background technology
Cotton Gossypii is the industrial crops that China is important, and its major product cotton fiber is important textile industry raw material, is spinning
Knit and industry plays the effect that can not be substituted.Blade is the photosynthetic organs that heavy cotton is wanted, and is responsible for converting luminous energy
Become carbohydrate for plant growth promoter.The growth promoter of Cotton Gossypii is had a significant impact by the change of blade shape,
And then have influence on production of cotton fibers and quality.Gossypium hirsutum L. is leaf is divided into normal leaf and drastic crack leaf.Normal leaf is leaf
For duck's foot type, leaf splits shallower, and leaf area is big, and mismanagement is typically easy to cause that Cotton Canopy is strongly fragrant to be covered, in making under
Portion's cotton boll produces severe detachment because illumination is not enough, and the overcast and rainy time easily causes rotten bell, easily affects defoliant
Spraying effect, affects machine cotton picking quality.
Sub-chicken foot leaf belongs to Cotton Gossypii drastic crack leaf, and leaf splits relatively deep, and leaf-area coefficient is moderate；It is being effectively improved Cotton Gossypii hat
While Rotating fields, the problem that chicken foot leaf cotton Efficient leaf area is not enough can be made up to a certain extent；Additionally, it is sub-
Chicken foot leaf phenotype can be used for distinguishing true and false hybrid as morphological markers, has bigger use in cotton hybrid vigor utilizes
On the way.
At present, typically by identifying sub-chicken foot leaf material in flower bud phase and the leaf phenotype of florescence investigation in production.Right
The sub-chicken foot leaf material that isozygotys typically requires with the qualification of hybrid material and preferred material kind is become plant, in next season
Joint plant leaf separation phenotypic evaluation rear can determine whether that this individual plant is whether for type of isozygotying.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, it is provided that the authentication method of a kind of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials
And primer special, can the sub-chicken foot leaf character that have all to Gossypium hirsutum L. Asia chicken foot leaf germplasm materials carry out in early days
Rapid identification, accelerates breeding process.
Therefore, the technical scheme that the present invention takes is as follows: the qualification side of a kind of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials
Method, with the genomic DNA of Gossypium hirsutum L. to be measured as template, uses primer pair: forward primer 5 '
GATGCACCAGATCCTTTTAT 3 ' and reverse primer 5 '
GGTACATCGGAATCACAGT 3 ', carries out PCR amplification, according to PCR primer on gel in
Existing banding pattern judges, comprise only 230bp banding pattern for sub-chicken foot leaf homozygote, containing 200bp banding pattern
For normal broad-leaved, both of which have for sub-chicken foot leaf heterozygote.
Above-mentioned banding pattern is master tape banding pattern.
Described pcr amplification reaction system and program be:
PCR system is 20ul, comprises 2 × EasyTaqPCR Supermix 10ul, DNA profiling 1ul, institute
State forward primer and each 1ul of reverse primer, DDH2O 7ul；
PCR program is 94 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 50s
10min is extended after (35 circulations) 72 DEG C；
Another object of the present invention is to provide described primer in preparation for identifying or auxiliary qualification Gossypium hirsutum L. Asia chicken foot
Application in the test kit of leaf germplasm materials.
The present invention also provides for a kind of for identifying or the test kit of auxiliary qualification Gossypium hirsutum L. Asia chicken foot leaf germplasm materials,
Containing described primer.
The existing method identifying sub-chicken foot leaf material has a disadvantage in that
1. it not too obvious owing to leaf splits phenotype in Cotton Gossypii fertility early stage performance, can only start to identify from the flower bud phase,
The sub-chicken foot leaf individual plant that wheat seeding is excellent cannot be screened.
It is the most protected from environmental that the most leaf phenotype belongs to morphological markers, brings necessarily to the stability of phenotypic evaluation
Difficulty.
3., from heredity angle, sub-chicken foot leaf is incomplete dominant lnheritance to normal leaf, but educates in land for growing field crops
Homozygous and heterozygous the differentiation difficulty of the sub-chicken foot leaf that isozygotys during Zhong is relatively big, have impact on excellence and isozygotys sub-chicken foot
The screening efficiency of leaf material, have impact on breeding process.
Therefore, for the shortcoming of above-mentioned prior art, the present invention have selected the sub-chicken of PCR-based molecular marker
Foot leaf material screening methodologies, sub-chicken foot leaf material can be identified, and guarantee simultaneously by the inventive method in advance
The accuracy of sub-chicken foot leaf material screening and high efficiency.
Compared with prior art the invention have the advantages that
1. at indoor seed or seedling, sub-chicken foot leaf germplasm materials purity can be identified by this invention,
The qualification of sub-chicken foot leaf material can be advanceed to seedling stage big Tanaka in period, filter out the Asia in wheat seeding excellence
Chicken foot leaf material；
2. the DNA molecular marker that the present invention uses belongs to neutral labelling, not by period, environment and histoorgan
Impact, qualification result is reliable and stable；
3. the present invention can distinguish sub-chicken foot leaf homozygote and heterozygote material, it is simple to accelerates breeding process, improves
Excellent sub-chicken foot leaf isozygotys the efficiency of selection of material.
Accompanying drawing explanation
Fig. 1 is form phenotype and the marker genetype Statistical Comparison of part individual plant.
Detailed description of the invention
Below in conjunction with concrete test method, technical scheme and produced technique effect thereof are entered
The elaboration of one step, the description below is merely to explain the present invention, but is any limitation as the present invention never in any form,
Based on present invention teach that any conversion or replacement made, belong to protection scope of the present invention.
Method used in the present invention if no special instructions, is this area conventional method.
Test material used in following embodiment, reagent etc., if no special instructions, the most commercially
Arrive.Each water article kind (strain) used is conventional use of kind (strain) in breeding field, logical
Cross country's authorization to assert or technical appraisement, can obtain or market purchasing at species bank.
Embodiment one. the authentication method of a kind of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials, step is as follows:
1. take Gossypium hirsutum L. fresh material tender leaf in seed or seedling stage, extract genomic DNA, and to DNA matter
Amount detects, and is diluted to 50ng/ul；
2. according to known Cotton Gossypii EST series, a pair special SSR label primer of SSRhunter software design,
Forward primer: 5 ' GATGCACCAGATCCTTTTAT 3 ' (SEQ ID No.1)；Reverse primer:
5’—GGTACATCGGAATCACAGT—3’(SEQ ID No.2)。
The est sequence of design primer is following (SEQ ID No.3), and underscore represents primer location.
CTGGACTAACACCAATAATCACTAAACTTTGATTAAAATAACATTTCAGTTACTAAA
CTTTCAAAAGTGACAAATCAGTCATTAACATTTACGAAAAGTGACAAATTAGTCACC
TGAGAGTGGACATCTGACGTGGCCCGTTAGGGTGCCACGTTGAACATGATCGGATGC ACCAGATCCTTTTATTAGTTTATAAGGATTACCAACTAAATAGAAGAAGAAGAAGAA
GAGGAAGAAGAAGAAGAAAAGGAAGAAGAAGAAGAAGAATAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAAAAGAGAAATGGAAATACCCACTGTGATTCCGATGTACC
GTCATTTGGACGGAATTTAAAAGACACTTTAGTTGTTATTAAGAACTGATTTTTATT
TGGATTTAAAAGAC
3. with the DNA of dilution as template, carrying out PCR amplification, reaction system and the program of operation are as follows:
PCR system is 20ul, comprises 2 × EasyTaqPCR Supermix 10ul, DNA profiling 1ul, on
Trip primer and each 1ul of downstream primer, DDH2O 7ul；
PCR program is 94 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, and 55 DEG C of annealing 30s, 72 DEG C extend 50s
10min is extended after (35 circulations) 72 DEG C；
4.PCR product is separated by electrophoresis in the PAGE glue of 8%, voltage 120V, 2h, uses argentation dye
Color；
5. marker genetype is identified, judges according to the banding pattern that PCR primer presents on gel, comprises only
230bp banding pattern for sub-chicken foot leaf homozygote, containing 200bp banding pattern for normal broad-leaved, both of which has plenty of
Sub-chicken foot leaf heterozygote.
Embodiment two. by the inventive method, 100 samples are carried out the qualification of sub-chicken foot leaf
1. material:
With normal broad-leaved material Shandong cotton grind No. 28 for maternal, sub-chicken foot leaf material S131189 system of isozygotying is male parent,
Structure is forgiven the sub-chicken foot leaf of 229 individual plants and is separated F with normal broad-leaved2Colony.
2.DNA extracts:
Randomly select 100 individual plants seedling stage, extract young leaflet tablet, extract genomic DNA by CTAB method,
And DNA mass is detected, concentration is adjusted to 50ng/ul.
3.PCR reacts:
PCR reaction is carried out on ABI9700PCR instrument, and system is 20ul, including the 2 × EasyPCR of 10ul
The each 1ul of the DNA profiling of mix, 1ul, forward primer and downstream primer, the DDH of 7ul2O.Response procedures
Being 94 DEG C of denaturations 5min, 94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 50s, and 35 circulate, 72 DEG C
Extend 10min.
4. electrophoresis and genotype identification:
PCR primer is separated by electrophoresis in the polyacrylamide gel of 8%, as it is shown in figure 1, statistic mass 230bp
(Brazilian 014 genotype) and 200bp (S131189) banding pattern.Only have 230bp banding pattern genotype and be designated as B；
Only having 200bp banding pattern genotype is A；Comprise two kinds of 230bp and 200bp banding patterns simultaneously and be designated as H.
The most leaf phenotypic evaluation:
Respectively at flower bud phase and seedling stage, the separation phenotype that colony is leaf is identified.Normal broad-leaved is labeled as B, sub-
Chicken foot leaf isozygotys and is labeled as A, and sub-chicken foot leaf hybrid marker is H.
6. data statistics:
Form phenotype and genotype to segregating population are added up respectively, and check the identical situation of genotype and phenotype.
7. result and analysis:
The statistics display of form phenotype, in 100 individual plants, the strain of normal broad-leaved 23, sub-chicken foot leaf isozygotys 32
Strain, sub-chicken foot leaf heterozygosis 45 strain.Genotype statistics display, in 100 individualities, genotype is the individuality of A
Being 40, gene is the individuality 36 of H, and genotype is the individuality 23 of B.The phenotype of normal broad-leaved and gene
Type performance is consistent, and sub-chicken foot leaf isozygotys and the phenotype of heterozygosis and genotype have 8 individual plants performance differences, 6 bases
Because Phenotypic Expression that type is A is sub-chicken foot leaf heterozygosis, 2 genotype be the Phenotypic Expression of H be sub-chicken foot leaf
Isozygoty.100 individual plant kinds are become plant, and the coincide plant phenotype of individual plant of 92 genotype and phenotype does not occurs
Separating, 6 genotype are that the plant of the individual plant of A all sub-chicken foot leafs of leaf separation does not occurs, illustrate this 6
The all sub-chicken foot leafs of individual individual plant isozygoty individual plant.2 genotype are H, and phenotypic evaluation is the individual plant of A, 1
The all sub-chicken foot leafs of plant of individual plant, other 1 shows as sub-chicken foot leaf and normal leaf separation.
By comparing it is known that the accuracy rate that routine phenotypic is identified is 92%, and genotype identification of the present invention
Accuracy rate is 99%；And routine phenotypic qualification can only start to identify from the flower bud phase, it is impossible to screening wheat seeding excellence
Sub-chicken foot leaf individual plant, and genotype identification of the present invention can advance to seedling stage, filters out the Asia in wheat seeding excellence
Chicken foot leaf material.This explanation present invention authentication method based on molecular marker is more more reliable than identification of morphology.
Claims (4)
1. an authentication method for Gossypium hirsutum L. Asia chicken foot leaf germplasm materials, is characterized in that, with the genomic DNA of Gossypium hirsutum L. to be measured
For template, use primer pair: forward primer 5 ' GATGCACCAGATCCTTTTAT 3 ' and reverse primer 5 '
GGTACATCGGAATCACAGT 3 ', carries out PCR amplification, carries out according to the banding pattern that PCR primer presents on gel
Judge, comprise only 230bp banding pattern for sub-chicken foot leaf homozygote, containing 200bp banding pattern for normal broad-leaved, what both of which had is
Sub-chicken foot leaf heterozygote.
2. for identifying the primer of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials, it is characterized in that, sequence is: forward primer 5 '
GATGCACCAGATCCTTTTAT 3 ', reverse primer 5 ' GGTACATCGGAATCACAGT 3 '.
3. primer described in claim 2 is identified in the test kit of Gossypium hirsutum L. Asia chicken foot leaf germplasm materials for qualification or auxiliary in preparation
Application.
4., for identifying or a test kit for auxiliary qualification Gossypium hirsutum L. Asia chicken foot leaf germplasm materials, it is characterized in that, want containing having the right
Seek primer described in 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610246829.9A CN105886614B (en) | 2016-04-20 | 2016-04-20 | A kind of identification method and its primer special of upland cotton Asia chicken foot leaf germplasm materials |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610246829.9A CN105886614B (en) | 2016-04-20 | 2016-04-20 | A kind of identification method and its primer special of upland cotton Asia chicken foot leaf germplasm materials |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105886614A true CN105886614A (en) | 2016-08-24 |
| CN105886614B CN105886614B (en) | 2019-05-24 |
Family
ID=56704121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610246829.9A Active CN105886614B (en) | 2016-04-20 | 2016-04-20 | A kind of identification method and its primer special of upland cotton Asia chicken foot leaf germplasm materials |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105886614B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757030A (en) * | 2014-01-14 | 2014-04-30 | 浙江农林大学 | Alleles for regulating and controlling two types of main stem table fur types of upland cotton, and single stranded conformational polymorphism (SSCP) molecular marker for identification thereof |
| WO2014172529A1 (en) * | 2013-04-17 | 2014-10-23 | Pioneer Hi-Bred International, Inc. | Methods for characterizing dna sequence composition in a genome |
-
2016
- 2016-04-20 CN CN201610246829.9A patent/CN105886614B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014172529A1 (en) * | 2013-04-17 | 2014-10-23 | Pioneer Hi-Bred International, Inc. | Methods for characterizing dna sequence composition in a genome |
| CN103757030A (en) * | 2014-01-14 | 2014-04-30 | 浙江农林大学 | Alleles for regulating and controlling two types of main stem table fur types of upland cotton, and single stranded conformational polymorphism (SSCP) molecular marker for identification thereof |
Non-Patent Citations (2)
| Title |
|---|
| ANDRES RJ ET AL.: "Mapping and genomic targeting of the major leaf shape gene (L) in Upland cotton (Gossypium hirsutum L.)", 《THEORETICAL AND APPLIED GENETICS》 * |
| 韩世杰等: "陆地棉张氏鸡脚叶标记系的鉴定与比较", 《棉花科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105886614B (en) | 2019-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109251995B (en) | CAPS molecular marker for identifying watermelon peel background color and application thereof | |
| CN111961750A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN111961749B (en) | KASP primer for detecting tomato yellow leaf curl virus disease-resistant genes Ty-3 and Ty-3a and application thereof | |
| CN107400721A (en) | With two InDel marks of cucumber yellow-white pericarp close linkage and application | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| Beser et al. | Marker-assisted introgression of a broad-spectrum resistance gene, Pi40 improved blast resistance of two elite rice (Oryza sativa L.) cultivars of Turkey | |
| CN113604596A (en) | KASP primer for detecting cucumber small zucchini yellow mosaic virus disease resistance gene zym and application thereof | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN105734141A (en) | Molecular biology method for identifying purity of tobacco varieties | |
| CN110273020B (en) | SNP molecular marker for distinguishing summer orange and common sweet orange of citrus and application thereof | |
| CN111961751A (en) | KASP primer for detecting tomato root-knot nematode resistance gene Mi-1.2 and application thereof | |
| KR101286989B1 (en) | Multiplex real time pcr method for discrimination of rice cultivar | |
| Jayawardana et al. | Evaluation of DNA markers linked to blast resistant genes, Pikh, Pit (p), and Pita, for parental selection in Sri Lankan rice breeding | |
| CN114164294B (en) | SNP locus related to green keeping property of Chinese cabbage and application thereof | |
| CN105506075A (en) | SNP (Single Nucleotide Polymorphism) marker related to resistance to alternaria kikuchiana and application | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN116162721A (en) | Molecular marker for distinguishing size of pumpkin fruits, identification method and application | |
| CN105886614A (en) | Identification method of upland cotton sub-okra leaf germplasm materials and special primers of method | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| CN112391489B (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN111549172A (en) | Watermelon leaf posterior green gene linkage site and CAPS marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |