CN110196322A - Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method - Google Patents
Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method Download PDFInfo
- Publication number
- CN110196322A CN110196322A CN201810160607.4A CN201810160607A CN110196322A CN 110196322 A CN110196322 A CN 110196322A CN 201810160607 A CN201810160607 A CN 201810160607A CN 110196322 A CN110196322 A CN 110196322A
- Authority
- CN
- China
- Prior art keywords
- pesticide
- pad
- gold
- acetylcholinesteraseisomer
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plasma & Fusion (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of organophosphate and carbamate pesticide method for detecting residue, the following steps are included: carrying out the expression of recombination human acetylcholinesteraseisomer by zooblast, recombination human acetylcholinesteraseisomer is marked with colloidal gold after purification, pesticide comlete antigen and pesticide molecule competitively with recombinate in conjunction with human acetylcholinesteraseisomer；The recombination human acetylcholinesteraseisomer, pesticide comlete antigen, recombined human AcetylcholinesteraseAntibody Antibody etc. of colloid gold label are assembled into test strips；The sample for needing to detect is after pre-treatment, it is extracted with Extraction solvent, obtain sample solution, appropriate amount of sample solution is added drop-wise in sample pad, sample solution will be mobile to water absorption pad end, after 3~15 minutes, according to the colour developing situation of detection line and control line, whether contain organic phosphates or carbamate pesticide residue in judgement sample.The present invention can carry out specific recognition to most of organophosphate and carbamate pesticide, and detection range is wide, high sensitivity.
Description
Technical field
The present invention relates to the detection fields to pesticide residue, and in particular to a kind of organophosphorus insecticide and carbamates
The detection method and its test strips and preparation method of pesticide residue.
Background technique
Organophosphorus insecticide and carbamate chemicals for agriculture are acetylcholinesterase inhibitor, people, mammal and
Insect etc. in vivo, can lead to acetylcholine with the irreversible combination of acetylcholinesterase, the activity of acetylcholine esterase inhibition
Esterase can not hydrolyze the acetylcholine in the prominent gap of nerve, make acetylcholine continue to stimulate neuromere, cause the tetanic of muscle
Phenomena such as contraction and failure, i.e. the generation of intoxicating phenomenon, mechanism of action of the organophosphorus insecticide in conjunction with acetylcholinesterase is such as
Under:
The combination of organophosphorus insecticide and acetylcholinesterase includes two stages, combination stage and phosphorylation stage, on
K in figuredIt is the dissociation constant between reactant and complex, KpIt is phosphorylation constant, KiIt is bimolecular inhibition constant, it is equal to
Kp/Kd, due to KdIt is the measurement of enzyme-inhibitor complex extent of dissociation, it is related with combination degree, and depends on inhibitor
Molecular structure and spatiality, the change of phosphorylation reaction performance then influence phosphorylation constant Kp, therefore, the space of inhibitor
Effect, stereospecificity, phosphorylation reaction performance, whether the features such as positively charged will affect organophosphorus insecticide to acetyl gallbladder
The rejection of alkali esterase.
Mechanism of action of the carbamate chemicals for agriculture in conjunction with acetylcholinesterase is as follows:
The same combination of carbamate chemicals for agriculture and acetylcholinesterase includes two stages, combination stage and amino first
Acylated stage, K in upper figuredIt is the dissociation constant between reactant and complex, KcIt is carbamylation constant, KiIt is bimolecular
Inhibition constant, it is equal to Kp/Kc, there is no the enzymes of phosphorylation to stablize for the enzyme of carbamoylation, therefore determines carbamates agriculture
Medicine rejection mainly enzyme-carbamate chemicals for agriculture complex binding performance, i.e., with carbamate chemicals for agriculture
Whether space structure has the features oil pipes such as positive charge.
Therefore, the rejection ability of the different organophosphorus insecticide of structure and carbamate chemicals for agriculture to acetylcholinesterase
There is certain difference.
Currently, being mainly GB/T based on the method that enzyme inhibition carries out organophosphorus insecticide and carbamate chemicals for agriculture inspection
Paper disk method and enzyme inhibition rate method in 5009.199, but its sensitivity and stability are poor, especially acetylcholine used
Esterase in animal body by extracting, and stability difference is very big between batch, is unable to reach accurate detection result.
It is also occurred at present using the product that colloidal gold immuno-chromatography test paper strip carries out Detecting Pesticide, but it is main
For the detection of a certain or several pesticides, many test strips are needed in practice while being detected, it is time-consuming and laborious, and
And also increase cost.
Summary of the invention
The purpose of the present invention is for the above defect of the existing technology, provide one kind can detect simultaneously organic phosphates and
The easy accurate detection method of carbamate pesticide residue, can be used for organic phosphates in the products such as veterinary antibiotics, grain
Quick detection and primary dcreening operation with carbamate pesticide residue.
In order to achieve the above objectives, the invention adopts the following technical scheme:
A kind of organophosphate and carbamate pesticide method for detecting residue, comprising the following steps:
(1) expression of recombination human acetylcholinesteraseisomer is carried out by zooblast, recombination human acetylcholinesteraseisomer is after purification
It is marked with colloidal gold, pesticide comlete antigen and pesticide molecule are competitively in conjunction with recombination human acetylcholinesteraseisomer；
(2) the recombination human acetylcholinesteraseisomer of colloid gold label, pesticide comlete antigen, recombination human acetylcholinesteraseisomer are resisted
Body etc. is assembled into test strips；The test strips by sample pad, gold-labelled pad, detection line, control line, nitrocellulose membrane, water absorption pad,
PVC bottom plate composition, the sample pad, gold-labelled pad, detection line, control line, nitrocellulose membrane, water absorption pad are arranged at the bottom PVC
The edge of PVC bottom plate is arranged in the top of plate, sample pad, and gold-labelled pad overlaps with sample pad, gold-labelled pad and water absorption pad point
It does not partly overlap with nitrocellulose membrane both ends, one end in nitrocellulose membrane close to gold-labelled pad is coated with detection line, close
One end of water absorption pad is coated with control line, and sample pad and gold-labelled pad are glass fibre membrane, is coated with colloid gold label in gold-labelled pad
Recombination human acetylcholinesteraseisomer, detection line is coated with pesticide comlete antigen, and coating recombination human acetylcholinesteraseisomer is anti-on control line
Body, water absorption pad are filter paper；The test strips can also remove above-mentioned gold-labelled pad, by the recombined human acetyl gallbladder of colloid gold label
Alkali esterase is with solid or liquid storage in container.
(3) sample for needing to detect is extracted with Extraction solvent after pre-treatment, obtains sample solution, and appropriate amount of sample is molten
Drop is added in sample pad, and sample solution will be mobile to water absorption pad end.
In step (3), appropriate amount of sample solution can also be added drop-wise in recombination human acetylcholinesteraseisomer container, it is sufficiently mixed
It closes, it will be in the test strips insertion container without gold-labelled pad.
After 3~15 minutes, according to the colour developing situation of detection line and control line, whether contain organic phosphates in judgement sample
Or carbamate pesticide residue, judgment method are as follows:
1) detection line is aobvious red, the aobvious red of control line --- negative findings, is free of organic phosphates and carbamic acid in sample
Ester pesticides；
2) detection line is not aobvious red, the aobvious red of control line --- positive findings, contains organic phosphates or amino first in sample
Esters of gallic acid pesticide；
3) no matter detection line shows red, the not aobvious red of control line --- test strips failure.
Further, in step (1), the zooblast is CHO-DG44；
Further, in step (1), the method for the expression of the recombination human acetylcholinesteraseisomer is as follows: according to the second of people
The amino acid sequence of acetylcholinesterase suitably changes gene by technologies such as codon optimization, signal peptide and tag modifications
It is dynamic, the new genetic fragment AChE of design synthesis acetylcholinesterase, by newly-designed AChE Gene Fusion to mammalian cell
It in expression vector pMPT, transfects into CHO-DG44 cell, by screening, obtains stablizing expression cell pond, this cell can give birth to
Produce and express the recombination human acetylcholinesteraseisomer that there is identical bioactivity with natural human acetylcholinesteraseisomer；
Further, in step (1), the purifying of the recombination human acetylcholinesteraseisomer, comprising the following steps: centrifuging and taking is thin
Born of the same parents' culture solution supernatant after being filtered to remove insoluble particles object, captures recombination human acetylcholinesteraseisomer therein with nickel column, to contain ladder
Recombination human acetylcholinesteraseisomer of the buffer elution of bound of concentration imidazoles in nickel column is spent, duplicate removal is removed with dialysis or other methods
Recombination human acetylcholinesteraseisomer solution is concentrated into required concentration by the imidazoles in group human acetylcholinesteraseisomer solution；
Further, in step (1), the pesticide comlete antigen is coupled by small haptens and BSA or OVA and is made,
Wherein small haptens can be modification or unmodified organophosphorus insecticide small molecule, modification or unmodified carbamic acid
Ester pesticides small molecule, organophosphorus insecticide universal hapten, carbamate chemicals for agriculture universal hapten；
Further, in step (2), the recombined human AcetylcholinesteraseAntibody Antibody is by above-mentioned recombination human acetylcholinesteraseisomer
The animals such as immunized mice, rabbit, sheep are made；
Further, in step (3), the Extraction solvent is the PBS buffering that the pH containing 0%~20% ethyl alcohol is 6~8
Liquid.
The testing principle of the detection remaining test strips of organophosphate and carbamate pesticide of the present invention is as follows:
After testing sample solution is added dropwise, sample solution is under the capillarity of various films, along sample pad to water absorption pad end
It is mobile, when being moved to gold-labelled pad, the recombination human acetylcholinesteraseisomer or sample solution and glue of sample solution dissolution colloid gold label
The recombination human acetylcholinesteraseisomer solution mixing of body gold label, when containing determinand in sample, by the weight with colloid gold label
Group human acetylcholinesteraseisomer occurs Irreversible binding and together to the movement of water absorption pad end, reaches the inspection for being fixed with pesticide comlete antigen
When survey line, pesticide comlete antigen by the recombination human acetylcholinesteraseisomer with determinand competitive binding colloid gold label, in sample to
Survey object content is higher, and competition is more obvious, the recombined human acetylcholine ester of pesticide comlete antigen and colloid gold label in detection line
Enzyme combination is fewer, when the recombination human acetylcholinesteraseisomer for the colloid gold label that pesticide comlete antigen is combined is less than certain amount
When, detection line will not show red, no matter in sample containing not containing determinand, the recombined human acetylcholine of excessive colloid gold label
Esterase or its with combination to be measured all can form a red in conjunction with the recombined human AcetylcholinesteraseAntibody Antibody of control line
Line, if the not aobvious red of control line, illustrates that test strips fail, need to re-replace test strips and detected.
The preparation of organophosphate and carbamate pesticide residue detection test strips of the present invention, including following step
It is rapid:
(1) pesticide comlete antigen is prepared: by pesticide hapten and bovine serum albumin(BSA) (BSA) or oralbumin (OVA),
It is coupled by the methods of carbodlimide method, active ester method, mixed anhydride method, diazotising method or glutaraldehyde method, prepares pesticide
Haptens-BSA conjugate and pesticide hapten-OVA conjugate, i.e. pesticide comlete antigen；
(2) preparation and reorganization human acetylcholinesteraseisomer: being expressed with CHO-DG44, with immobilized metal affinity chromatography
(IMAC) the recombination human acetylcholinesteraseisomer containing histidine tag is purified, SDS-PAGE purity > 90%；
(3) prepare colloidal gold: colloidal gold prepared with trisodium citrate reduction method, colloid gold particle diameter 20~60nm it
Between；
(4) colloidal gold labeled monoclonal antibody: by colloidal gold solution and recombination human acetylcholinesteraseisomer by 1 μ of μ g/mL~20 g/mL's
Ratio mixes, and by centrifugal purification, concentration, is prepared into the recombination human acetylcholinesteraseisomer of colloid gold label；
(5) the recombination human acetylcholinesteraseisomer of colloid gold label is sprayed and is fixed in gold-labelled pad, or by colloidal gold mark
The recombination human acetylcholinesteraseisomer of note is stored in solid or liquid form in the containers such as micropore, and pesticide comlete antigen is coated on
In detection line, on the control line by recombined human AcetylcholinesteraseAntibody Antibody coating, and it is sufficiently dry；
(6) nitrocellulose membrane, gold-labelled pad (can also not need gold-labelled pad), sample pad, water absorption pad are successively bonded in PVC
On bottom plate, it is cut into strip, that is, the detection remaining test strips of organophosphate and carbamate pesticide are made.
The remaining test strips of detection organophosphate and carbamate pesticide of the present invention have the advantage that
(1) present invention uses recombination human acetylcholinesteraseisomer to measure pesticide residue in the form of test strips for the first time, can be to big
Part organophosphate and carbamate pesticide carries out specific recognition, and detection range is wide, high sensitivity；
(2) present invention synthesizes acetylcholinesterase in a manner of genetic recombination, solves acetylcholine ester currently on the market
The big problem of stability difference between enzyme batch；
(3) cost of test strips of the present invention can be controlled in existing market average level or so, and it is steady to substantially increase detection
Qualitative and sensitivity, promotion and application value with higher.
Detailed description of the invention
Fig. 1 is the structural schematic diagram of organophosphate and carbamate pesticide residue detection test strips of the present invention；
Fig. 2 is the improvement structural representation of organophosphate and carbamate pesticide residue detection test strips of the present invention
Figure；
Fig. 3 is present invention recombination human acetylcholinesteraseisomer purification result schematic diagram.
In figure: 1-PVC bottom plate, 2- sample pad, 3- gold-labelled pad, 4- detection line, 5- control line, 6- nitrocellulose membrane, 7-
Water absorption pad, the recombination human acetylcholinesteraseisomer of 8- colloid gold label.
Specific embodiment
Technical solution of the present invention is described in further detail below in conjunction with specific embodiment.
As shown in Figure 1, a kind of organophosphate and carbamate pesticide residue detection test strips, by sample pad 2, Jin Biao
Pad 3, detection line 4, control line 5, nitrocellulose membrane 6, water absorption pad 7, PVC bottom plate 1 form, the sample pad 2, gold-labelled pad 3, inspection
Survey line 4, control line 5, nitrocellulose membrane 6, water absorption pad 7 are arranged at the top of PVC bottom plate 1, and sample pad 2 is arranged at the bottom PVC
The edge of plate 1, gold-labelled pad 3 overlap with sample pad 2, gold-labelled pad 3 and water absorption pad 7 respectively with 6 both ends of nitrocellulose membrane
It partly overlaps, one end in nitrocellulose membrane 6 close to gold-labelled pad is coated with detection line 4, and nitrocellulose membrane 6 is close to water absorption pad
7 one end is coated with control line 5, and sample pad 2 and gold-labelled pad 3 are glass fibre membrane, is coated with colloid gold label in gold-labelled pad 3
Human acetylcholinesteraseisomer 8 is recombinated, detection line 4 is coated with pesticide comlete antigen, and coating recombination human acetylcholinesteraseisomer is anti-on control line 5
Body, water absorption pad 7 are filter paper.
As a further improvement of the present invention, as shown in Fig. 2, the test strips can also remove above-mentioned gold-labelled pad 3,
By the recombination human acetylcholinesteraseisomer 8 of colloid gold label with solid or liquid storage in container.
Embodiment 1: the synthesis of pesticide hapten:
By taking the preparation of parathion-methyl haptens as an example, synthesis path is as follows；
Step 1: 4.53g parathion is dissolved in 150mL saturated ammonium chloride solution/ethanol solution (volume ratio 2:3), add
Enter 3.28g iron powder, 90 DEG C are stirred overnight.Filtering, filtrate decompression are concentrated into 50mL.It is extracted with ethyl acetate three times, each 50mL,
Combining extraction liquid removes moisture therein with anhydrous sodium sulfate.Water bath method, residue column chromatography purify (ethyl acetate/petroleum
Ether, ratio from 1/50 to 1/2), obtain amino parathion.
Step 2: 2.49mg succinic acid is dissolved in 40mL dimethylformamide under the conditions of -5 DEG C, 260mL tri- is added
Chloroethanes, 1.5mL triethylamine, 4g polypeptide condensing agent HATU (2- (7- aoxidizes benzotriazole)-N, N, N', N'- tetramethylurea six
Fluorophosphoric acid ester) and 1.83g amino parathion.- 5 DEG C are stirred 4 hours, and 100mL water is added, is extracted with dichloromethane four times, often
Secondary 80mL.Combining extraction liquid is washed with saturated sodium chloride solution, then removes wherein moisture with anhydrous sodium sulfate, is filtered, decompression
Concentration.Residue column chromatography purifies (ethyl acetate/formic acid, ratio 10000/1) to get parathion-methyl haptens.
Embodiment 2: the expression of human acetylcholinesteraseisomer is recombinated:
The present invention is repaired according to the amino acid sequence of the acetylcholinesterase of people by codon optimization, signal peptide and label
The technologies such as change suitably to change gene, the new genetic fragment AChE of design synthesis acetylcholinesterase, so as to gene and place
The fusion of chief cell and protein secretion expression, specific new genetic fragment AChE gene order are as follows:
ATGGCGCCCGTCGCCGTCTGGGCCGCGCTGGCCGTCGGACTGGAGCTCTGGGCTGCGGCGCACGCCCGG
GAGGATGCAGAGCTGCTGGTGACGGTGCGTGGGGGCCGGCTGCGGGGCATTCGCCTGAAGACCCCCGGGGGCCCTGT
CTCTGCTTTCCTGGGCATCCCCTTTGCGGAGCCACCCATGGGACCCCGTCGCTTTCTGCCACCGGAGCCCAAGCAGC
CTTGGTCAGGGGTGGTAGACGCTACAACCTTCCAGAGTGTCTGCTACCAATATGTGGACACCCTATACCCAGGTTTT
GAGGGCACCGAGATGTGGAACCCCAACCGTGAGCTGAGCGAGGACTGCCTGTACCTCAACGTGTGGACACCATACCC
CCGGCCTACATCCCCCACCCCTGTCCTCGTCTGGATCTATGGGGGTGGCTTCTACAGTGGGGCCTCCTCCTTGGACG
TGTACGATGGCCGCTTCTTGGTACAGGCCGAGAGGACTGTGCTGGTGTCCATGAACTACCGGGTGGGAGCCTTTGGC
TTCCTGGCCCTGCCGGGGAGCCGAGAGGCCCCGGGCAATGTGGGTCTCCTGGATCAGAGGCTGGCCCTGCAGTGGGT
GCAGGAGAACGTGGCAGCCTTCGGGGGTGACCCGACATCAGTGACGCTGTTTGGGGAGAGCGCGGGAGCCGCCTCGG
TGGGCATGCACCTGCTGTCCCCGCCCAGCCGGGGCCTGTTCCACAGGGCCGTGCTGCAGAGCGGTGCCCCCAATGGA
CCCTGGGCCACGGTGGGCATGGGAGAGGCCCGTCGCAGGGCCACGCAGCTGGCCCACCTTGTGGGCTGTCCTCCAGG
CGGCACTGGTGGGAATGACACAGAGCTGGTAGCCTGCCTTCGGACACGACCAGCGCAGGTCCTGGTGAACCACGAAT
GGCACGTGCTGCCTCAAGAAAGCGTCTTCCGGTTCTCCTTCGTGCCTGTGGTAGATGGAGACTTCCTCAGTGACACC
CCAGAGGCCCTCATCAACGCGGGAGACTTCCACGGCCTGCAGGTGCTGGTGGGTGTGGTGAAGGATGAGGGCTCGTA
TTTTCTGGTTTACGGGGCCCCAGGCTTCAGCAAAGACAACGAGTCTCTCATCAGCCGGGCCGAGTTCCTGGCCGGGG
TGCGGGTCGGGGTTCCCCAGGTAAGTGACCTGGCAGCCGAGGCTGTGGTCCTGCATTACACAGACTGGCTGCATCCC
GAGGACCCGGCACGCCTGAGGGAGGCCCTGAGCGATGTGGTGGGCGACCACAATGTCGTGTGCCCCGTGGCCCAGCT
GGCTGGGCGACTGGCTGCCCAGGGTGCCCGGGTCTACGCCTACGTCTTTGAACACCGTGCTTCCACGCTCTCCTGGC
CCCTGTGGATGGGGGTGCCCCACGGCTACGAGATCGAGTTCATCTTTGGGATCCCCCTGGACCCCTCTCGAAACTAC
ACGGCAGAGGAGAAAATCTTCGCCCAGCGACTGATGCGATACTGGGCCAACTTTGCCCGCACAGGGGATCCCAATGA
GCCCCGAGACCCCAAGGCCCCACAATGGCCCCCGTACACGGCGGGGGCTCAGCAGTACGTTAGTCTGGACCTGCGGC
CGCTGGAGGTGCGGCGGGGGCTGCGCGCCCAGGCCTGCGCCTTCTGGAACCGCTTCCTCCCCAAATTGCTCAGCGCC
ACCGACACGCTCGACGAGGCGGAGCGCCAGTGGAAGGCCGAGTTCCACCGCTGGAGCTCCTACATGGTGCACTGGAA
GAACCAGTTCGACCACTACAGCAAGCAGGATCGCTGCTCAGACCTGCACCACCACCACCACCACTGATAA
Newly-designed AChE genetic fragment is fused in mammalian cell expression vector pMPT, transfection to CHO-DG44
In cell, by screening, obtain stablizing expression cell pond.This cell is able to produce and expresses to be had with natural human acetylcholinesteraseisomer
There is the recombination human acetylcholinesteraseisomer of identical bioactivity.
Embodiment 3: the purifying of human acetylcholinesteraseisomer is recombinated:
30mL 4.0mol/L NaCl is added in 350mL Chinese hamster ovary celI culture solution supernatant, and 0.6mL Ni Bestarose is added
FF is slowly mixed in 2~8 DEG C, is incubated overnight, after cleaning Ni Bestarose FF with phosphate buffer (PBS), successively
Ni Bestarose FF is cleaned with the PBS buffer solution containing 75mmol/L, 100mmol/L, 500mmol/L imidazoles, uses SDS-PAGE
The purity of recombined human enzyme acetylcholine in electrophoresis detection elution fraction merges the component of purity > 90%, in PBS buffer solution thoroughly
After analysis overnight, it is concentrated into 1.7mg/mL with concentration tube, as shown in Fig. 3, in figure:
A: cell culture supernatant before purification；
B: the cell culture supernatant after being incubated overnight with Ni Bestarose FF；
C:75mmol/L imidazoles elution fraction；
D:100mmol/L imidazoles elution fraction；
E:500mmol/L imidazoles elution fraction.
Embodiment 4: Application Example:
Vegetable leaf is taken on the market, and appropriate clip is ground, and the PBS buffer solution vibration of the pH=7 containing 10% ethyl alcohol is added
Extraction is swung, layering is placed, Aspirate supernatant is added drop-wise to organophosphate and carbamate pesticide residual test strips sample pad
On, 5~10min is reacted, detection line and control line colour developing situation are observed.If the aobvious red of detection line and control line, result are
Feminine gender shows in sample without organophosphorus insecticide and carbamate chemicals for agriculture；If the not aobvious red of detection line, control line show red
Color, then result is the positive, shows to contain organophosphorus insecticide or carbamate chemicals for agriculture in sample；If control line does not show red
Color illustrates that test strips fail, and new test strips need to be used to be detected.
Embodiment 5: sensitivity test:
40 kinds of organophosphorus insecticides and 15 kinds of carbamates chemicals for agriculture are detected with test strips of the invention, every kind
Pesticide is configured to different concentration, and the results are shown in Table 1:
1 test strips sensitivity of table and specific test result
Chart explanation: test strips of the invention detection limit remaining to organophosphate and carbamate pesticide is 0.01
Between~0.8mg/kg, illustrate that test strips of the invention can carry out most of organophosphorus insecticides and carbamate chemicals for agriculture
Detection.
Embodiment 6: specific test:
10 kinds of other type pesticides and 10 kinds of non-pesticides are detected with test strips of the invention, the results show that biphenyl
Pyrethroids, cypermethrin, cyfloxylate, DDT, six six six, 5a,6,9,9a-hexahydro-6,9-methano-2,4, pentachloronitrobenzene, heptachlor, drinox, dicofol
Deng 10 kinds of other type Pesticides Testing results be feminine gender, chlorophyll, lutein, luteole, Cyanidin, grape skin color,
10 kinds of phytochrome testing results such as delphinidin, lycopene, capsorubin, apiolin, hesperetin are also feminine gender, illustrate this
The test strips of invention can carry out specific detection to organophosphorus pesticide and carbamate chemicals for agriculture, and to other type pesticides with
And multiple phytochrome is without specific reaction.
Embodiment 7: stability test:
The test strips made with the method for the present invention are packed into hermetic bag, built-in desiccant is saved in 45 DEG C of baking ovens,
It is taken out respectively at 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, the stability of test strip.The results show that 45 DEG C save 7
It, 14 days, 21 days, 28 days, testing result has no significant change, 45 DEG C save 35 days, the antibody of colloid gold label in gold-labelled pad
Redissolution effect declined, the color of T line and C line obviously shoals, sensitivity decline.45 DEG C save 35 days, are equivalent to room temperature
It saves 12 months.
Claims (10)
1. a kind of organophosphate and carbamate pesticide method for detecting residue, comprising the following steps:
(1) expression of recombination human acetylcholinesteraseisomer is carried out by zooblast, recombination human acetylcholinesteraseisomer uses glue after purification
Body gold is marked, and pesticide comlete antigen and pesticide molecule are competitively in conjunction with recombination human acetylcholinesteraseisomer；
(2) by the recombination human acetylcholinesteraseisomer of colloid gold label, pesticide comlete antigen, recombined human AcetylcholinesteraseAntibody Antibody etc.
It is assembled into organophosphate and carbamate pesticide residue detection test strips；The test strips are by sample pad, gold-labelled pad, detection
Line, control line, nitrocellulose membrane, water absorption pad, PVC bottom plate composition；
(3) sample for needing to detect is extracted with Extraction solvent after pre-treatment, obtains sample solution, appropriate amount of sample solution is dripped
It is added in sample pad, sample solution will be mobile to water absorption pad end；
After 3~15 minutes, according to the colour developing situation of detection line and control line, whether contain organic phosphates or ammonia in judgement sample
Carbamate pesticide residue, judgment method are as follows:
1) detection line is aobvious red, the aobvious red of control line --- negative findings, is free of organic phosphates and carbamates in sample
Pesticide；
2) detection line is not aobvious red, the aobvious red of control line --- positive findings, contains organic phosphates or carbamate in sample
Class pesticide；
3) no matter detection line shows red, the not aobvious red of control line --- test strips failure；
Wherein in step (2), the test strips can also be removed above-mentioned gold-labelled pad, by the recombined human acetyl of colloid gold label
Cholinesterase is with solid or liquid storage in container；
Wherein in step (3), appropriate amount of sample solution can also be added drop-wise in recombination human acetylcholinesteraseisomer container, it is sufficiently mixed
It closes, it will be in the test strips insertion container without gold-labelled pad.
2. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (1), the zooblast is CHO-DG44.
3. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (1), the method for the expression of the recombination human acetylcholinesteraseisomer is as follows: according to the ammonia of the acetylcholinesterase of people
Base acid sequence suitably changes gene by technologies such as codon optimization, signal peptide and tag modifications, design synthesis acetyl
The new genetic fragment AChE of cholinesterase, by newly-designed AChE Gene Fusion into mammalian cell expression vector pMPT,
Transfection, by screening, obtains stablizing expression cell pond, this cell is able to produce and expresses and natural human into CHO-DG44 cell
Acetylcholinesterase has the recombination human acetylcholinesteraseisomer of identical bioactivity.
4. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (1), the purifying of the recombination human acetylcholinesteraseisomer, comprising the following steps: centrifuging and taking cell culture supernatant,
After being filtered to remove insoluble particles object, recombination human acetylcholinesteraseisomer therein is captured with nickel column, to contain gradient concentration imidazoles
Recombination human acetylcholinesteraseisomer of the buffer elution of bound in nickel column removes recombined human acetylcholine with dialysis or other methods
Recombination human acetylcholinesteraseisomer solution is concentrated into required concentration by the imidazoles in esterase solution.
5. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (1), the pesticide comlete antigen is coupled by small haptens and BSA or OVA and is made, and small molecular half is anti-
Original can be modification or unmodified organophosphorus insecticide small molecule, modification or small point of unmodified carbamate chemicals for agriculture
Son, organophosphorus insecticide universal hapten, carbamate chemicals for agriculture universal hapten.
6. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (2), the recombined human AcetylcholinesteraseAntibody Antibody is by above-mentioned recombination human acetylcholinesteraseisomer immunized mice, rabbit, sheep
Equal animals are made.
7. organophosphate and carbamate pesticide method for detecting residue according to claim 1, it is characterised in that:
In step (3), the Extraction solvent is the PBS buffer solution that the pH containing 0%~20% ethyl alcohol is 6~8.
8. a kind of organophosphate and carbamate pesticide residue detection test strips as described in claim 1~7 any one,
It is characterized by: the test strips are by sample pad, gold-labelled pad, detection line, control line, nitrocellulose membrane, water absorption pad, the bottom PVC
Board group is at the sample pad, gold-labelled pad, detection line, control line, nitrocellulose membrane, water absorption pad are arranged at the upper of PVC bottom plate
Side, the edge of PVC bottom plate is arranged in sample pad, and gold-labelled pad overlaps with sample pad, gold-labelled pad and water absorption pad respectively with nitre
Base cellulose membrane both ends partly overlap, and one end in nitrocellulose membrane close to gold-labelled pad is coated with detection line, NC Nitroncellulose
Film is coated with control line close to one end of water absorption pad, and the recombination human acetylcholinesteraseisomer of colloid gold label is coated in gold-labelled pad,
Detection line is coated with pesticide comlete antigen, is coated with recombined human AcetylcholinesteraseAntibody Antibody on control line；The test strips can also incite somebody to action
Above-mentioned gold-labelled pad removal, by the recombination human acetylcholinesteraseisomer of colloid gold label with solid or liquid storage in container.
9. organophosphate and carbamate pesticide residue detection test strips according to claim 8, feature exist
It is glass fibre membrane in: the sample pad and gold-labelled pad, the water absorption pad is filter paper.
10. a kind of organophosphate and carbamate pesticide residue detection test strips as described in claim 8~9 any one
Preparation method, it is characterised in that: the following steps are included:
(1) it prepares pesticide comlete antigen: pesticide hapten and bovine serum albumin(BSA) (BSA) or oralbumin (OVA) passes through
The methods of carbodlimide method, active ester method, mixed anhydride method, diazotising method or glutaraldehyde method are coupled, and it is anti-to prepare pesticide half
Original-BSA conjugate and pesticide hapten-OVA conjugate, i.e. pesticide comlete antigen；
(2) preparation and reorganization human acetylcholinesteraseisomer: being expressed with CHO-DG44, right with immobilized metal affinity chromatography (IMAC)
Recombination human acetylcholinesteraseisomer containing histidine tag is purified, SDS-PAGE purity > 90%；
(3) it prepares colloidal gold: colloidal gold being prepared with trisodium citrate reduction method, colloid gold particle diameter is between 20~60nm；
(4) colloidal gold labeled monoclonal antibody: by colloidal gold solution and human acetylcholinesteraseisomer is recombinated in the ratio of 1 μ of μ g/mL~20 g/mL
It mixes, by centrifugal purification, concentration, is prepared into the recombination human acetylcholinesteraseisomer of colloid gold label；
(5) the recombination human acetylcholinesteraseisomer of colloid gold label is sprayed and is fixed in gold-labelled pad, or by colloid gold label
Recombination human acetylcholinesteraseisomer is stored in solid or liquid form in the containers such as micropore, and pesticide comlete antigen is coated on detection
On line, on the control line by recombined human AcetylcholinesteraseAntibody Antibody coating, and it is sufficiently dry；
(6) nitrocellulose membrane, gold-labelled pad, sample pad, water absorption pad are successively bonded on PVC bottom plate, are cut into strip, that is, are made
Detect the remaining test strips of organophosphate and carbamate pesticide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810160607.4A CN110196322A (en) | 2018-02-27 | 2018-02-27 | Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810160607.4A CN110196322A (en) | 2018-02-27 | 2018-02-27 | Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110196322A true CN110196322A (en) | 2019-09-03 |
Family
ID=67751178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810160607.4A Pending CN110196322A (en) | 2018-02-27 | 2018-02-27 | Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110196322A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111505297A (en) * | 2020-05-13 | 2020-08-07 | 北京勤邦生物技术有限公司 | Application of endosulfan artificial antigen in enzyme linked immunosorbent assay kit |
| CN112898343A (en) * | 2021-01-25 | 2021-06-04 | 中国农业科学院蔬菜花卉研究所 | Hapten of organophosphorus triazophos pesticide and preparation method thereof |
| CN114672482A (en) * | 2022-05-31 | 2022-06-28 | 上海百力格生物技术有限公司 | Method for preparing nucleic acid probe |
| CN117587097A (en) * | 2024-01-15 | 2024-02-23 | 北京航空航天大学 | Acetylcholinesterase composite hydrogel photonic crystal sensor and method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001079219A2 (en) * | 2000-04-14 | 2001-10-25 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the ache gene |
| WO2005051976A2 (en) * | 2003-11-20 | 2005-06-09 | Ansata Therapeutics, Inc. | Protein and peptide ligation processes and one-step purification processes |
| CN105785021A (en) * | 2016-04-08 | 2016-07-20 | 广州万联生物科技有限公司 | Quick detecting card for immunochromatography of organophosphorus and carbamate pesticide multiresidue cholinesterase |
| CN106324243A (en) * | 2016-08-23 | 2017-01-11 | 广东志道医药科技有限公司 | Colloidal gold immunochromatography test strip and preparing and use method thereof |
-
2018
- 2018-02-27 CN CN201810160607.4A patent/CN110196322A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001079219A2 (en) * | 2000-04-14 | 2001-10-25 | Genaissance Pharmaceuticals, Inc. | Haplotypes of the ache gene |
| WO2005051976A2 (en) * | 2003-11-20 | 2005-06-09 | Ansata Therapeutics, Inc. | Protein and peptide ligation processes and one-step purification processes |
| CN105785021A (en) * | 2016-04-08 | 2016-07-20 | 广州万联生物科技有限公司 | Quick detecting card for immunochromatography of organophosphorus and carbamate pesticide multiresidue cholinesterase |
| CN106324243A (en) * | 2016-08-23 | 2017-01-11 | 广东志道医药科技有限公司 | Colloidal gold immunochromatography test strip and preparing and use method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 吕志强等: "对硫磷完全抗原的合成鉴定及其免疫效果", 《解放军预防医学杂志》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111505297A (en) * | 2020-05-13 | 2020-08-07 | 北京勤邦生物技术有限公司 | Application of endosulfan artificial antigen in enzyme linked immunosorbent assay kit |
| CN111505297B (en) * | 2020-05-13 | 2022-11-18 | 北京勤邦生物技术有限公司 | Application of endosulfan artificial antigen in enzyme linked immunosorbent assay kit |
| CN112898343A (en) * | 2021-01-25 | 2021-06-04 | 中国农业科学院蔬菜花卉研究所 | Hapten of organophosphorus triazophos pesticide and preparation method thereof |
| CN114672482A (en) * | 2022-05-31 | 2022-06-28 | 上海百力格生物技术有限公司 | Method for preparing nucleic acid probe |
| CN114672482B (en) * | 2022-05-31 | 2022-08-30 | 上海百力格生物技术有限公司 | Method for preparing nucleic acid probe |
| CN117587097A (en) * | 2024-01-15 | 2024-02-23 | 北京航空航天大学 | Acetylcholinesterase composite hydrogel photonic crystal sensor and method |
| CN117587097B (en) * | 2024-01-15 | 2024-04-16 | 北京航空航天大学 | Acetylcholinesterase composite hydrogel photonic crystal sensor and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110196322A (en) | Organophosphate and carbamate pesticide method for detecting residue and its test strips and preparation method | |
| CN106324243B (en) | A kind of colloidal gold immuno-chromatography test paper strip and its preparation and application | |
| CN101806804B (en) | Reagent for detecting acute myocardial infarction by immunological method and test strip | |
| CN111239399B (en) | Test strip and method for detecting profenofos | |
| CN110488006A (en) | A kind of immunochromatographydetection detection card and preparation method thereof of 3 sample albumen 1 of quick detection chitinase | |
| CN109265404A (en) | A kind of preparation method and application of carbendazim haptens and antigen | |
| CN106918705B (en) | Test paper for detecting fenpropathrin and application thereof | |
| CN109180519B (en) | Olaquindox metabolite antigen, antibody, enzyme-linked immunosorbent assay kit and detection method | |
| CN110627872A (en) | Phage display polypeptide specifically bound by imidacloprid antibody and application thereof | |
| DE10111224B4 (en) | Analogs of ecstasy class and use thereof in detecting ecstasy-class compounds | |
| CN104031886B (en) | A kind of immunomagnetic beads purification-enzyme linked immune assay detects method and the special monoclonal antibody thereof of monensin | |
| CN110927382A (en) | Time-resolved fluorescence immunoassay kit for detecting olaquindox and application thereof | |
| JP3154724B2 (en) | Methods for detecting monoclonal antibodies, hybridomas and diarrheal shellfish poisons specific to diarrheal shellfish toxins | |
| CN115340985A (en) | Hybridoma cell strain secreting anti-cat A-type blood specific monoclonal antibody, monoclonal antibody and application of monoclonal antibody | |
| JP2007527523A (en) | Reagent, method and kit for detecting feed enzymes | |
| CN112946256A (en) | Rapid quantitative detection card for ricin | |
| CN110275012B (en) | Bambuterol colloidal gold rapid detection card suitable for animal derived food and preparation method thereof | |
| DE3231204A1 (en) | ANTIBODIES AGAINST BACTERIAL PEPTIDOGLYCANES, METHODS FOR THEIR PRODUCTION AND METHODS FOR THEIR QUANTITATIVE DETERMINATION | |
| CN103214572A (en) | Anti-sterigmatocystin monoclonal antibody | |
| CN112462047B (en) | Nicarbazin detection kit and application thereof | |
| DE69628878T2 (en) | Method for determining cholinesterase and method for differentiating between cirrhosis and hepatitis | |
| Palm et al. | Immunogenetic analysis of microsomal and non‐microsomal lipoproteins from normal and malignannt mouse tissues for histocompatibility‐2 (H‐2) antigens | |
| CN113238043B (en) | Preparation method and application of furadan test paper based on SERS immunochromatographic technique | |
| CN112595844B (en) | Test strip and method for detecting fenpyrazamine | |
| CN116514907B (en) | Immunochromatography test strip for rapidly detecting mycotoxin tenatoxin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190903 |