CN105785021B - A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more - Google Patents
A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more Download PDFInfo
- Publication number
- CN105785021B CN105785021B CN201610215012.5A CN201610215012A CN105785021B CN 105785021 B CN105785021 B CN 105785021B CN 201610215012 A CN201610215012 A CN 201610215012A CN 105785021 B CN105785021 B CN 105785021B
- Authority
- CN
- China
- Prior art keywords
- pad
- cholinesterase
- organophosphorus
- sample
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of organophosphorus and N-methylcarbamate pesticides to remain cholinesterase immunochromatography quick measuring card more.The quick measuring card includes bottom plate and capping plate；Include some groups of cushion pads on the bottom plate, across several sample pads on each cushion pad, and then sample pad, which is also arranged in order, is pasted with enzyme pad, detection film and adsorptive pads；Include several wells and several visual windows on the capping plate；Wherein, the detection film upper surface is coated with organophosphor and carbamate chemicals for agriculture protein conjugate and antibiont enzyme antibody IgG side by side.The quick measuring card of the present invention is simple to operate, quick, a variety of organophosphorus and N-methylcarbamate pesticides that can simultaneously in quick detection sample, sensitivity is 0.008~0.987mg/kg, 3~5 minutes i.e. observable result, is suitable for being used for quickly detecting the organophosphorus and N-methylcarbamate pesticides in veterinary antibiotics and environmental water sample.
Description
Technical field
The invention belongs to Pesticides Testing technical field.More particularly, to a kind of organophosphorus and N-methylcarbamate pesticides
More residual cholinesterase immunochromatography quick measuring cards.
Background technology
Agricultural chemicals is the Important Agricultural means of production for being used for preventing and treating disease pest harm in agricultural production, is widely used in fruit, vegetables
And in the production of grain.Agricultural chemicals has played highly important effect in terms of the good harvest of agricultural byproducts is ensured.But in recent years
Indiscriminate use of pesticide also brings huge threat to the health of environment and the mankind.Increasing country gradually pays much attention to
Indiscriminate use of pesticide.Because pesticide variety is various and compounding use phenomenon is universal, the more residuals that can detect multiple objects simultaneously are established
Detection method is very necessary.Instrument analytical method can realize multi-residue determination, but need expensive instrument and equipment and specialty
Operating personnel, and sample pre-treatments it is cumbersome it is time-consuming, testing cost is high, it is difficult to meet high flux, the quick, needs of on-line checking.
At present, developing quick multi-residue determination method turns into the important means for the deficiency for making up instrumental method.From 20 generation
From recording 80 years, cholinesterase activity principle is suppressed based on Organophosphorus and carbamate pesticides class agricultural chemicals and establishes " inhibiting AChE " and opens
Beginning is widely used in the rapid screening of Organophosphorus and carbamate pesticides class agricultural chemicals in agricultural product, due to its simple and rapid characteristic
And quite varied application is obtained rapidly.Progressively withdrawn from the market yet with its sensitivity and less stable, at present only
A small number of developing countries such as South Korea are still using.Immunoassay based on antigen and antibody specific association reaction also can be used in
The detection of part agricultural chemicals, but because Antibody preparation is difficult, somewhat expensive, and it is unstable, at present can only be small to a certain kind or one
Class agricultural chemicals can detect.Quick determination method of the development with more broad spectrum activity and stability is extremely urgent.
The content of the invention
The technical problem to be solved in the present invention is the defects of overcoming prior art and deficiency, there is provided a kind of pesticide multi-residues life
Thing enzyme process quick measuring card, it is possible to achieve simultaneously, simply and quickly detect food and the organophosphor in environment and carbamates agriculture
Medicine, the quick detection that Multiple Pesticides remain in water fruits and vegetables and environmental water sample can be applied.
It is an object of the invention to provide a kind of organophosphorus and N-methylcarbamate pesticides to remain cholinesterase immunochromatography more
Quick measuring card.
Another object of the present invention be to provide the quick measuring card detection organophosphorus and N-methylcarbamate pesticides more the side of residual
The application in face.
Above-mentioned purpose of the present invention is achieved through the following technical solutions：
A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card, the quick measuring card bag more
Include bottom plate 1 and capping plate 9；Include some groups of cushion pads 2 on the bottom plate 1, across several sample pads on each cushion pad 2
3（The one side of cushion pad 2 is pasted onto on bottom plate 1, and the another side of cushion pad 2 pastes sample pad 3）, and then sample pad 3 is also successively
It is arranged with enzyme pad 4, detection film 5 and adsorptive pads 8；The sample pad 3, enzyme pad 4, detection film 5 and adsorptive pads 8 are pasted onto bottom plate successively
On 1；Include several wells 10 and several visual windows 11 on the capping plate 9；Wherein, it is described to detect the upper surface of film 5 simultaneously
Row coating organophosphor and carbamate chemicals for agriculture protein conjugate（Detection line 6）With antibiont enzyme antibody IgG（Nature controlling line 7）.
Further, organophosphor is coated with the detection film 5 with carbamate chemicals for agriculture protein conjugate as detection
Line 6,1 antibiont enzyme antibody IgG line of coating is as nature controlling line 7, and organophosphor and carbamate chemicals for agriculture protein conjugate were both
It can be combined, can also be identified by antibiont enzyme antibody IgG with cholinesterase.
Wherein it is preferred to the structure of the organophosphor and carbamate chemicals for agriculture protein conjugate is as follows：
Wherein it is preferred to the coupling protein is bovine serum albumin（BSA）Or ovalbumin（OVA）.
Preferably, the biology enzyme in the antibiont enzyme antibody IgG is the restructuring for from silkworm and passing through genetic modification
Acetylcholinesterase.
Specifically it is highly preferred that the preparation method of the biology enzyme is as follows：
The amino acid sequence of present invention silkworm acetylcholinesterase known to, is suitably changed, and to greatest extent
The codon that make use of Escherichia coli to have a preference for, has designed and synthesized new acetylcholinesterasegene genebmaceFragment.Specifically,
The new acetylcholinesterasegene gene of designbmaceThe sequence of fragment is as follows：
ATGATCAACTACTGATCCTAGGCTGATCCTAATAGATTCTGATCCTATTGATCCTAAGGTACCCTATACCTATACTA
GGTGATCCTATGATCCTATGATCCTAGGTGATCCTATGATCCTATGATCCTATCCTATACTAGGTGATCCTATGATC
CTATGATCACTAGGTGATCCTATGATCCTATGATCCCCTATACTAGCCTATACTAGGTGATCCTATGATCCTATGAT
CGTGATCCTATGATCCTATGATCGATCTTGATCCCTATACTAGGTGATCCTATGATCCTATGATCCTAAGGATGATC
CTACTTACGTAGCTATTGATCCTAGGATGATCCTATATGACCTATACTAGGTGATCCTATGATCCTATGATCTTGAT
CCTATGATGATCCTATCCTACCTAGGCCGTATGACGTAGCTAGTACGTGATCCTAACCTATACTAGGTGATCCTATG
ATCCTATGATCTCGATCTGATCCCTACCTATACTAGGTGATCCTATGATCCTATGATCTCCTATACTAGGTGATCCT
ATGACCTATACTAGGTGATCCTATGATCCTATGATCTCCTATGATCACCTATACTAGGTGATCCTATGACCTATACT
AGGTGATCCTATGATCCTATGATCTCCTATGATCCTAGGTGATCCTATGATCCTATGATCTGATCCTACTAGATTGA
TCCTACGACCTATACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCCCTAT
ACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCTCCCTATACTAGGTGATC
CTATGATCCTATGATCGTAGTAGCTGATCCTACTAGCTAGCTAGCTTCCCTTGATCCTATAGCTGATTGATCCTACT
ATAGTGATCCTACCTATACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCG
ATCTGATCCTGATCCTATGATCCTATACTAGGTGATCCTATGATCCTATGATCCTATGATCCTATATTGCTTTG。
Then by the new acetylcholinesterasegene gene of the designbmaceRecombinate fusion expression vector（Preferably, it is used
Fusion expression vector can be pET28 (a), pUC118 or pEZZ318 etc.）In, and be transformed into Escherichia coli, pass through large intestine
The culture of bacillus obtains the expression product restructuring acetylcholinesterase with bioactivity identical with natural acetylcholinesterase.
More specifically, the preparation process of above-mentioned restructuring acetylcholinesterase is as follows：
（1）Sequences Design：As described above, design new acetylcholinesterasegene genebmaceFragment；
（2）Build recombinant expression carrier：With Nde I, BamH I by new acetylcholinesterasegene genebmaceFragment is from restructuring
Cut in plasmid pUC118-CM, be inserted into the carrier pET28 (a) with Nde I, Bam H I digestion, convert e. coli bl21,
Obtained recombinant plasmid is named as pET28 (a)-CM；
（3）Convert Escherichia coli：By Nde I, the digested vector pET28 (a) of Bam H I effect, by recombinant plasmid pET28
(a)-CM converts e. coli bl21；
（4）Cultivate Escherichia coli and obtain restructuring acetylcholinesterase：Recombinant plasmid pET28 (a)-CM converts Escherichia coli
After BL21, acetylcholinesterase is under the control of T7 promoters, and the small peptide amalgamation and expression with a molecular weight only 2000 is final to obtain
Recombinate acetylcholinesterase.
Furthermore it is preferred that the antibiont enzyme antibody IgG is rabbit polyclonal antibody, its preparation method is by biology enzyme breast
New zealand white rabbit is immunized after change, the rabbit anti-serum obtained by screening.
Furthermore it is preferred that the plastic plate that the bottom plate 1 scribbles adhesive sticker and do not absorbed water for one side, plays fixed support speed and surveys
The effect of card other components is simultaneously merged into quick measuring card with capping plate 9.
Preferably, the preparation method of the cushion pad 2 and sample pad 3 is：All-glass paper or filter paper are immersed into pH
In 6.4~7.2 Tris-HCl or 0.1mol/L, pH6.4~7.2 PBS in, handle 3~10min（It is preferred that
5min）, take out and produced after drying.
Preferably, the drying is in 50~70 DEG C（It is preferred that 60 DEG C）Drying, vacuum drying or other modes are dried.
Described cushion pad 2 and sample pad 3 plays a part of to absorb sample solution in detection, and sample solution passes through cushion pad
2 averagely assign in two sample pads 3, and are formed and moved up.
Preferably, the preparation method of the enzyme pad 4 is：Using filter paper as material, filter paper is immersed and contains cholinesterase
In the solution of stabilizer, at 15~25 DEG C（It is preferred that 20 DEG C）25~50min of lower stirring immersion（It is preferred that 40min）, then dry,
10~15h is dried overnight in vacuum desiccator（It is preferred that 12h）.
Preferably, the stabilizer is the sucrose solution that mass fraction is 60%.
Preferably, described cholinesterase is marked with zymolyte, collaurum or quantum dot etc..
The enzyme pad 4 plays a part of fixed and adheres to cholinesterase.The detection film 5 is pasted onto on enzyme pad.
In addition on above-mentioned quick measuring card, the well 10 is identical with the quantity of cushion pad 2, visual window 11 and detection film 5
Quantity it is identical；After plate 9 is covered and bottom plate 1 combines to form detection card, well 10 faces the middle of cushion pad 2, can
Form 11 faces detection film 5 respectively.
Preferably, the adsorptive pads 8 are all-glass paper, filter paper or the blotting paper of drying at room temperature.The main work of adsorptive pads 8
Absorbed with the sample solution for being to come up movement.
Preferably, the capping plate 9 is plastic plate.
As it is a kind of preferably can embodiment, quick measuring card of the invention includes a bottom plate 1 and a capping plate 9, institute
Stating includes a cushion pad 2 on bottom plate 1, respectively have across two sample pads 3, enzyme pad 4, detection film 5 and adsorptive pads 8 on cushion pad 2
Two.I.e. as shown in Figure 1, to include a cushion pad 2 on bottom plate 1, carried out on cushion pad 2 exemplified by two sample pads 3
Explanation：The quick measuring card includes bottom plate 1 and capping plate 9；Include a cushion pad 2 on the bottom plate 1, on cushion pad 2 across
Two sample pads 3（The one side of cushion pad 2 is pasted onto on bottom plate 1, and the another side of cushion pad 2 pastes sample pad 3）, and then each
Sample pad 3 is also arranged in sequence with enzyme pad 4, detection film 5 and adsorptive pads 8；The sample pad 3, enzyme pad 4, detection film 5 and adsorptive pads 8
It is pasted onto successively on bottom plate 1；Include a well 10 and two visual windows 11 on the capping plate 9；Wherein, the detection film
5 upper surfaces are coated with organophosphor and carbamate chemicals for agriculture protein conjugate side by side（Detection line 6）With antibiont enzyme antibody IgG
（Nature controlling line 7）.
The assemble method of agricultural chemicals quick measuring card of the present invention is as follows（Exemplified by comprising a cushion pad 2）：
Two groups of sample pads 3, enzyme pad 4, detection film 5 and adsorptive pads 8 are pasted successively on bottom plate 1, by cushion pad 2 across two
In individual sample pad 3, then capping plate 9 is covered, well 10 is respectively toward to against the middle of cushion pad 2, two visual windows 11
Two detection films 5.
In addition, the above-mentioned application for stating quick measuring card in terms of residual more than detection organophosphorus and N-methylcarbamate pesticides, also exists
Within protection scope of the present invention.
Preferably, the organophosphorus and N-methylcarbamate pesticides are DDVP, Resistox, Bassa, parathion, furans
Pellet, phoxim, methidathion, dichlofenthion, quinalphos, Hostathion, triazotion, Phosalone, Menite, omethoate, different chlorine
Phosphorus, Ficam, cynock, sevin, parathion-methyl, malathion, fenifrothion, Entex, famphur, iodfenphos, first
Base chlopyrifos or disulfoton etc..
In addition, the quick measuring card of the present invention is in use, be applicable to arbitrary sample.
Preferably, when it is water sample to detect sample, detection method is that the judgement of result is：Environmental water sample is directly drawn to be added dropwise
Into well 10, several drops are added dropwise（It is preferred that 4 drops）, after standing keeps flat 3~5min, if lines all occur in two detection films, show
Sample is feminine gender, does not contain organophosphor or carbamate chemicals for agriculture, is otherwise positive.No matter sample is negative or sun
Property, lines should occur in nature controlling line, if nature controlling line without lines, shows that test paper fails.
When it is fruit and vegetable to detect sample, detection method is that the judgement of result is：Fruit（Take skin portion）Or vegetables cut
Into fritter, weigh a small amount of（It is preferred that 1g）With a small amount of（It is preferred that 1mL）PBS solutions of the 0.05mol/L containing 10% methanol extracts 8~15min
（It is preferred that 10min）, 3000~5500rpm centrifugations, 3~10min（It is preferred that 5000 rpm centrifuge 5min）, take supernatant directly to detect, side
Method and the same water sample of judged result.
The Cleaning Principle of quick measuring card of the present invention is：
By well add sample, sample by cushion pad reach sample pad, then on move on to enzyme pad.If in sample
Containing organophosphor or carbamate chemicals for agriculture, it can be combined with the cholinesterase on enzyme pad and move on to detection line on continuing, because
Cholinesterase on enzyme pad only has a binding site, after more remainss of pesticide in sample are in combination, having in detection line
Machine phosphorus and carbamate chemicals for agriculture protein conjugate cannot be combined with cholinesterase, then detection line（T）Wirelessly show；When
When not having Organophosphorus and carbamate pesticides class agricultural chemicals in sample, cholinesterase reaches detection line（T）When will be by organophosphor or ammonia
Carbamate class agricultural chemicals protein conjugate captures, and forms macroscopic lines.Whether no matter organophosphor or ammonia are contained in sample
Methyl propylhomoserin ester pesticides nature controlling line（C）Lines will occur.Therefore, if comprising only organophosphorus pesticide in sample, examine above
Survey and only occur a line on film；If detect only occur a line on film below, such as containing only carbamate chemicals for agriculture in sample
The class agricultural chemicals of fruit two all sometimes, detects film and a line can all occur in detection film below above.
From principle, the present invention, which has surmounted original utilization Organophosphorus and carbamate pesticides class agricultural chemicals, can suppress cholinesterase
Active this single characteristic roughly detects agricultural chemicals, combines immunologic principle on this basis, is wrapped in chromatographic film
There is corresponding organophosphor and carbamates agricultural chemicals protein conjugate and antibiont enzyme antibody IgG, chromatographed with reference to physics, utilized
The tactic pattern of the detection of immune colloid gold card, cholinesterase instead of the antibody of original detection object, then with cholinesterase
Itself detects harmful object as the principle that a kind of antigen can be combined with antibiont enzyme antibody IgG, and this may be considered colloid
Gold detection card combines with one kind of inhibiting AChE.
From the construction of detection card, present invention detection card detects with indirect competitive immune colloid gold in the prior art
Card structure is similar, but coated in the prior art is antibody, and the coated present invention is cholinesterase, and in the prior art coated two
Anti-, the coated present invention is antibiont enzyme antibody IgG；And it is coated with the material used in cholinesterase and is better than enzyme to a certain extent
Material used in suppression method, therefore will be more preferable in stability.
From the effect of detection, the present invention is more accurate than inhibiting AChE of the prior art, more stable.It is existing
Inhibiting AChE all can only roughly detect the content of agricultural chemicals, and present invention incorporates the advantages of immune detection card, to many agricultural chemicals
There is relatively low test limit, and it is very sensitive, while cholinesterase is introduced, make Detection results sensitiveer.
The above-mentioned quick measuring card of the present invention can detect Organophosphorus and carbamate pesticides class pesticide multi-residues simultaneously, and the quick measuring card includes
Bottom plate and capping plate, and at least two groups of cushion pads pasted successively, sample pad, enzyme pad, detection film, adsorptive pads；The buffering
Pad one side is pasted onto on bottom plate, and another side pastes sample pad, across the sample pad for pasting at least two on cushion pad, and then sample
Product pad pastes enzyme pad, detection film, adsorptive pads successively；The capping plate is provided with well and visual window, and the well is opposite
Cushion pad, the visual window are respectively toward to detect film；The detection film upper surface is coated with agricultural chemicals protein conjugate and antibiosis side by side
Thing enzyme antibody IgG, detection line and nature controlling line are formed respectively.The principle of the quick measuring card substitutes gold labeling antibody using cholinesterase
Physics immunochromatographiassays assays method, there is high sensitivity, be adapted to scene screening, it is simple, quick, cost is low, sample aequum is few,
The advantages that pre-treatment is simple and convenient, the Pesticides Testing for ultramicron have extremely wide market prospects.Cholinesterase physics
Immunochromatography is can be directly the same as inspection using the cholinesterase to organophosphorus and N-methylcarbamate pesticides with high susceptibility
The characteristic that target molecule combines is surveyed, the method for then recycling immunochromatography principle to be measured.Its is easy to operate quick, several
Minute is i.e. it can be seen that result, cost is also very cheap, suitable for the detection of all Organophosphorus and carbamate pesticides class agricultural chemicals, fills out
The pesticide multi-residues quick measuring card blank at home and abroad in the prior art using cholinesterase together with immune chromatography method is mended.
The invention has the advantages that：
（1）It is simple to operate：The present invention quick measuring card is easy to operate, rapid and convenient, result are accurate, to water fruits and vegetables
It is and i.e. detectable after ambient water sample progress simple process, it is only necessary to by distinguishing that lines situation occur it is determined that in sample
Residues of pesticides situation.This quick measuring card is not required to any instrument and equipment, and common layman is operable, can with the naked eye sentence
Read.
（2）The enzyme pad of quick measuring card of the present invention keeps the stability of wherein medicine using special stabilizer, makes it have
Very strong antijamming capability, and being capable of stay active for long periods.
（3）High flux：It can be achieved to being detected while Organophosphorus and carbamate pesticides class agricultural chemicals；One quick measuring card can
Realize the Rapid Detection of two major classes totally tens kinds of toxic pesticides minimal residues.
（4）High sensitivity：The detection sensitivity of quick measuring card of the present invention is 0.008~0.987mg/kg, 3~5 minutes
Result is observed, is suitable for being used for quickly detecting the organophosphorus and N-methylcarbamate pesticides in veterinary antibiotics and environmental water sample.
（5）Environmental protection：The making of card uses the biomaterial for being easy to degraded, nontoxic, securely and reliably, to environment friend
It is good.
Brief description of the drawings
Fig. 1 is the structural representation of quick measuring card of the present invention.
Embodiment
The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention
Limit in any form.Unless stated otherwise, the reagent of the invention used, method and apparatus routinely try for the art
Agent, method and apparatus.
Unless stated otherwise, following examples agents useful for same and material are purchased in market.
The structure of 1 quick measuring card of the present invention of embodiment
1st, quick measuring card of the present invention includes bottom plate and capping plate, includes at least two groups of cushion pads pasted successively, samples on bottom plate
Product pad, enzyme pad, detection film, adsorptive pads；The cushion pad one side is pasted onto on bottom plate, and cushion pad another side pastes sample pad, tightly
Then sample pad pastes enzyme pad, detection film, adsorptive pads successively；The capping plate is covered after pasting successively and produces the speed survey
Card；The capping plate is provided with well and visual window, and the well is respectively toward to detect against cushion pad, the visual window
Film；The detection film upper surface is coated with organophosphor and carbamates agricultural chemicals protein conjugate and antibiont enzyme antibody IgG side by side,
Detection line and nature controlling line are formed respectively.
Further, organophosphor is coated with the detection film 5 with carbamate chemicals for agriculture protein conjugate as detection
Line 6,1 antibiont enzyme antibody IgG line of coating is as nature controlling line 7, and organophosphor and carbamate chemicals for agriculture protein conjugate were both
It can be combined, can also be identified by antibiont enzyme antibody IgG with cholinesterase.
2nd, wherein, the structure of the organophosphor and carbamate chemicals for agriculture protein conjugate is as follows：
Wherein, the coupling protein is bovine serum albumin（BSA）Or ovalbumin（OVA）.
3rd, the biology enzyme in the antibiont enzyme antibody IgG is the restructuring acetyl courage for from silkworm and passing through genetic modification
Alkali esterase.The preparation method of the biology enzyme is as follows：
The amino acid sequence of present invention silkworm acetylcholinesterase known to, is suitably changed, and to greatest extent
The codon that make use of Escherichia coli to have a preference for, has designed and synthesized new acetylcholinesterasegene gene fragment.Specifically, design
New acetylcholinesterasegene genebmaceThe sequence of fragment is as follows：
ATGATCAACTACTGATCCTAGGCTGATCCTAATAGATTCTGATCCTATTGATCCTAAGGTACCCTATACCTATACTA
GGTGATCCTATGATCCTATGATCCTAGGTGATCCTATGATCCTATGATCCTATCCTATACTAGGTGATCCTATGATC
CTATGATCACTAGGTGATCCTATGATCCTATGATCCCCTATACTAGCCTATACTAGGTGATCCTATGATCCTATGAT
CGTGATCCTATGATCCTATGATCGATCTTGATCCCTATACTAGGTGATCCTATGATCCTATGATCCTAAGGATGATC
CTACTTACGTAGCTATTGATCCTAGGATGATCCTATATGACCTATACTAGGTGATCCTATGATCCTATGATCTTGAT
CCTATGATGATCCTATCCTACCTAGGCCGTATGACGTAGCTAGTACGTGATCCTAACCTATACTAGGTGATCCTATG
ATCCTATGATCTCGATCTGATCCCTACCTATACTAGGTGATCCTATGATCCTATGATCTCCTATACTAGGTGATCCT
ATGACCTATACTAGGTGATCCTATGATCCTATGATCTCCTATGATCACCTATACTAGGTGATCCTATGACCTATACT
AGGTGATCCTATGATCCTATGATCTCCTATGATCCTAGGTGATCCTATGATCCTATGATCTGATCCTACTAGATTGA
TCCTACGACCTATACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCCCTAT
ACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCTCCCTATACTAGGTGATC
CTATGATCCTATGATCGTAGTAGCTGATCCTACTAGCTAGCTAGCTTCCCTTGATCCTATAGCTGATTGATCCTACT
ATAGTGATCCTACCTATACTAGGTGATCCTATGATCCTATGATCCCTATACTAGGTGATCCTATGATCCTATGATCG
ATCTGATCCTGATCCTATGATCCTATACTAGGTGATCCTATGATCCTATGATCCTATGATCCTATATTGCTTTG。
Then by the new acetylcholinesterasegene gene of the designbmaceRecombinate fusion expression vector（Preferably, it is used
Fusion expression vector can be pET28 (a), pUC118 or pEZZ318 etc.）In, and be transformed into Escherichia coli, pass through large intestine
The culture of bacillus obtains the expression product restructuring acetylcholinesterase with bioactivity identical with natural acetylcholinesterase.
More specifically, the preparation process of above-mentioned restructuring acetylcholinesterase is as follows：
（1）Sequences Design：As described above, design new acetylcholinesterasegene genebmaceFragment；
（2）Build recombinant expression carrier：With Nde I, BamH I by new acetylcholinesterasegene genebmaceFragment is from restructuring
Cut in plasmid pUC118-CM, be inserted into the carrier pET28 (a) with Nde I, Bam H I digestion, convert e. coli bl21,
Obtained recombinant plasmid is named as pET28 (a)-CM；
（3）Convert Escherichia coli：By Nde I, the digested vector pET28 (a) of Bam H I effect, by recombinant plasmid pET28
(a)-CM converts e. coli bl21；
（4）Cultivate Escherichia coli and obtain restructuring acetylcholinesterase：Recombinant plasmid pET28 (a)-CM converts Escherichia coli
After BL21, acetylcholinesterase is under the control of T7 promoters, and the small peptide amalgamation and expression with a molecular weight only 2000 is final to obtain
Expression product.
List is from the point of view of the SDS-PAGE behaviors of expression product, the thalline expressing protein bar containing recombinant plasmid and containing empty plasmid
Band indifference（There is a band of expression in molecular weight 6000 or so because both）.In order to further identify expression product, will also
Expression product carries out determination of activity, by determination of activity, obtains restructuring acetylcholinesterase.
4th, the antibiont enzyme antibody IgG is rabbit polyclonal antibody, and its preparation method is to be immunized newly after biology enzyme is emulsified
Western blue White Rabbit, the rabbit anti-serum obtained by screening.
The structure of 2 quick measuring card of the present invention of embodiment
1st, as shown in accompanying drawing 1, quick measuring card of the present invention includes bottom plate 1 and capping plate 9.
Include a cushion pad 2, and two groups of sample pads 3, enzyme pad 4, detection film 5 and adsorptive pads 8 on the bottom plate 1.
Wherein, the cushion pad 2 is an entirety, in two sample pads 3, two groups of sample pads 3, enzyme pad 4, inspection
Survey film 5 and adsorptive pads 8 are pasted onto on bottom plate 1 successively；Detection film 5 upper surface is coated with organophosphor and carbamates side by side
Agricultural chemicals protein conjugate（Detection line 6）With antibiont enzyme antibody IgG（Nature controlling line 7）.
Include well 10 and visual window 11 on the capping plate 9.
2nd, the function of the above-mentioned quick measuring card each several part of the present invention and preparation method are described as follows：
（1）Bottom plate 1：For the plastic plate for simultaneously scribbling adhesive sticker and not absorbing water, fixed other composition portions of support quick measuring card are played
Point effect and with capping plate 9 be merged into quick measuring card.
（2）Cushion pad 2 and sample pad 3：All-glass paper is immersed to 5min in pH 6.4~7.2 Tris-HCl, taken out,
Vacuum drying, produces cushion pad 2 and sample pad 3.Cushion pad 2 and sample pad 3 play a part of to absorb sample solution, sample in detection
Product solution is averagely assigned in two sample pads 3 by cushion pad 2, and is formed and moved up.
（3）Enzyme pad 4：Play a part of fixed and adhere to cholinesterase.
The processing of enzyme pad：Filter paper is immersed in the solution containing cholinesterase and stabilizer respectively, selects to stir at 20 DEG C
40min is soaked, is then dried, is placed in vacuum desiccator and is dried overnight 12h.
（4）Detect film 5：Detect and organophosphor is coated with film 5 with carbamate chemicals for agriculture protein conjugate as detection line
6,1 antibiont enzyme antibody IgG line of coating both may be used as nature controlling line 7, organophosphor with carbamate chemicals for agriculture protein conjugate
To be combined with cholinesterase, can also be identified by antibiont enzyme antibody IgG.
（5）Adsorptive pads 8：Using the all-glass paper after drying at room temperature, filter paper or blotting paper as adsorptive pads.Adsorptive pads 8
Main function is to absorb the mobile sample solution to come up.
（6）Cover plate 9：There are well 10 and visual window 11 above plastic plate, well 10 is against cushion pad middle, and two
Individual visual window 11 is respectively toward to two detection films 5；Capping plate 9 can combine to form detection card with bottom plate 1.
3rd, the assembling of agricultural chemicals quick measuring card of the present invention
As shown in Figure 1, two groups of sample pads 3, enzyme pad 4, detection film 5 and adsorptive pads 8 are pasted successively on bottom plate 1, will be slow
Pad 2 is rushed across in two sample pads 3, then covers capping plate 9, for well 10 against the middle of cushion pad 2, two visual
Window 11 is respectively toward to two detection films 5.
The application of 3 quick measuring card of the present invention of embodiment
1st, enzyme pad 4 is the cholinesterase for having adsorbed zymolyte mark in the quick measuring card of the present embodiment, and this is the present embodiment speed
Survey where the main points of card, other parts construction is same as Example 1 with composition.
2nd, using the quick measuring card, according to detection method provided by the invention, to organophosphor and amino in several frequently seen tealeaves
The minimum detection limit of formate ester agricultural chemicals is as shown in table 1 below：
Minimum detection limit of the cholinesterase immunochromatography quick measuring card of table 1 to several frequently seen Pesticides in Tea medicine（mg/kg）
The application of 4 quick measuring card of the present invention of embodiment
1st, the detection of environmental water sample：Directly to draw environmental water sample to be added drop-wise in well 10, be added dropwise 4 drops, standing keeps flat 3~
After 5min.If lines all occur in two detection films, show that sample for feminine gender, does not contain organophosphor or carbamate chemicals for agriculture,
Otherwise it is positive.No matter sample is negative or positive, and lines should occur in nature controlling line, if nature controlling line shows to try without lines
Paper fails.
2nd, the detection of fruit and vegetable sample：Fruit（Take skin portion）Or vegetables are cut into small pieces, 1g 1mL are weighed
0.05mol/L containing 10% methanol PBS solution extract 10 min, 5000 rpm centrifugation 5min, take supernatant directly to detect, method and
The same environmental water sample of judged result.
3rd, the present invention is as shown in table 2 to the test limit of organophosphorus and N-methylcarbamate pesticides.
Table 2 is detection limit of this quick measuring card to organophosphorus and N-methylcarbamate pesticides（mg/kg）
The contrast of 5 quick measuring card of the present invention of embodiment and commercially available detection card
1st, 7 blank samples are chosen（Wherein 4 are pond water sample, and 3 are food and vegetable sample）Add appropriate oxygen pleasure
Fruit, while the scraps of paper are surveyed using this quick measuring card and commercially available speed and are measured, and confirmed simultaneously using HPLC-MS/MS methods,
It the results are shown in Table 3.
3 quick measuring cards of table survey the scraps of paper with commercially available speed and determine comparing result to sample
This quick measuring card is can be seen that from result shown in table 3 and commercially available speed surveys the scraps of paper and can preferably measure negative sample.
Illustrate that quick measuring card of the present invention has more preferable sensitivity, the scraps of paper are surveyed better than traditional speed.
Claims (7)
1. a kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more, it is characterised in that institute
Stating quick measuring card includes bottom plate (1) and capping plate (9)；Include some groups of cushion pads (2), each cushion pad (2) on the bottom plate (1)
On across several sample pads (3), and then sample pad (3) is also arranged in sequence with enzyme pad (4), detection film (5) and adsorptive pads
(8)；The sample pad (3), enzyme pad (4), detection film (5) and adsorptive pads (8) are pasted onto on bottom plate (1) successively；The capping plate
(9) several wells (10) and several visual windows (11) are included on；Wherein, described detection film (5) upper surface is coated with side by side
Organophosphor and carbamate chemicals for agriculture protein conjugate and antibiont enzyme antibody IgG；Organophosphor is coated with the detection film (5)
With carbamate chemicals for agriculture protein conjugate as detection line (6), 1 antibiont enzyme antibody IgG line of coating is as nature controlling line
(7)；The enzyme pad is adsorbed with collaurum or quantum dot-labeled cholinesterase；The organophosphor and carbamate chemicals for agriculture egg
The structure of white conjugate is as follows：
。
2. organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more according to claim 1,
Characterized in that, the biology enzyme in the antibiont enzyme antibody IgG is the restructuring acetyl for from silkworm and passing through genetic modification
Cholinesterase.
3. organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more according to claim 1,
Characterized in that, the antibiont enzyme antibody IgG is rabbit polyclonal antibody, its preparation method is to be immunized newly after biology enzyme is emulsified
Western blue White Rabbit, the rabbit anti-serum obtained by screening.
4. organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more according to claim 1,
Characterized in that, the preparation method of the cushion pad (2) and sample pad (3) is：All-glass paper or filter paper are immersed into pH
In 6.4~7.2 Tris-HCl or 0.1mol/L, pH6.4~7.2 PBS in, handle 3~10min, take out drying
After produce；
The preparation method of the enzyme pad (4) is：Using filter paper as material, filter paper is immersed containing cholinesterase and stabilizer
In solution, 25~50min of stirring immersion, then dries at 15~25 DEG C, dries 10~15h.
5. organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more according to claim 1,
Characterized in that, the well (10) is identical with the quantity of cushion pad (2), the quantity phase of visual window (11) and detection film (5)
Together；After plate (9) is covered and bottom plate (1) combines to form detection card, well (10) faces the middle of cushion pad (2), can
Form (11) faces detection film (5) respectively.
6. application of the quick measuring card described in claim 1 in terms of residual more than detection organophosphorus and N-methylcarbamate pesticides.
7. apply according to claim 6, it is characterised in that the organophosphorus and N-methylcarbamate pesticides be DDVP,
Resistox, Bassa, parathion, Furadan, phoxim, methidathion, dichlofenthion, quinalphos, Hostathion, triazotion, volt
Kill sulphur phosphorus, Menite, omethoate, Di-captan, Ficam, cynock, sevin, parathion-methyl, malathion, kill snout moth's larva sulphur
Phosphorus, Entex, famphur, iodfenphos, chlorpyrifos-methyl or disulfoton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610215012.5A CN105785021B (en) | 2016-04-08 | 2016-04-08 | A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610215012.5A CN105785021B (en) | 2016-04-08 | 2016-04-08 | A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105785021A CN105785021A (en) | 2016-07-20 |
| CN105785021B true CN105785021B (en) | 2018-02-06 |
Family
ID=56395954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610215012.5A Active CN105785021B (en) | 2016-04-08 | 2016-04-08 | A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105785021B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106324243B (en) * | 2016-08-23 | 2018-07-13 | 广东志道医药科技有限公司 | A kind of colloidal gold immuno-chromatography test paper strip and its preparation and application |
| CN106680493A (en) * | 2017-01-21 | 2017-05-17 | 上海为然环保科技有限公司 | Agricultural product pesticide residual colloidal gold detection kit |
| CN106970217B (en) * | 2017-03-22 | 2018-08-07 | 江苏美正生物科技有限公司 | A kind of immune chromatography method quantitatively detecting organophosphorus insecticide |
| CN111566081B (en) * | 2017-11-20 | 2021-04-06 | 天津安百胜医疗科技有限公司 | Bisamide compound and preparation method and application thereof |
| CN110196322A (en) * | 2018-02-27 | 2019-09-03 | 广东志道医药科技有限公司 | Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method |
| CN109813689B (en) * | 2018-11-22 | 2020-04-03 | 中南民族大学 | Method for detecting carbamate pesticide based on CdTe quantum dot paper chip substrate |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1321194C (en) * | 2002-12-30 | 2007-06-13 | 高希武 | Detection reagent kit for pesticide residue, its preparing method and its use |
| CN101475587B (en) * | 2009-01-09 | 2011-11-16 | 华南农业大学 | Diethoxy thiophosphate organophosphorus pesticide hapten and preparation thereof |
| CN202216956U (en) * | 2011-04-12 | 2012-05-09 | 华南农业大学 | Organic phosphorus pesticide multi-residue gold-labeled rapid test card |
| CN102539753A (en) * | 2011-12-29 | 2012-07-04 | 深圳康美生物科技股份有限公司 | Reagent kit and enzyme-linked immunochromatography for detecting various organophosphorus pesticide residues |
| CN102680714B (en) * | 2012-01-15 | 2014-08-06 | 河南科技大学 | Colloidal gold immune test paper for rapid detection of dibutyl phthalate as well as preparation method and application thereof |
| CN104865248B (en) * | 2015-05-27 | 2018-05-01 | 华南农业大学 | A kind of preparation method for the recombinant silkworm acetylcholinesterase for being used to detect pesticide residue |
-
2016
- 2016-04-08 CN CN201610215012.5A patent/CN105785021B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105785021A (en) | 2016-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105785021B (en) | A kind of organophosphorus and N-methylcarbamate pesticides remain cholinesterase immunochromatography quick measuring card more | |
| CN105334319B (en) | A kind of test strips for detecting zearalenone in breast | |
| CN101988924A (en) | Test strip for detecting anti-cyclic citrullinated peptide antibody in blood and preparation method | |
| CN102135536B (en) | Colloidal gold immune chromatographic test paper box of silver staining enhancement technology and preparation method thereof | |
| CN103808939A (en) | Spectinomycin colloidal gold detection card | |
| CN106970217A (en) | A kind of immune chromatography method for quantitatively detecting organophosphorus insecticide | |
| Anfossi et al. | Mycotoxins in food and feed: extraction, analysis and emerging technologies for rapid and on-field detection | |
| CN109709339A (en) | Detect colloidal gold immuno-chromatography test paper strip and the application of ox or ovine skeletal muscle Troponin I | |
| CN208283400U (en) | A kind of aflatoxin B1 fluorescence immunoassay immue quantitative detection reagent box | |
| CN107918011A (en) | The detection method and detection kit of fungi | |
| CN109444423A (en) | Tetraodotoxin immunofluorescence Rapid detection test strip and preparation method and detection method | |
| CN109061134A (en) | Detect the double colour developing qualitative, quantitative immuno-chromatographic test paper strips of fluorescent microsphere-colloidal gold and preparation method thereof of salbutamol | |
| CN108761075A (en) | A kind of deoxynivalenol quantifies rapid detection card and its detection method | |
| Liu et al. | Research on rapid detection technology for β 2-agonists: Multi-residue fluorescence immunochromatography based on dimeric artificial antigen | |
| CN107589265A (en) | A kind of time-resolved fluorescence test strips for detecting aflatoxin B1 and its application | |
| CN105181949B (en) | Rapid test method for 3 kinds of pesticide residue such as imidacloprid in tea and test paper strip used in rapid test method | |
| CN203148947U (en) | Cyproheptadine immunochromatography rapid test paper card | |
| CN106198966A (en) | A kind of near-infrared fluorescent immune chromatography reagent kit detecting aflatoxin and application thereof | |
| CN106771273B (en) | One kind detection Formoterol colloidal gold immuno-chromatography test paper strip and preparation method and application | |
| CN108562741A (en) | A kind of imidaclothiz bioluminescence sidestream immune chromatography method | |
| CN111205219B (en) | Paraquat hapten, complete antigen, nano antibody, detection test paper, kit, preparation method and application | |
| CN106483300A (en) | A kind of colloidal gold immuno-chromatography test paper strip of detection Furaxone metabolite and preparation method and application | |
| CN208172009U (en) | A kind of time-resolved fluoroimmunoassay chromatograph test strip | |
| CN204044161U (en) | Deoxynivalenol enol colloidal gold reagent plate in a kind of grain and oil of detection fast | |
| CN207798850U (en) | The colloidal gold strip of parathion and Hostathion can be detected simultaneously |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |