CN105802985B - A method of fast implementing bacillus licheniformis gene knockout - Google Patents
A method of fast implementing bacillus licheniformis gene knockout Download PDFInfo
- Publication number
- CN105802985B CN105802985B CN201610240529.XA CN201610240529A CN105802985B CN 105802985 B CN105802985 B CN 105802985B CN 201610240529 A CN201610240529 A CN 201610240529A CN 105802985 B CN105802985 B CN 105802985B
- Authority
- CN
- China
- Prior art keywords
- pcr
- bacillus licheniformis
- segment
- gene
- follows
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a kind of methods for fast implementing bacillus licheniformis gene knockout.The following steps are included: (1) obtain bacillus licheniformis in intend knock out gene encoder block in one section of genetic fragment as homology arm sequence；(2) resistance label genetic fragment is obtained；(3) by carrying out Overlap extension PCR to homology arm sequence and resistance label genetic fragment, the fusion gene sequence comprising homology arm sequence and resistance label genetic fragment is obtained, and use as gene knockout segment；(4) single endonuclease digestion is carried out to fusion gene sequence, converts bacillus licheniformis competent cell, after recovery culture and screening and culturing, the bacillus licheniformis of gene knockout is made.The present invention is based on single-swap principles to carry out bacillus licheniformis gene knockout, and knockout process only needs to generate a homologous recombination, and integration process is efficient；Entire knock out can complete with screening operation in 3~4 days, and the gene knockout period is short, and knockout cost is effectively reduced.
Description
Technical field
The present invention relates to a kind of methods for fast implementing bacillus licheniformis gene knockout, belong to biotechnology technology neck
Domain.
Background technique
Bacillus licheniformis (Bacillus licheniformis) is that one kind is widely present in nature and can resist evil
The Gram-positive thermophilic bacteria of bad environment is one of production bacterial strain important in biotechnological industries field.It mainly answers at present
For fields such as medicine, biological washing powder, nanotechnologies, and show up prominently in terms of biological material degradation.Changed by molecule
It makes and the metabolism of bacillus licheniformis is regulated and controled to realize that purpose product accumulation has been reported.
Gene knockout (gene knockout), also known as gene targeting are a kind of novel Protocols in Molecular Biology, its benefit
With DNA transformation technology, after the targeting vector of building is imported target cell, by being dyed in recombinant vector DNA sequence dna and target cell
Carrier DNA site-directed integration, is entered the site of a certain determination on target cell genome by homologous DNA sequence on body, or with target cell base
Because organizing upper a certain determining segment displacement, make the specific gene inactivation of body or missing, to change the method for cell trait.
Currently, being mostly the homologous double-crossover method used using plasmid as carrier when carrying out gene knockout to bacillus licheniformis, that is, obtain mesh
Two sections of gene orders of gene upstream and downstream as homology arm, construct shuttle vector or suicide vector and be transformed into purpose bacterial strain,
It needs that single-swap twice successively occurs after conversion, realizes the knockout of target gene.Though the method for carrying out gene knockout with above-mentioned principle
It has so been widely used at present, but unitary construction process is complicated, the operation cycle is long.
The serpin gene knockout constructed such as Chinese patent literature CN103146739A (application number: CN201310070885)
Carrier is by the elements such as upstream homology arm (Up-serpin), resistant gene, downstream homology arm (Down-serpin) and pUC57 head and the tail
It connects and composes, therefore only carrier construction just needs digestion connection for several times and sequencing procedures, completes time-consuming several weeks in whole operation period
Even one month or more, simultaneously because carrier structure is complicated, sequence was longer, and transformation efficiency is generally lower.Although above method energy
Enough realize the specific demands such as the seamless knockout of gene, but in gene knockout operation for the purpose of verifying by gene function, such
Method often becomes the speed limit link of entire experiment flow.
Summary of the invention
In view of the deficiencies of the prior art, the present invention provides a kind of methods for fast implementing bacillus licheniformis gene knockout.
This method knocks out segment using the building of two step of round pcr, and conversion is into target bacillus licheniformis after digestion, by primary homologous
Single-swap is inserted into one section of sequence containing riddled basins inside target gene, realizes the knockout of target gene.
Technical solution of the present invention is as follows:
A method of fast implementing bacillus licheniformis gene knockout, which comprises the following steps:
(1) design primer F1 and R1, by round pcr, obtains lichens gemma using bacillus licheniformis genome as template
Intending knocking out a segment length in gene encoder block in bacillus is the genetic fragment greater than 400bp as homology arm sequence；
(2) design primer F2 and R2, using containing resistant label gene carrier or sequence as template, by round pcr, obtain
Take resistance label genetic fragment；
(3) as carrying out weight to resistance label genetic fragment made from homology arm sequence made from step (1) and step (2)
Folded extension PCR, obtains the fusion gene sequence comprising homology arm sequence and resistance label genetic fragment, and as gene knockout piece
Section uses, and obtains fusion two end of segment and contains the identical restriction enzyme enzyme introduced by primers F 1/R2 or F2/R1
Enzyme site, and the restriction enzyme site does not knock out in gene and resistance label genetic fragment quasi-；
(4) single endonuclease digestion is carried out to fusion gene sequence made from step (3), being then concentrated into concentration is 300~5000 μ g/
Ml converts bacillus licheniformis competent cell, and after recovery culture and screening and culturing, the lichens gemma bar of gene knockout is made
Bacterium.
It is preferred according to the present invention, intend knocking out gene in the step (1) being glycoside hydrolase, nucleotide
When sequence such as SEQ ID NO.1, the nucleotide sequence of primers F 1 and R1 are as follows:
F1:CGGGATCCAACCGTTCTTTTATCCGCAGT
R1:CCAGCAAAATTCAGCATCTCTCGGTTAAGCA
Wherein, underscore mark is BamH I restriction enzyme site.
According to the present invention it is further preferred that PCR amplification system is as follows in the step (1):
Primers F 1 2.0 the μ l, 2.0 μ of primer R1 of 10 μm of ol/L of 2 × HiFi-PCR master 25 μ l, 10 μm of ol/L
L, 2.0 μ l of template, uses ddH2O supplies 50 μ l；
The PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 30 recycle；72
DEG C extend 10min, 4 DEG C preservation；
Preferred according to the present invention, resistance label gene is chloramphenicol, nucleotide sequence such as SEQ ID in the step (2)
When shown in NO.2, the nucleotide sequence of primers F 2 and R2 are as follows:
F2:CCGAGAGATGCTGAATTTTGCTGGCCTTTTGCTCA
R2:AACGTATCATGGGATCCTAGTGACTGGCGATGCTG
Wherein, underscore mark is BamH I restriction enzyme site.
According to the present invention it is further preferred that PCR amplification system is as follows in the step (2):
2 × HiFi-PCR master, 25 μ l, the primers F of 10 μm of ol/L22.0 μ l, the primer R of 10 μm of ol/L22.0 μ l,
2.0 μ l of template, uses ddH2O supplies 50 μ l；
The PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 3min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations；
Preferred according to the present invention, the first amplification system of over-lap PCR is as follows in the step (3):
2 μ l of GH1 segment；Cmr2 μ l of segment；2×HiFi-PCR master 12.5μl；ddH2O 8.5μl；
The first amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 5 recycle；72
DEG C extend 2min；
The supplement amplification system of the over-lap PCR is as follows:
The upstream primer F of 10 μm of ol/L12μl；The downstream primer R of 10 μm of ol/L22μl；2×HiFi-PCR master
12.5μl；ddH2O 8.5μl；
The supplement amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 5min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations；
Preferred according to the present invention, the preparation step of bacillus licheniformis competent cell is as follows in the step (4):
The fresh bacillus licheniformis single colonie of picking, 35~38 DEG C, to expand culture under the conditions of 200~240rpm dense to thallus
Spend OD600It is 0.7~0.9, is placed in cooled on ice, is centrifuged after cooling, then turn buffer washing thalline 3~5 with the electricity of pre-cooling
It is secondary, in the sterile EP tube of packing to pre-cooling, bacillus licheniformis Electrocompetent cells are made；
The expansion culture medium is that addition sorbierite to concentration is 0.4~0.6M on the basis of LB culture medium；
It is as follows that the electricity turns buffer composition:
0.4~0.6M sorbierite, 0.4~0.6M mannitol, 0.05M~0.16M glycerol, water are prepared.
It is preferred according to the present invention, electrotransformation is converted into the step (4), electrotransformation condition is 1800~2200V electricity
4~6ms is hit, liquid resuscitation culture medium 3~4h of culture is added immediately after, after centrifugation, takes thallus, suspension contains antibiotic
Plate screening culture；
The liquid resuscitation culture medium is that sorbierite to concentration is added on the basis of LB culture medium is 0.4~0.6M and sweet
Revealing alcohol to concentration is 0.4~0.5M.
Preferred according to the present invention, one kind fast implementing bacillus licheniformis glycoside hydrolase gene knockout
Method, which comprises the following steps:
(i) DNA for extracting Bacillus licheniformis body uses primers F using DNA as template1And R1PCR amplification is carried out, is obtained
To the homology arm GH1 for GH gene knockout, the PCR primer sequence is as follows:
F1:CGGGATCCAACCGTTCTTTTATCCGCAGT
R1:CCAGCAAAATTCAGCATCTCTCGGTTAAGCA
(ii) DNA for extracting the PHT01 of shuttle plasmid uses primers F using DNA as template2And R2PCR amplification is carried out, is obtained
To chloramphenicol resistance gene segment Cmr, the PCR primer sequence is as follows:
F2:CCGAGAGATGCTGAATTTTGCTGGCCTTTTGCTCA
R2:AACGTATCATGGGATCCTAGTGACTGGCGATGCTG
(iii) by Cm made from GH1 segment made from step (i) and step (ii)rSegment carries out over-lap PCR, is made
GH1-CmrSegment；
The first amplification system of the over-lap PCR is as follows:
2 μ l of GH1 segment；Cmr2 μ l of segment；2×HiFi-PCR master 12.5μl；ddH2O 8.5μl；
The first amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 5 recycle；72
DEG C extend 2min；
The supplement amplification system of the over-lap PCR is as follows:
The upstream primer F of 10 μm of ol/L12μl；The downstream primer R of 10 μm of ol/L22μl；2×HiFi-PCR master
12.5μl；ddH2O 8.5μl；
The supplement amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 5min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations；
(iv) by GH1-Cm made from step (iii)rSegment is digested with restriction enzyme BamH I, and utilizes electrotransformation
Instrument is converted to bacillus licheniformis competent cell, and electrotransformation condition is 1800~2200V, 4~6ms of electric shock, is added immediately after
Liquid resuscitation culture medium 3~4h of culture, after centrifugation, takes thallus, and obtained cell is coated in the Luria Broth solid containing chloramphenicol
It on culture medium, is cultivated 1~2 day at 37 DEG C, screens the transformant with chlorampenicol resistant.
Beneficial effect
The present invention is based on single-swap principles to carry out bacillus licheniformis gene knockout, and knockout process only needs to generate primary homologous
It recombinates (single-swap), integration process is efficient；The knockout segment that the present invention constructs only includes two sections of sequences (homology arm and antibiosis
Plain resistance label gene), building process is simple；Bacillus licheniformis gene knockout method provided by the present invention, it is entire to knock out
It can be completed in 3~4 days with screening operation, the gene knockout period is short, and knockout cost is effectively reduced, and improves working efficiency.
Detailed description of the invention
Fig. 1 is building and the knockout flow chart of bacillus licheniformis segment；
Fig. 2 is the electrophoresis detection result photo of homology arm GH1；
Swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~3 is positive recombinant verification result.
Fig. 3 is CmrThe electrophoresis detection result photo of segment；
Swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~4 is positive recombinant verification result.
Fig. 4 is the knockout verification result photo of bacillus licheniformis glycoside hydrolase gene；
Swimming lane M is that DNA molecular amount marks (DNA marker), and swimming lane 1~5 is positive recombinant verification result.
Specific embodiment
Technical solution of the present invention is further elaborated below with reference to embodiment, but institute's protection scope of the present invention is not limited to
This.
Biological material source:
Shuttle plasmid PHT01 is purchased from Hangzhou Bao Sai Biotechnology Co., Ltd；
Bacillus licheniformis (Bacillus licheniformis) is purchased from Chinese industrial Culture Collection
(CICC)；Bacterium numbering is CICC20085；
LB nutrient media components are as follows, are weight percentage:
Peptone 1%, yeast extract 0.5%, sodium chloride 1%, surplus are water, pH7.0~7.4.
Embodiment 1
The building of gene knockout segment
(i) DNA for extracting bacillus licheniformis Bacillus licheniformis thallus is carried out using DNA as template
PCR amplification obtains homology arm GH1；
The PCR primer sequence is as follows:
F1:CGGGATCCAACCGTTCTTTTATCCGCAGT
R1:CCAGCAAAATTCAGCATCTCTCGGTTAAGCA
Wherein, underscore is identified as BamH I restriction enzyme site；
The PCR amplification system is 50 μ l:
Primers F 1 2.0 the μ l, 2.0 μ of primer R1 of 10 μm of ol/L of 2 × HiFi-PCR master 25 μ l, 10 μm of ol/L
L, 2.0 μ l of template, uses ddH2O supplies 50 μ l；
The PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 30 recycle；72
DEG C extend 10min, 4 DEG C preservation；
Agarose gel electrophoresis examines PCR product, and length is 549bp (SEQ ID NO.3, as shown in Figure 2), uses
SanPrep pillar DNA plastic recovery kit (the raw work in Shanghai) carries out glue recycling, and -20 DEG C of recovery product preservations are spare；
(ii) DNA for extracting shuttle plasmid pHT01 carries out PCR amplification, obtains Cm using DNA as templaterSegment；
The PCR primer sequence is as follows:
F2:CCGAGAGATGCTGAATTTTGCTGGCCTTTTGCTCA
R2:AACGTATCATGGGATCCTAGTGACTGGCGATGCTG
Wherein, underscore is identified as BamH I restriction enzyme site
The PCR amplification system is 50 μ l:
2 × HiFi-PCR master, 25 μ l, the primers F of 10 μm of ol/L22.0 μ l, the primer R of 10 μm of ol/L22.0 μ l,
2.0 μ l of template, uses ddH2O supplies 50 μ l；
The PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 3min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations；
Agarose gel electrophoresis examines PCR product, and length is 1245bp (SEQ ID NO.2, as shown in Figure 3), uses
SanPrep pillar DNA plastic recovery kit (the raw work in Shanghai) carries out glue recycling, and -20 DEG C of recovery product preservations are spare；
(iii) by Cm made from GH1 segment made from step (i) and step (ii)rSegment carries out over-lap PCR, is made
GH1-CmrSegment；
The first amplification system of the over-lap PCR is 25 μ l:
2 μ l of GH1 segment；Cmr2 μ l of segment；2×HiFi-PCR master 12.5μl；ddH2O 8.5μl；
The first amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 5 recycle；72
DEG C extend 2min；
The supplement amplification system of the over-lap PCR is 25 μ l:
The upstream primer F of 10 μm of ol/L12μl；The downstream primer R of 10 μm of ol/L22μl；2×HiFi-PCR master
12.5μl；ddH2O 8.5μl；
The supplement amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 5min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations；
Agarose gel electrophoresis examines PCR product, and length 1794bp uses SanPrep pillar DNA plastic recovery kit
(the raw work in Shanghai) carries out glue recycling, and -20 DEG C of recovery product preservations are spare；
Through detecting, the gene order of knockout is as shown in SEQ ID NO.1.
Embodiment 2
Prepare bacillus licheniformis competence
(i) the bacillus licheniformis single colonie of the fresh LB solid culture primary surface of picking is inoculated in 10mL GM (expansion) training
It supports in base, 37 DEG C, 220r/min are incubated overnight；
(ii) the above-mentioned bacterium solution of 1mL is taken to be transferred to 100mL GM (expansion) fluid nutrient medium, 37 DEG C, 220r/min cultivate to
OD600=0.9；
(iii) bacterium solution is transferred to 100mL centrifuge tube, ice bath 20min makes thallus stop growing；
(iv) 4 DEG C after ice bath thallus is collected in, 5000g, 5min centrifugation；
(v) electricity of the thallus pre-cooling after being centrifuged turns buffer (ETM) and washs 3 times；
(vi) after washing, turn buffer using 1000uL electricity and thallus is resuspended；
(vii) competent cell prepared is dispensed into the 100 every pipes of μ L, -80 DEG C of preservations are spare.
Wherein, GM:LB+0.5M sorbierite
ETM:0.5M sorbierite+0.5M mannitol+0.11M glycerol.
Embodiment 3
By GH1-CmrSegment converts Bacillus licheniformis cell
(i) by GH1-Cm made from embodiment 1rSegment is digested with restriction enzyme BamH I；
Digestion system (40uL) is as follows:
(ii) digestion products are concentrated and purified
(1) 1/10 volume 3M sodium acetate and 2.5 times of volume dehydrated alcohols are added, are placed in -20 DEG C of refrigerator 20min；
(2) 12000r/min, centrifugation 5min must be precipitated；
Precipitating is resuspended in the ethyl alcohol that (3) 300 μ L percents by volume are 75%；
(4) 12000r/min is centrifuged 5min, removes ethyl alcohol, 37 DEG C of air-dried 30min；
(5) 15~18 μ L ddH are added2DNA is resuspended in O, is placed in -20 DEG C of preservations.
(iii) electrotransformation
GH1-Cm is measured using nucleic acid ultramicrospectrophotometerrFragment concentrations carry out electricity after reaching 2000 μ g/ml of concentration
Conversion, electrotransformation condition are 2100V, 5ms, then cultivate in RM (liquid resuscitation) culture medium, take after obtained cell recovery
100 μ L are coated on the LB solid medium containing 30 μ g/ml chloramphenicol, are cultivated 1~2 day at 37 DEG C, and screening is anti-with chloramphenicol
The transformant of property；
RM:LB+0.5M sorbierite+0.38M mannitol.
Embodiment 4
The culture and identification of positive restructuring bacterium
The above-mentioned positive restructuring bacterium colony of picking is inoculated into the LB liquid medium containing chlorampenicol resistant 37 DEG C of overnight incubations,
After the completion of culture, recombinant bacterium DNA is extracted using the kit that Shanghai bioengineering Co., Ltd provides, and with the genome of acquisition
For template, F1And R2PCR amplification is carried out for primer, amplified production is verified using agarose gel electrophoresis；
The PCR primer sequence is as follows:
F1:CGGGATCCAACCGTTCTTTTATCCGCAGT
R2:AACGTATCATGGGATCCTAGTGACTGGCGATGCTG
Wherein, underscore mark is restriction enzyme site
The PCR amplification system is 20 μ l:
2 × HiFi-PCR master, 10 μ l, primers F1(10 μm of ol/L) 1.0 μ l, primer R2(10 μm of ol/L) 1.0 μ l, mould
1.0 μ l of plate, uses ddH2O supplies 20 μ l；
The PCR amplification program is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 4min, 30 recycle；72℃
Extend 10min, 4 DEG C of preservations, agarose gel electrophoresis examines PCR product.
Testing result is as shown in Figure 2.Knockout process of the present invention only needs to generate a homologous recombination it can be seen from the result
(single-swap) can be effectively reduced knockout cost, improve working efficiency.
Claims (1)
1. one kind fast implements bacillus licheniformisglycoside hydrolaseThe method of gene knockout, which is characterized in that packet
Include following steps:
(i) the DNA for extracting Bacillus licheniformis body uses primers F using DNA as template1And R1PCR amplification is carried out, is used
Inglycoside hydrolaseThe homology arm GH1 of gene knockout, the PCR primer sequence are as follows:
F1: CG GGATCCAACCGTTCTTTTATCCGCAGT,
R1: CCAGCAAAATTCAGCATCTCTCGGTTAAGCA；
(ii) the DNA for extracting the PHT01 of shuttle plasmid uses primers F using DNA as template2And R2PCR amplification is carried out, chlorine is obtained
Mycin resistant gene segment Cmr, the PCR primer sequence is as follows:
F2: CCGAGAGATGCTGAATTTTGCTGGCCTTTTGCTCA,
R2: AACGTATCATGGGATCCTAGTGACTGGCGATGCTG；
(iii) by Cm made from GH1 segment made from step (i) and step (ii)rSegment carries out over-lap PCR, and GH1-Cm is mader
Segment；
The first amplification system of the over-lap PCR is as follows:
GH1 segment 2 μ l, Cmr2 μ l, 2 × HiFi-PCR master of segment 12.5 μ l, ddH2O 8.5μl；
The first amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 5 recycle；72 DEG C are prolonged
Stretch 2min；
The supplement amplification system of the over-lap PCR is as follows:
The upstream primer F of 10 μm of ol/L12 μ l, the downstream primer R of 10 μm of ol/L22 μ l, 2 × HiFi-PCR master, 12.5 μ
L, ddH2O 8.5μl；
The supplement amplification program of the over-lap PCR is as follows:
95 DEG C of initial denaturation 5min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 5min, 30 recycle；72 DEG C of extensions
10min, 4 DEG C of preservations；
(iv) by GH1-Cm made from step (iii)rSegment restriction enzymeBamHI digestion, and turned using electric converter
Change to bacillus licheniformis competent cell, electrotransformation condition is 1800~2200V, 4~6ms of electric shock, and liquid is added immediately after
Recovery medium 3~4h of culture, after centrifugation, takes thallus, and obtained cell is coated in the Luria Broth solid culture containing chloramphenicol
It on base, is cultivated 1~2 day at 37 DEG C, screens the transformant with chlorampenicol resistant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610240529.XA CN105802985B (en) | 2016-04-18 | 2016-04-18 | A method of fast implementing bacillus licheniformis gene knockout |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610240529.XA CN105802985B (en) | 2016-04-18 | 2016-04-18 | A method of fast implementing bacillus licheniformis gene knockout |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802985A CN105802985A (en) | 2016-07-27 |
| CN105802985B true CN105802985B (en) | 2019-11-05 |
Family
ID=56457224
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610240529.XA Active CN105802985B (en) | 2016-04-18 | 2016-04-18 | A method of fast implementing bacillus licheniformis gene knockout |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802985B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106467903B (en) * | 2016-09-18 | 2019-10-08 | 齐鲁工业大学 | A kind of bacillus licheniformis engineering bacteria and its construction method suitable for pulping process |
| CN106191093B (en) * | 2016-09-18 | 2019-11-08 | 湖北工业大学 | The method of cellulose excision enzyme expression quantity under the conditions of enhancing B. amyloliquefaciens alkaline |
| CN107641631A (en) * | 2017-09-07 | 2018-01-30 | 浙江工业大学 | A kind of method that bacillus coli gene is knocked out based on CRISPR/Cas9 systems by chemical conversion mediation |
| CN108949784B (en) * | 2018-08-06 | 2020-01-10 | 齐鲁工业大学 | Application of sporulation-related gene sigmaF in enzyme production |
| CN108929883B (en) * | 2018-08-06 | 2020-05-01 | 齐鲁工业大学 | Application of spoIII E gene related to sporulation in influencing growth of strain and producing enzyme |
| CN108949785B (en) * | 2018-08-06 | 2020-03-06 | 齐鲁工业大学 | Application of sporulation-related gene spo0A in enzyme production |
| CN109868253B (en) * | 2019-01-11 | 2020-03-13 | 齐鲁工业大学 | Bacillus licheniformis engineering bacteria for inhibiting bacterial autolysis and construction method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937735A (en) * | 2014-05-05 | 2014-07-23 | 绿康生化股份有限公司 | Bacillus licheniformis strain for knocking out xpf gene of PBSX as well as construction method and application of same |
| CN105400796A (en) * | 2015-12-28 | 2016-03-16 | 齐鲁工业大学 | Gene for adjusting and controlling production of long-chain diacid and application of gene |
-
2016
- 2016-04-18 CN CN201610240529.XA patent/CN105802985B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802985A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105802985B (en) | A method of fast implementing bacillus licheniformis gene knockout | |
| CN105087456B (en) | A method of producing the recombined bacillus subtilis building of specified molecular weight hyaluronic acid | |
| CN107502585A (en) | One plant of bacillus licheniformis engineering bacteria for efficiently synthesizing poly- γ glutamic acid | |
| CN103740734B (en) | Xiamen mycin biological synthesis gene cluster, purposes and bacterial strain | |
| CN110106206A (en) | A kind of corynebacterium glutamicum construction method improving L-lysine yield and stability | |
| CN105779444B (en) | A kind of Gene expression improving bacillus protein expression quantity | |
| CN105950524A (en) | Construction method of corynebacterium glutamicum engineering bacteria for high production of L-lysine | |
| CN109897862A (en) | GentamicinB produces bacterium and its preparation method and application | |
| CN110055204A (en) | A kind of method and application for knocking out II Q and pcf gene of spo and improving the lichen bacillus ferments producing enzyme | |
| CN104946552B (en) | The engineering strain of safe and efficient production shenqinmycin and its application | |
| CN108220219A (en) | A set of lactobacillus plantarum food-grade expression system and its application in heterologous protein expression | |
| CN107881140A (en) | The Leuconostoc mesenteroides mutant strain of one plant height production mannitol and its application process | |
| CN107267568A (en) | Utilize method of the spoT gene deletion strains by fermenting and producing L amino acid | |
| CN107058144A (en) | A kind of restructuring yeast strains for producing itaconic acid and its construction method and application | |
| CN103555646B (en) | A kind of coexpression L-arabinose isomerase gene and the genetic engineering bacterium of mannose-6-phosphate isomerase | |
| CN105861522A (en) | Antibacterial peptide Enterocin P and preparation method and application thereof | |
| CN104152483A (en) | Application of argJ gene in fermentation production of L-citrulline | |
| CN106467903B (en) | A kind of bacillus licheniformis engineering bacteria and its construction method suitable for pulping process | |
| CN108795836A (en) | A kind of genetic engineering bacterium of synthesis mannitol and its construction method and application | |
| CN108220216A (en) | A kind of nitrogen-fixing microorganism of resistance to ammonium for being overexpressed glnR genes and its construction method and application | |
| CN104403969A (en) | Peroxidase capable of degrading malachite green and preparation method for peroxidase | |
| CN109913515A (en) | A method of it improving bacillus glycerol metabolism and increases Polyurethane-epoxy resin yield | |
| CN104877997B (en) | One special promoter for responding Osmotic Stress Signal Transduction and application | |
| CN105316383B (en) | A method of improving the oxytetracycline yield of streptomycete by gene disruption | |
| CN108949784A (en) | Application of the sporulation related gene sigmaF in producing enzyme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |