CN105779610A

CN105779610A - Flanking sequence of genetically modified insecticidal maize HKG60 exogenous insert fragment and detecting method of flanking sequence

Info

Publication number: CN105779610A
Application number: CN201610237095.8A
Authority: CN
Inventors: 郎志宏; 黄大昉; 汪海; 朱莉; 李圣彦; 宋苗; 李秀影; 戴军
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2015-08-06
Filing date: 2016-04-15
Publication date: 2016-07-20
Anticipated expiration: 2036-04-15
Also published as: CN105779610B

Abstract

The invention relates to a flanking sequence of a genetically modified insecticidal maize HKG60 exogenous insert fragment and a detecting method of the flanking sequence, and belongs to the technical field of biology.A plant expression carrier pmAhG2 containing a Bt cry1Ah gene is established, a genetically modified maize plant genetically modified by the Bt cry1Ah gene is obtained, and a genetic modification event HGK60 with a remarkable ostrinia nubilalis resistant effect is screened out; the maize event HGK60 contains an insert gene sequence on a first chromosome of a maize genome, and the 5' flanking sequence and the 3' flanking sequence of the maize genome are as shown in SEQ ID NO:1 and SEQ ID NO:2 respectively.A primer can be designed according to the DNA of a combination area where the insert sequence and the flanking sequences of maize are introduced, and the event HGK60 is specifically, qualitatively and quantitatively detected.

Description

The flanking sequence of transgenic insect-resistant corn HGK60 external source Insert Fragment and detection method thereof

Technical field

The invention belongs to biological technical field, particularly relate to the detection of transgenic insect-resistant corn plant.

Background technology

Semen Maydis (ZeamaysL.) is important cereal crops, feedstuff and the raw material of industry, plays a very important role in national economy.Insect pest is always up one of key factor of restriction corn yield, Corn Pests about 350 kinds in global range, wherein with the harm of Lepidoptera Pyrausta nubilalis (Hubern). the most seriously, is distributed the widest.From north orientation south, can occurring in the harm of China Pyrausta nubilalis (Hubern). 1～7 generation for 1 year, general time spring maize is subject to the harm of Pyrausta nubilalis (Hubern). can cause the Semen Maydis underproduction about 10%, up to more than 30% when production loss that outbreak year causes is serious.When simultaneously corncob infringement is occurred by lepidoptera pest, mycotoxin can be produced, the health of domestic animal is caused much bad impact, and this toxin is under a cloud may result in cancer.Therefore, China or even global agricultural production are had very important significance by pest control effectively.

Traditional pest control method mainly includes chemical prevention and Biological control.Chemical prevention insecticidal spectrum is wide, instant effect, should acute by force, easy to operate, but long-term sprinkling can cause serious ecological problem, develops immunity to drugs including insect, to environment, health is caused many drawbacks such as serious harm, the natural enemy of murder by poisoning insect and useful insecticide.Biological control is a kind of method sought from ecological view, comparatively safe, alleviates environmental pollution, but it takes effect slowly, affected by environment bigger.The raising of plant self insect resistace is of great significance by the development of insect-resistant transgenic technology, and the preventing and treating for insect pest provides a new approach.From first case transgenic Bt Semen Maydis in 1996 since the U.S. goes through commercial growth, the cultivated area of whole world insect-resistant transgenic Semen Maydis increases year by year.

The R&D work of transgenic Bt Semen Maydis, start to walk abroad relatively early and develop very swift and violent, " Bt176 " and " Bt11 " pest-resistant Semen Maydis Industry Promotion that " MON810 " the pest-resistant Semen Maydis released such as Monsanto Company and Syngenta company release, the pest-resistant Semen Maydis turning Btcry1Ab gene that they are all is controlling object with Pyrausta nubilalis (Hubern).；Di Ka company is proposed and turns Btcry1Ac gene pest-resistant Semen Maydis " DBT418 " subsequently, AventisCropScience company and Pioneer Electronic Corp. of Du Pont are proposed respectively and turn Btcry9C gene pest-resistant Semen Maydis " CBH351 " and turn Btcry1F gene pest-resistant Semen Maydis " TC1507 ", and its controlling object is mainly Pyrausta nubilalis (Hubern)..Domestic pest-resistant Semen Maydis research starting ratio is later, and development is also relatively slow, up to the present there is no the pest-resistant corn variety of the trans Bt gene of industrialization.Fourth groups of stars etc. and kingdom's English etc. (fourth groups of stars etc., Chinese science B collects, and 1993,23 (7): 707-713；Kingdom's English etc., Chinese science B collects, and 1995,25 (1): 71-76) it is utilized respectively Ovary injection and particle bombardment by Bt channel genes Semen Maydis, it is thus achieved that trans Bt gene regenerated corn plant；Wang Gang and Du Juan (Wang Gang etc., Maize Sciences, 2002,10 (1): 36-37) undertaken studying and obtaining transfer-gen plant by Bt channel genes Semen Maydis with pollen tube Dow process；(the Zhu Changxiang etc. such as Zhu Changxiang, Journal of Shandong agri.Univ: natural science edition, 2002,33 (2): 120-125) adopting cotransformation method to proceed in maize immature embryos by Btcry1Ab gene and bar gene, Pyrausta nubilalis (Hubern). is shown certain resistance by partial transgenic plant.

Btcry1Ah gene is Zhang Jie researcher seminar of Plant Protection institute, Chinese Academy of Agricultral Sciences is the new type disinsection protein gene (patent No.: 200410009918) of separating clone from domestic thuringiensis (Bacillusthuringiensis, Bt) bacterial strain BT8.The coding region of this gene is 3549bps, encodes 1182 aminoacid, and molecular weight is 134kDa.Lepidoptera pest is had high virulence by Cry1Ah albumen, and the insecticidal activity of bollworm, rice-stem borer is better than Cry1Ac albumen；The insecticidal activity of Ostrinia furnacalis is better than Cry1Ac, Cry1Ab albumen.The research of Cry1Ah active region is shown, from ATG to 2001bp totally 667 amino acid whose polypeptide fragments (65kDa), there is high virulence equally, it it is the required section of activity, insecticidal activity and total length Cry1Ah albumen quite (Xueetal to Pyrausta nubilalis (Hubern)., bollworm, diamondback moth and striped rice borer, FEMSmicrobiologyletters, 2008,280 (1): 95-101).

nullDomestic existing by independent for cry1Ah gene maize transformation or and the application of other assortment of genes maize transformations，Such as (JournalofIntegrativeAgriculture2015 such as Sun He,14(2):305-313)、(the JournalofIntegrativeAgriculture such as Li Xiuying，2014,13(5):937-944)、Dai Jun etc. (circulate a notice of by biotechnology，2014，5:62-68)、(the journal of crops such as He Fuxia，2012，6:29～33)、(the Chinese agriculture science and technology Leader such as Yang Zhaojun，2012，14 (4): 39-45)、(the Chinese agriculture science and technology Leader such as Li Shengyan，2011，13 (6): 20～26)、(the Journal of Agricultural Biotechnology such as Yue Tongqing，2010，18 (4): 638-644))、(the ChineseScienceBulletin such as Wang Yuebing，2008，53 (2): 3185-3190).In foregoing document, although what convert is all Btcry1Ah gene, but the factor owing to affecting gene expression also includes promoter, regulating and controlling sequence, the different codon-optimised version of gene, riddled basins and different transform modes, the transgenic line produced is different, the expression of exogenous gene there is also very big difference, and it is also different that exogenous gene is inserted into the position on the genome of Semen Maydis.Owing to the position on exogenous origin gene integrator to Maize genome can affect the expression of exogenous gene, if wanting to obtain the transfer-gen plant that expression is high, insect resistant effect is good, need to screen from a large amount of transformation events, and the hereditary stability through too much generation detects, just can obtain the pest-resistant Semen Maydis of industrialization prospect, simultaneously, transgenic corn events inserts the border sequence of Maize genome can as the identity label of this transgenic line, can as an independent transformation event in a chromosomal insertion point, it is possible to use specific primer detects.The transgenic corns that the present invention obtains is a novel transformation event, and its position inserted in Maize genome is different from other transgenic events, and its border sequence can do specificity identification as identity label.

Summary of the invention

The present invention constructs the plant expression vector pmAhG2 containing Btcry1Ah gene, obtain turn have a Btcry1Ah gene turn milpa, screen a significant transgenic event HGK60 of anti-Pyrausta nubilalis (Hubern). effect；Its 5 ' end border sequence and 3 ' end border sequences are obtained by the method for chromosome walking, the border sequence at two ends can as the specific detection sequence of this transformation event, primer is designed by two border sequences, to transgenic event HGK60 specific detection, and the exploitation of detection kit can be applied to.

3 ' end side DNA of transgenic insect-resistant corn HGK60 external source Insert Fragment, its nucleotide sequence is such as shown in SEQIDNO:1.

5 ' end side DNA of transgenic insect-resistant corn HGK60 external source Insert Fragment, its nucleotide sequence is such as shown in SEQIDNO:2.

For detecting the specific primer of 3 ' above-mentioned end side DNA, its nucleotide sequence is as follows:

3 ' F:GCATGTCTATTACGCAAAGGTC,

3 ' R:GGTCTCAGGCATTCGCATTCAG.

For detecting the specific primer of 5 ' above-mentioned end side DNA, its nucleotide sequence is as follows:

5 ' F:CGAAACAAGAAAAATGTTTCCTTAG,

5’R:GTGCGCGCTAGCTGGCGTGTT。

The PCR detection method of transgenic insect-resistant corn HGK60, it is characterised in that: its PCR primer is above-mentioned specific primer.

Described specific primer is:

3 ' F:GCATGTCTATTACGCAAAGGTC,

3 ' R:GGTCTCAGGCATTCGCATTCAG,

The clip size that described PCR is obtained by reacting is 1124bp.

Described specific primer is:

5 ' F:CGAAACAAGAAAAATGTTTCCTTAG,

5 ' R:GTGCGCGCTAGCTGGCGTGTT,

The clip size that described PCR is obtained by reacting is 628bp.

The application in preparation detection transgenic corns test kit of the above-mentioned specific primer.

A kind of detection kit, it is characterised in that: containing the specific primer described in claim 4 or 5.

Above-mentioned side DNA or specific primer, detection kit application in detection transgenic corns.

Carrier pmAhG2 (structure is shown in Fig. 1) is transformed in Agrobacterium EHA105 by the present invention by freeze-thaw method, and PCR identifies.With the maize immature embryos of about the 1.2mm of fresh stripping for material, rataria is put into and infects in culture medium after one hour, wash once with infecting culture medium, then be immersed in the Agrobacterium bacterium solution adding 100 μMs of acetosyringones, and place 5 points of kinds.Taking-up sterilizing filter paper blots, and is put into and co-cultures on base, co-cultures 3 days, and set comparison under 26 DEG C of dark conditions.Again rataria is transferred on recovery media and cultivates 10 days to inducing callus, then it is then transferred to after callus first being removed bud in the screening culture medium containing corresponding selective agent, every two weeks subcultures are once, through the screenings of 6 weeks resistant calli transferred to and regeneration culture medium being shown in, light breaks up, after seeing light about one week, start that green bud point occurs, wound healing block carries out cutting make the bud point of green separate and transfer to regeneration culture medium is cultivated, it is beneficial to the growth of stem, when stem elongation is to 3～4cm, transfer them to root induction on regeneration culture medium, look sturdy after and well developed root system until milpa, transfer them in greenhouse small flower and grow.After continuing cultivation two weeks, it is transferred to greenhouse the earth after Seedling growth conditions to be transformed is good, after female fringe is weaved silk, entangles with paper bag, pollinate after waiting tassel loose powder, and gather in the crops fruit.

Plantation transgenic corns is in land for growing field crops, Pyrausta nubilalis (Hubern). newly hatched larvae is manually connect when Semen Maydis length to six leaf phases, transgenic corns HGK60 (deposit number CGMCCNo.12264) is not subject to Pyrausta nubilalis (Hubern). harm, anti-Pyrausta nubilalis (Hubern). effect is notable, its 5 ' end border sequence and 3 ' end border sequences are obtained by the method for chromosome walking, the border sequence at two ends can as the specific detection sequence of this transformation event, primer is designed by two border sequences, to transgenic event HGK60 specific detection, and the exploitation of detection kit can be applied to.

Transgenic corns HGK60, Classification And Nomenclature is Semen Maydis, Zeamays

Preserving number is CGMCCNo.12264

Preservation date: on March 29th, 2016

Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center

Preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3, Institute of Microorganism, Academia Sinica, postcode 100101

Accompanying drawing illustrates:

Fig. 1 is for the plant expression vector pmAhG2 schematic diagram of corn transformation

The PCR testing result of Fig. 2 corn transformation plant, wherein M is DM5000DNAMarker；1 is positive control, with plasmid pMAhG2 for template amplification product；2 is nontransgenic plants；3 is blank, with water for template amplification product；The product that 4-6 is is template amplification with transgenic corns genomic DNA.

Fig. 3 Insert Fragment restriction enzyme site schematic diagram B:BamHI；H:HindIII；S:SacI

The southernblot results of hybridization of Fig. 4 transgenic corns HGK60, CK+ is containing cry1Ah genetic fragment；Sample1, sample2 and sample3 are three different plants of HGK60 event, and respectively with BamH I, Hind III and Sac I enzyme action, ck-is that non-transgenic corn is with Hind III enzyme action

Fig. 5 transgenic corns HGK60 field insect resistace is identified, left: transfer-gen plant；Right: nontransgenic plants

Fig. 6 transgenic corns HGK60 external source Insert Fragment schematic diagram

Fig. 7 chromosome walking method detection left side flap sequence, M is DNAMarker；1 is the 2nd take turns PCR result, and 2 is third round PCR result

Fig. 8 Insert Fragment 5 ' end edge circle Sequence Detection PCR schemes, and M is DNAMarker；1,2 is pcr amplification product

Fig. 9 Insert Fragment 3 ' end border sequence PCR figure, M is DNAMarker；1,2 is pcr amplification product

Figure 10 Insert Fragment 3 ' end border sequence PCR figure, M is DNAMarker；1 is negative control；2-4 is pcr amplification product

Figure 11 Insert Fragment position in Maize genome

Detailed description of the invention

Embodiment 1, transgenic corn events HGK60 acquisition

1, for the structure of the plant expression vector of corn transformation

The plant expression vector of this research is pmAhG2 (being stored in Biological Technology institute, Chinese Academy of Agricultural Sciences), and Fig. 1 is shown in by collection of illustrative plates.nullThe skeleton of plant expression vector is pCAMBIA3300，Polyclone at carrier inserts the ubiquitin promoter from maize ubiquitin albumen、Btcry1Ah gene (the patent No.: the ZL200410009918.9 of transformation，See SEQIDNO:3) and NOS terminator，The riddled basins being inserted simultaneously into is G2-aroA gene，G2-aroA gene is the coding EPSPS enzyme (patent No.: ZL03826892.2) of clone in the strain glyphosate height endurability bacterial strain Pseudomonas fluorescence G2 bacterial strain separated from long-term glyphosate contaminated soil，G2-aroA gene is by Semen Maydis ubiquitin promoters driven，Terminator is NOS，Riddled basins expression cassette is connected with Btcry1Ah expression casette，Jointly it is inserted into skeleton carrier pCAMBIA3300 structure and obtains pmAhG2 (see SEQIDNO:4).

2, Agrobacterium-mediated Transformation maize immature embryos obtains transformed plant

Being transformed in Agrobacterium EHA105 by freeze-thaw method by carrier pmAhG2, PCR identifies.With the maize immature embryos of about the 1.2mm of fresh stripping for material, rataria is put into and infects in culture medium after one hour, wash once with infecting culture medium, then be immersed in the Agrobacterium bacterium solution adding 100 μMs of acetosyringones, and place 5 points of kinds.Taking-up sterilizing filter paper blots, and is put into and co-cultures on base, co-cultures 3 days, and set comparison under 26 DEG C of dark conditions.Again rataria is transferred on recovery media and cultivates 10 days to inducing callus, then it is then transferred to after callus first being removed bud in the screening culture medium containing corresponding selective agent, every two weeks subcultures are once, through the screenings of 6 weeks resistant calli transferred to and regeneration culture medium being shown in, light breaks up, after seeing light about one week, start that green bud point occurs, wound healing block carries out cutting make the bud point of green separate and transfer to regeneration culture medium is cultivated, it is beneficial to the growth of stem, when stem elongation is to 3～4cm, transfer them to root induction on regeneration culture medium, look sturdy after and well developed root system until milpa, transfer them in greenhouse small flower and grow.After continuing cultivation two weeks, it is transferred to greenhouse the earth after Seedling growth conditions to be transformed is good, after female fringe is weaved silk, entangles with paper bag, pollinate after waiting tassel loose powder, and gather in the crops fruit.With reference to (FrameBR, PlantPhysiology, 2002,129:13-22)

Culture medium is for infecting culture fluid: N6 salt and N6 vitamin (Chu etc., ScienceSinica, 1975,18:659-668), 1.5mg/L2,4-D, 0.7/Lg proline, 68.4g/L sucrose, 36g/L glucose (pH5.2), filtration sterilization, in 4 DEG C of storages；The acetosyringone (AS) of filtration sterilization is added before using, final concentration of 100 μMs；

Co-culture culture medium: N6 salt and N6 vitamin, 1.5mg/L2,4-D, 0.7g/L proline, 30g/L sucrose, 3g/L plant gel (pH5.8), the silver nitrate of final concentration of 0.85mg/L through filtration sterilization, the cysteine of AS, the 300mg/L of 100 μMs is added after autoclaving；

Recovery media: N6 salt and N6 vitamin, 1.5mg/L2,4-D, 0.7g/L proline, 30g/L sucrose, 0.5g/LMES, 4g/L plant gel (pH5.8), adds the Carbenicillin of the silver nitrate of final concentration of 0.85mg/L through filtration sterilization and 200mg/L after autoclaving；

Screening culture medium: recovery media adds selective agent 1mM phosphine oxamate；

Regeneration culture medium: MS salt and MS vitamin, 30g/L sucrose, 100mg/L inositol, 3g/L plant gel (pH5.8), autoclaving.

3, the PCR detection of transformed plant

The a small amount of of 3.1 corn gene group DNAs extracts (test kit is purchased from Beijing Pu Boxin biotech firm):

(1) take fresh tissues of plants and be about 100mg or dry weight tissue is about 30mg, add liquid nitrogen and fully mill.

(2) ground powder being quickly transferred to is pre-loaded with in the centrifuge tube of 700 μ l65 DEG C preheating buffer GP1 and (in the GP1 of preheating, before experiment, adds mercaptoethanol, make its final concentration of 0.1%), rapidly after reverse mixing, centrifuge tube is placed on 65 DEG C of water-bath 20min, and in water-bath process, reverse centrifuge tube is with biased sample for several times.

(3) add 700 μ l chloroforms, fully mix, 12,000rpm centrifugal 5min.

(4) carefully previous step gained upper strata aqueous phase is proceeded in a new centrifuge tube, add 700 μ l buffer GP2, fully mix.

(5) liquid of mixing is proceeded in adsorption column CB3,12,000rpm centrifugal 30s, discard waste liquid.

(6) in adsorption column CB3, add 500 μ l buffer GD (please first check whether before use and added dehydrated alcohol), 12,000rpm centrifugal 30s, outwell waste liquid, are put in collecting pipe by adsorption column CB3.

(7) in adsorption column CB3, add 600 μ l rinsing liquid PW (please first check whether before use and added dehydrated alcohol), 12,000rpm centrifugal 30s, outwell waste liquid, are put in collecting pipe by adsorption column CB3.

(8) repetitive operation step 7.

(9) adsorption column CB3 is put back in collecting pipe, 12,000rpm centrifugal 2min, outwell waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in adsorbing material, add 40 μ lddH₂O eluted dna.

3.2 amplification cry1Ah genetic fragment primers:

M4Ah1:5'-GCATCTCCACCTACACCGACTA-3'

M4Ah2:5'-CGGCTGGAATCTGGGTAATC-3'

Purpose clip size: 831bp

3.3PCR reaction system is as follows:

Amplification condition is as follows: 94 DEG C of denaturation 5min；94 DEG C of degeneration 50s, 56 DEG C of annealing 40s, 72 DEG C extend 50s,

Amplification cycles number is 35；Last 72 DEG C extend 10min.

It is transfer-gen plant that PCR detects positive plant, and testing result is shown in Fig. 2.

4, the southernblot detection of transfer-gen plant

A large amount of extractions of 4.1 corn gene group DNAs:

CTAB method is slightly improved:

(1) weighing 5g blade, liquid nitrogen is fully ground in the centrifuge tube that powder (not making material melts) adds 50mL afterwards；

(2) ((Tris100mM, NaCl1.4M, 20mMEDTA, 2%CTAB, 0.1% mercaptoethanol) fully mixes, and 65 DEG C carry out water-bath 1 hour to add 15mL2 × CTAB buffer；

(3) after being cooled to room temperature, adding the chloroform/isoamyl alcohol (24:1) of 15mL, mixing of turning upside down is to emulsion, and ambient temperatare puts 15～60 minutes；

(4) the centrifugal 15min of 12,000rpm under room temperature；

(5) after supernatant being transferred to clean centrifuge tube, add the isopropanol of 2/3 volume, turn upside down for several times, choose DNA, put into clean 1.5mL centrifuge tube；

(6) by DNA 70% ethanol purge 2 times, air drying 1 hour；

After (7) 500 μ lTE dissolving DNAs, add 5 μ lRNaseA (10mg/mL), overnight dissolve or 37 DEG C of dissolvings in 1 hour at 4 DEG C；

(8) 500 μ l phenol are added, reverse fully mixing, 12,000rpm centrifugal 5min, supernatant is transferred to another centrifuge tube；(9) 250 μ l phenol and chloroforms it are separately added into, reverse fully mixing, 12,000rpm centrifugal 5min, supernatant is transferred to another centrifuge tube；

(10) 500 μ l chloroforms are added, reverse fully mixing, 12,000rpm centrifugal 5min, supernatant is transferred in 10mL centrifuge tube；

(11) add TE to 3mL, be subsequently adding dehydrated alcohol and the 1/10 volume 3MNaAc of 2 times of volumes, turn upside down for several times；

(12) by DNA 70% ethanol purge that is settled out 2 times；Transfer DNA is to 1.5mL centrifuge tube, and air drying is also dissolved in 500 μ lTE, DNA quantitatively, standby.

The preliminary experiment of 4.2 genomic DNAs enzyme action in a small amount:

After mixing, in 37 DEG C of enzyme action 2～3hr；Endonuclease reaction thing is separated by electrophoresis on 0.7% agarose, checks enzyme action effect.

A large amount of enzyme action of 4.3 genomic DNAs:

Genomic DNA 100 μ g

Enzyme (10U/ μ L) 5 μ L

(BamH I, Hind III and Sac I enzyme action are selected in this experiment)

10×Buffer40μL

Total400μL

In 37 DEG C of enzyme action 10hr after mixing；Take 2 μ l digestion products to be separated by electrophoresis, check enzyme action effect；After enzyme action is complete, digestion products is precipitated, adds the 3MNaAc of 1/10 volume, the dehydrated alcohol (-20 DEG C of pre-coolings) of 2 times of volumes, after mixing, place 2hr in-20 DEG C；In 12,000rpm, 4 DEG C of centrifugal 20min, abandon supernatant, in precipitation, add 1ml70% ethanol, 12,000rpm centrifugal 2min abandon supernatant, and precipitation is dissolved in 30 μ lddH after drying up₂In O standby.

4.4Southernblot is hybridized

(1) agarose gel of 0.7% is prepared, 30 μ l genomic DNA digestion products add 6 μ l6 × loadingbuffer be separated by electrophoresis, 10min is stood after loading, begin with low-voltage, run out of after well 2～3cm until bromophenol blue, high voltage is to 50V, electrophoresis 5～6 hours；

(2) after electrophoresis terminates, successively gel is handled as follows: soaking glue 10min in 0.125M hydrochloric acid, in gel, bromophenol blue becomes yellow；Distilled water treatment gel 5min；Neutralizer soaks glue 30min；

(3) adopt capillary transfer method that DNA is transferred to nylon membrane (" molecular cloning " laboratory manual is shown in concrete operations)；

(4) transferring film terminates rear 6XSSC and soaks nylon membrane 5min, is put by nylon membrane in super-clean bench and dries up or room temperature is dried；

(5) 80 DEG C, dry film 2hr, fixed dna sample；

(6) label probe: the method prepared according to test kit middle probe carries out, with plasmid pmAhG2 for template, m4Ah1, m4Ah2 are primer, and PCR program is with above-mentioned detection program, and probe size is 831bp, measure concentration and probe concentration；

(7) prehybridization: carefully nylon membrane is loaded in hybrid pipe with tweezers, careful operation does not produce bubble, it is subsequently adding DIGEasyHyb hybridization solution (digoxigenin labeled and detection kit II and PCR digoxigenin-probe synthetic agent box are purchased from Roche company) 10mL, 42 DEG C of prehybridization 3h of 42 DEG C of preheatings；

(8) hybridization: first carry out the process of probe, by the probe of labelling in 99 DEG C of degeneration 6min, is immediately placed in ice and cools down 2min.Taking 7mLDIGEasyHyb hybridization solution, the probe (25ng/mlHyb hybridization solution) that addition processed, mixing does not carefully produce bubble gently, puts in hybrid heater, 42 DEG C of hybridization 16～20h；

(9) film is washed: first wash twice with under 2 × SSC, the 0.1%SDS solution room temperature of 50mL, each 15min.Then wash twice with 0.5 × SSC, 0.1%SDS solution 50mL65 DEG C, each 30min.With tweezers film carefully taken out and proceed to equipped with the washing 1～5min that vibrates in the plate of 50mLWashingbuffer；

(10) with 100ml1 × Blockingsolution incubated at room 60min；

(11) 30min is hatched with 20mlAntibodysolution；

(12) wash 2 times with 50mlWashingbuffer, each 30min；

(13) in 20mlDetectionbuffer, 2～5min is balanced；

(14) with tweezers, film is lain against between two-layer preservative film, first upper strata preservative film is mentioned, be subsequently adding 1mlCSPD substrate, slowly put down upper strata preservative film from one end, make substrate cover the surface of film equably, stand 5min in room temperature；

(15) drive surplus liquid out of with Glass rod, blot the substrate outside film with filter paper, hatch 10min for 37 DEG C；

(16) by the nylon membrane sealed as in folding, in darkroom with X-ray tabletting and be exposed, develop, fixing.

5, the insect resistace of transfer-gen plant is identified

(1) when milpa grows to 6～8 leaves, being connected in Semen Maydis lobus cardiacus by Pyrausta nubilalis (Hubern). newly hatched larvae, every strain connects 40～60 Pyrausta nubilalis (Hubern). newly hatched larvaes, connects 2 weeks " Invest, Then Investigate " food leaf level of worm.

(2) insect resistace standard adopts 9 grades of grade scales that international Pyrausta nubilalis (Hubern). cooperative groups is formulated:

1～3 grade: worm channel needle prick shape (1 grade: rare, dispersion；2 grades: moderate quatity；3 grades: a large amount of).

4～6 grades: worm channel match end size (4 grades: rare, dispersion；5 grades: moderate quatity；6 grades: a large amount of).

7～9 grades: worm channel is more than match end (7 grades: rare dispersion；8 grades: moderate quatity；9 grades: a large amount of).

(3) resistance grade classification: 1～2.9 grade (high resistance), 3～4.9 grades (pest-resistant), 5～6.9 grades (sense worm), 7～9 grades (high sense).Select non-transgenic corn as negative control simultaneously, connect worm method identical with transgenic line.After 2 weeks, statistics milpa is by Pyrausta nubilalis (Hubern). Harm: in 442 strain transfer-gen plants of detection, there is transfer-gen plant 139 strain of 1-4.9 level, 5-6.9 level have 35 strains, the plant of 7-9 level has 268 strains, wherein having a strain to only have the worm channel of needle point size, and all do not have Pyrausta nubilalis (Hubern). to endanger at stem stalk and spica, this plant is HGK60 (Fig. 5).

Embodiment 2, transgenic corn events HGK60 exogenous gene insertion point analyze

Southernblot result according to transgenic corn events HGK60 is analyzed: carrier restriction enzyme site as shown in Figure 3,3 BamH I restriction enzyme sites are had in inserting expression cassette, using be sized to the m4-cry1Ah genetic fragment of the digoxigenin labeled of 831bp as probe 1 hybridize time, no matter exogenous sequences has several copy to insert, capital hybridization obtains 1 fragment (Fig. 4) being sized to 4.6Kb, and 3 samples show identical hybridising band；1 Hind III restriction enzyme site is had in inserting expression cassette, 3 Sac I restriction enzyme sites, these restriction enzyme sites are respectively positioned on cry1Ah gene 3 ' end, without influence on the qualification to cry1Ah gene copy number, result is that Hind III, Sac I digestion products all hybridize 2 bands (Fig. 4), it was demonstrated that be the insertions of two copies.

Analyzed by Southernblot, cry1Ah gene is insert with two copies in HGK60 event, it is that unit point inserts or dibit point inserts to verify that exogenous gene inserts, by HGK60 event and Zheng 58 hybridization between selfed lines, detection first filial generation exogenous gene segregation ratio, in 255 offsprings of detection, has 128 positive plants, the ratio of positive plant and negative plant is 1:1, and preliminary proof exogenous gene is inserted on same chromosome.According to different infix forms (head to head, tail is to tail, and head is correct to tail and tail) the design primer of Insert Fragment, carry out pcr amplification with HGK60 corn gene group DNA for template.

Detection primer:

G2fprimer:5 '-TCCTCGCAGCCTTCAACAATACTCCC

1Ahrprimer:5 '-GCACGAACTCGGAGAGCAGAAACT

PCR reaction system is as follows:

Reaction condition:

94 DEG C, 2min；98 DEG C, 10s, 55.7 DEG C, 30s, 68 DEG C, 2min, 30 circulations；72 DEG C, 10min

PCR primer sequencing result shows that two copies inserted are reversely to be inserted in Maize genome in the way of tail is correct, and schematic diagram is shown in that Fig. 5, exogenous gene are that unit point inserts.

Embodiment 3 obtains 5 ' ends and 3 ' the end flanking sequences of transgenic event HGK60 by chromosome walking

It is inserted into the exogenous sequences of Maize genome as shown in Figure 6, the cry1Ah gene of transformation and the G2-aroA marker gene of transformation of two copies are cascaded and are reversely inserted on maize chromosome, because ubiquitin promoter originates from maize ubiquitin protein gene, containing this gene in Maize genome, so not easily obtaining flanking sequence by chromosome walking method, therefore start to design primer from G2-aroA gene, expand toward 3 ' ends from the 5 ' of G2-aroA ends.

Specific primer design is as follows:

SP1:TCCTCGCAGCCTTCAACAATACTCCC (is positioned on G2-aroA gene)

SP2:GGTCTCAGGCATTCGCATTCAG (is positioned on G2-aroA gene)

SP3:AATCCTGTTGCCGGTCTTGCGATGA (is positioned on no)

Chromosome walking test kit is purchased from TaKaRa company (GenomeWalkingKit), 4 kinds of degenerate primers are had in test kit, carry out 2 with respectively with 4 kinds of degenerate primers (AP1, AP2, AP3, AP4) of SP1, SP2 and take turns amplification, according to expanding effect, finally have selected AP4 primer, having carried out the amplification of third round with AP4 primer with SP3, the band obtained sends to order-checking.

(1) 1stPCR reaction

With SP1 for forward primer, 4 kinds of degenerate primer respectively downstream primers, for AP1, carry out 1stPCR reaction.Reaction system:

Reaction condition:

(2) 2ndPCR reaction

Take first round PCR product 5 μ l electrophoresis, select extension rate according to first round electrophoretic band brightness.Take 1 μ L cut back to carry out the 2nd as template and take turns reaction, with SP2 for forward primer, 4 kinds of degenerate primer respectively downstream primers, carry out 2ndPCR reaction.

Reaction system:

Reaction condition:

(3) 3rdPCR reaction

Taking 1 μ l second and take turns PCR product as template, with SP3 for forward primer, AP4 is downstream primer, carries out 3rdPCR reaction.

Reaction system:

Reaction condition:

(4) each 5 μ l of 2nd and 3rdPCR product are taken, the agarose gel of 1% carries out electrophoresis, electrophoretogram is shown in Fig. 7, third round PCR primer checks order, sequencing result is carrier sequence and maize genomic sequence, the maize genomic sequence obtained, by MaizeGDB database retrieval, is positioned on Semen Maydis number one chromosome.Obtain 3 ' the end flanking sequences that sequence is Insert Fragment, see SEQIDNO:1.

(5) acquisition of 5 ' end flanking sequences of Insert Fragment

It is ubiquitin promoter sequence owing to holding the 3 ' of Insert Fragment, Maize genome there is also identical sequence, the method utilizing chromosome walking is difficult to obtain border sequence, according to the 3 ' flanking sequences obtained, retrieve known maize genomic sequence, carry out pcr amplification at the cry1Ah gene internal of carrier and 5 ' flanking sequence design specific primers of supposition.

Specific primer:

AhF:GCACGAACTCGGAGAGCAGAAACT (in cry1Ah gene)

GR1:GAGCACGACAACGAGACAGA (on Maize genome)

Reaction system:

Reaction condition:

PCR primer checks order.Electrophoresis result is shown in Fig. 8.

Sequencing result shows that the ubiquitin promoter 5 ' end driving cry1Ah gene has lacked 352bp, insertion due to exogenous sequences, Maize genome there is 27bp lack, two copies insert in the Maize genome being just reversely inserted into disappearance 27bp, and 5 ' flanking sequences of insertion sequence are shown in SEQIDNO:2.

Figure 11 is Insert Fragment position in Maize genome.

Embodiment 4, transgenic corn events HGK60 flanking sequence application

In order to detect transgenic corn events, design specific primer detection transgenic corns HGK60 event, hold flanking sequence and Insert Fragment primers as follows according to 3 ':

3 ' F:GCATGTCTATTACGCAAAGGTC (Insert Fragment 3 ' end)

3 ' R:GGTCTCAGGCATTCGCATTCAG (G2-aroA gene)

Clip size 1124bp

Reaction system:

Reaction condition:

PCR primer detects at 0.8% agarose gel electrophoresis, and testing result is shown in Fig. 9, amplifiable go out 1124bp band.

Insert Fragment 5 ' flanking sequence specific primer

5 ' F:CGAAACAAGAAAAATGTTTCCTTAG (Ubi promoter)

5 ' R:GTGCGCGCTAGCTGGCGTGTT (Insert Fragment 5 ' end)

Amplified band is sized to 628bp

Reaction system:

Reaction condition:

PCR primer detects at 0.8% agarose gel electrophoresis, and testing result is shown in Figure 10, amplifiable go out 628bp band.Meanwhile, because the insertion point of the transgenic event of this research is specific, it is possible to use 5 ' flanking sequences detect this transformation event with carrier sequence and 3 ' flanking sequences with carrier sequence design specific primer, and utilize specific primer exploitation detection kit.

Claims

1. 3 ' end side DNA of transgenic insect-resistant corn HGK60 external source Insert Fragment, its nucleotide sequence is such as shown in SEQIDNO:1.

2. 5 ' end side DNA of transgenic insect-resistant corn HGK60 external source Insert Fragment, its nucleotide sequence is such as shown in SEQIDNO:2.

3. being used for test right and require the specific primer of the side DNA described in 1, its nucleotide sequence is as follows:

3 ' F:GCATGTCTATTACGCAAAGGTC,

3 ' R:GGTCTCAGGCATTCGCATTCAG.

4. being used for test right and require the specific primer of the side DNA described in 2, its nucleotide sequence is as follows:

5 ' F:CGAAACAAGAAAAATGTTTCCTTAG,

5’R:GTGCGCGCTAGCTGGCGTGTT。

5. the PCR detection method of transgenic insect-resistant corn HGK60, it is characterised in that: its PCR primer is the specific primer described in claim 3 or 4.

6. PCR detection method according to claim 5, described specific primer is:

3 ' F:GCATGTCTATTACGCAAAGGTC,

3 ' R:GGTCTCAGGCATTCGCATTCAG,

The clip size that described PCR is obtained by reacting is 1124bp.

7. PCR detection method according to claim 5, described specific primer is:

5 ' F:CGAAACAAGAAAAATGTTTCCTTAG,

5 ' R:GTGCGCGCTAGCTGGCGTGTT,

The clip size that described PCR is obtained by reacting is 628bp.

8. the application in preparation detection transgenic corns test kit of the specific primer described in claim 3 or 4.

9. a detection kit, it is characterised in that: containing the specific primer described in claim 4 or 5.

10. side DNA shown in claim 1 or 2 or the specific primer described in claim 3 or 4 or the application in detection transgenic corns of the detection kit described in claim 9.