CN106497924B - The construction method of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04 - Google Patents

Abstract

The present invention relates to the construction methods of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04 a kind of.The present invention constructs the genetic transformation carrier comprising Glyphosate resistance gene cp4 epsps and anti-snout moth's larva genecry1C, by agrobcterium-mediated transformation, using glyphosate as selective agent, successfully the area T-DNA of carrier is singly copied and is integrated into rice genome, and the excellent transgenic rice plant KCRC04 of anti-snout moth's larva, resistance glyphosate, economical character is cultivated, it specifies the insertion position of external source T-DNA and devises method for detecting specificity.This method is suitable for the security evaluation and detection of transgenic paddy rice, and the transgenic paddy rice obtained as the transformation event is various transgenic paddy rice new varieties obtained from donor.

Description

The construction method of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04

Technical field

The present invention relates to plant genetic engineering and technical field of crop propagation.Specifically, being related to a kind of anti-grass of anti-snout moth's larva The construction method of sweet phosphine transgenic paddy rice KCRC04.

Background technique

China is main Rice Cropping state and country of consumption in the world, currently, the cultivated area of rice in China occupies the whole world Second, yield occupies the first in the world (Su Shaoquan, Teng Chunhong.The new development of herbicides for use in paddy.World pesticide, 2010,32:1- 6.).2011, the cultivated area of China's rice reached 3005.7 ten thousand hectares, and the annual output of paddy has reached 20100.1 ten thousand Ton, 35.2% (China Statistical Yearbook, 2012) of Zhan Suoyou grain yield.By the end of the year 2008, the cultivated area in China has contracted 12171.6 ten thousand hectares are reduced to, total Farmland was also only maintained on this quantity in recent years, and population is with annual 5 ‰ speed increases (China Statistical Yearbook, 2012).It can be seen that the safe and stable life of rice from above statistical data Production is the key that ensure national food security.But the poor environments factor such as insect pest and weeds limits the hair of rice yield potentiality It waves.

(1) insect infestations problem: insect pest is an important factor for influencing Rice Production, it is annual caused by production loss be up to 15% or so (Zhang Qifa.The conception and practice of green super hybridization rice, 2009, Science Press).Currently crop pests are prevented It controls measure and also relies primarily on chemical pesticide.China Pesticide use amount whole world first, nineteen ninety dosage is less than 300,000 tons, and 2005 Dosage just has reached 1,400,000 tons.A large amount of uses of pesticide, had both increased the planting cost of peasant, reduced kind of a grain income, and make At a series of ecological environment problems such as environmental pollution, pesticide residue, pest resistance to insecticide enhancing and killing natural enemies.The pest-resistant egg of Bt It is white, it is mainly toxic to the larva of the lepidopterous insects such as snout moth's larva of rice, there is very strong specificity, by cultivating the pest-resistant water of transgenosis Bt Rice is capable of the harm of the effectively preventing snout moth's larva of rice, reduces Pesticide use amount, increases the income of peasant, reduces Pesticide use pair It is endangered caused by environment.

(2) Weed infestation problem: weeds in paddy field and rice are at war on water, fertilizer, growing space, directly affect rice Yield.The use with cultural methods such as rice transplantings is broadcast live in recent years, so that the Weed infestation in rice field becomes to get worse.In addition, As people in the countryside are toward the quickening of urban migration speed, the scale and mechanization of Rice Cropping are a foreseeable trend, This makes the method for traditional artificial weeding become unrealistic.Application herbicide is to solve these preferred plans newly to go wrong One of.Therefore, Herbicide resistant Hybrid Rice Combinations will have very big actual demand and market potential.

Summary of the invention

In order to solve the problems in the existing technology, the object of the present invention is to provide a kind of anti-snout moth's larva resistance glyphosates to turn base Because of the construction method of rice KCRC04.

In order to achieve the object of the present invention, the present invention relates to transgenic paddy rice event, by by pest-resistant anti-herbicide gene structure It is built to and makes recipient plant on an expression vector while there is the characteristic of pest-resistant antiweed.Sieve is oriented by the character in mostly generation Choosing and identification, have obtained the excellent strain of pest-resistant antiweed and have separated the flanking sequence of foreign vector, it is determined that it integrates position Point.The transgenic rice plant that the transformation event obtains can not only be used as the donor of breed improvement, but also specificity inspection Survey method be designed as identification comprising the same T-DNA segment of the transformation event and be inserted into same genomic locations turn base Because plant provides approach.

The present invention is constructed comprising Glyphosate resistance gene cp4 epsps (SEQ ID NO:15) and anti-snout moth's larva gene The genetic transformation carrier pZHZH15003 of cry1C (SEQ ID NO:16), by agrobcterium-mediated transformation, with grass The area T-DNA of pZHZH15003 is successfully singly copied and is integrated into rice genome as selective agent by sweet phosphine, and is cultivated anti- The excellent transgenic rice plant KCRC04 of snout moth's larva, resistance glyphosate, economical character, specifies the insertion position of external source T-DNA simultaneously Devise method for detecting specificity.

The present invention provides the T-DNA region nucleotide sequence of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04, the T-DNA Region nucleotide sequence is as shown in SEQ ID NO:1 or its complementary series or the nucleotide for reaching 90% or more with its homology Sequence；The left margin flanking sequence of the T-DNA region nucleotide sequence be as shown in SEQ ID NO:2 or its complementary series or Reach 90% or more nucleotide sequence with its homology.

The present invention also provides the T-DNA region nucleotide sequence of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04, the T- Region of DNA nucleotides sequence is classified as shown in SEQ ID NO:1 or its complementary series or the nucleosides for reaching 90% or more with its homology Acid sequence；The right margin flanking sequence of the T-DNA region nucleotide sequence is as shown in SEQ ID NO:3 or its complementary series Or reach with its homology 90% or more nucleotide sequence.

The present invention also provides the specific primers for regular-PCR qualitative detection KCRC04 transformation event and genotype It is right, comprising:

LBF1:GGAAACAGCTGCCTGGGAT；

LBR:CAGTACATTAAAAACGTCCGCAAT；

RBR:TGTGACGATCGAAAAAATACGAAT。

The present invention also provides the specific primer pair for Realtime-PCR quantitative detection KCRC04 transformation event, packets It includes:

LBF2:AGCTTAGCCAACACGGACTTG；

LBR:CAGTACATTAAAAACGTCCGCAAT。

The present invention also provides the detection methods of anti-snout moth's larva resistance glyphosate transgenic paddy rice, comprising the following steps:

1) total DNA of transgenic paddy rice to be measured is extracted；

2) using the DNA of step 1) as template, using primer SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:7 or SEQ ID NO:5 and SEQ ID NO:6 carries out regular-PCR or Realtime-PCR amplification；

3) gel electrophoresis analysis pcr amplification product or analysis Realtime-PCR amplification curve.

The present invention also provides application of the detection method in rice breeding.It is related to planting the rice of above-mentioned transformation event The detection of strain, to carry out the applications such as transgenic labeling, content analysis, genetic drift research and crossbreeding tracking.The plant Including but not limited to each organs such as parent, self progeny, the seed of filial generation, pollen, gynoecium, blade, root and plant cell, Plant tissue etc..

The present invention also provides application of the detection method in the genotype for judging KCRC04 transformation event, specifically:

The material of only one 448bp size banding pattern is the material of KCRC04 homozygous genotype；

The material of only one 590bp size banding pattern is the material without KCRC04 event；

Have two strip-types and size be respectively 448bp and 590bp material be KCRC04 heterozygous genotypes material.

The present invention further provides the construction methods of anti-snout moth's larva resistance glyphosate transgenic paddy rice, comprising the following steps:

(1) artificial synthesized glyphosate and snout moth's larva resistant gene cp4 epsps and cry1C；

(2) gene constructed into same genetic transformation carrier pZHZH15003 by what is synthesized in step (1)；

The specific building process of the conversion carrier pZHZH15003 are as follows: (carrier is by CP4 segment and PU130 carrier The derivative vector of pCambia3300, building process are: pCambia3300 is handled through XhoI and HindIII digestion, uses Pubi The part P35s-Bar is replaced to obtain PU130) respectively with BamHI and SacI digestion, skeleton carrier Pubi-CP4- is obtained after connection T35spolyA；PCR amplification rbcs promoter simultaneously adds HindIII and XmaI restriction enzyme site at its both ends respectively, is connected to and comes from On the cloning vector pGEM7Z of Promega company, intermediate vector 7Z-rbcs is obtained；Synthesis cry1C-Tnos segment simultaneously adds enzyme Enzyme site XmaI and SphI；The segment and intermediate vector 7Z-rbcs are cut with XmaI and SphI respectively, intermediate load is obtained after connection Body Prbcs-cry1C-Tnos；Using PmeI single endonuclease digestion skeleton carrier Pubi-CP4-T35spolyA, and is handled with CIP and remove phosphoric acid Change；Using SacI digestion intermediate vector Prbcs-cry1C-Tnos, and filling-in cohesive end.Connect treated matrix tablet Section and Insert Fragment Prbcs-cry1C-Tnos, building obtain pZHZH15003 carrier.

(3) recombinant vector obtained in step (2) is imported into rice varieties ' no loadtransformer ' by agrobacterium-mediated transformation In；Specific steps are as follows: the expression vector that building obtains is transformed into Agrobacterium；The embryo that Agrobacterium bacterium solution infects rice is cured Injured tissue；Callus is transferred on the Selective agar medium for be added to glyphosate and carries out screening and culturing, selects kanamycin-resistant callus tissue group It knits；Resistant calli is transferred to differential medium and carries out differentiation culture, the regeneration seedling being differentiated to form is transferred to culture of rootage It is cultivated in base, hardening, transplanting, obtain transgenic paddy rice transformant after seedling takes root.

(4) Molecular Identification is carried out to the transformant of step (3), screens single copy insertion and the T0 generation conversion of carrier-free skeleton Plant is planted and harvests T1 for seed；

(5) glyphosate is sprayed after the T1 of step (4) was for germination 15 days, choosing has glyphosate resistance and meet Meng The transgenic paddy rice strain of Dare genetic development detects genotype, and T2 is for seed for screening homozygous strain harvest；

(6) T2 of plantation step (5) identifies its resistance to the snout moth's larva of rice in plant different stages of growth for seed, sieve The strain harvest T3 for selecting insect resistace good is for seed；

(7) by the T3 of step (6) for cultivating seeds at plant, assess the economical character of strain, it is excellent to choose economical character Strain detect T-DNA region nucleotide sequence, screening has the transgenic rice plant that singly copies of the area T-DNA；The area T-DNA Nucleotide sequence is as shown in SEQ ID NO:1 or its complementary series or the nucleotide sequence for reaching 90% or more with its homology；

(8) it is verified using transgenic rice plant of the detection method to step (7), it is anti-finally to obtain anti-snout moth's larva Glyphosate transgenic paddy rice；

The anti-snout moth's larva resistance glyphosate transgenic paddy rice, T-DNA left margin flanking sequence as shown in SEQ ID NO:2, Or its complementary series or the nucleotide sequence for reaching 90% or more with its homology；Its T-DNA right margin flanking sequence such as SEQ Shown in ID NO:3 or its complementary series or the nucleotide sequence for reaching 90% or more with its homology.

Wherein, the spraying concentration range of the step 5) glyphosate is 0.3%-9%V/V.

The present invention still further provides the construction method of anti-snout moth's larva resistance glyphosate transgenic paddy rice in Weeds distribution and evil The application of worm prevention and treatment aspect.

The anti-snout moth's larva resistance glyphosate transgenic rice plant KCRC04 that the present invention obtains is to be with rice varieties ' no loadtransformer ' Receptor is obtained by transgenic technology, while the transformation event is also applied for having same T-DNA segment and be inserted into same Sample genomic locations, and the plant obtained using other receptor breed improvements.

The present invention provides the detection methods and application of anti-snout moth's larva resistance glyphosate transgenic paddy rice, are suitable for transgenic paddy rice Security evaluation and detection, and the transgenic paddy rice obtained as the transformation event is various transgenic paddy rices obtained from donor New varieties.

On the one hand, the present invention provides a kind of transgenic paddy rice events, are had by the transgenic paddy rice that the transformation event obtains Have the characteristic of anti-snout moth's larva resistance glyphosate, using the transgenic paddy rice can carry out transgenic paddy rice new varieties cultivation and improvement with Prevent and treat snout moth's larva harm and Weed infestation.

On the other hand, the present invention provides a kind of detection methods of anti-snout moth's larva resistance glyphosate transgenic paddy rice, using the party Method can be to comprising having same T-DNA segment with the transformation event and being inserted into the transgenosis water of same genomic locations Rice (including parent, hybrid and its offspring) and its product (including plant, tissue, paddy, rice and its product) examinations, prison Survey and safety management.

Detailed description of the invention

Fig. 1 is the area T-DNA of transformation event and insertion position schematic diagram in the embodiment of the present invention 1.Arrow indicates conversion thing The design position of part detection primer, the title mark of each element is on the diagram.LB, Left Border；RB, Right Border；S, SEQ ID NO。

Fig. 2 is 1 transgenic plant Molecular Identification result of the embodiment of the present invention (detection of antibody test paper).A:Southern is miscellaneous Hand over identification transgenic plant copy number；B: antibody test paper identifies exogenous protein expression.The sample of asterisk expression event containing KCRC04.

The case where Fig. 3 is the Herbicid resistant and trait segregation of 1 transgenic plant of the embodiment of the present invention.Arrow instruction Strain is wild type control.Withered plant is the negative genes type separated in transgenic line.Asterisk expression contains The sample of KCRC04 event.

Fig. 4 is transformation event in the embodiment of the present invention 1 to the appraisal of the tolerance of various concentration glyphosate.A: wild Type ' no loadtransformer ' sprays 0.3% glyphosate；B, C, D, E, F, G, H, I be respectively KCRC04 transgenic paddy rice spray 0 respectively, 0.3%, the glyphosate of 2.4%, 4.8%, 6%, 9%, 15%, 24% (V/V).It sprays and takes a picture after two weeks.

Fig. 5 is transformation event in the embodiment of the present invention 1 to the Resistance Identification situation of the snout moth's larva of rice.A: transformation event is to rice The resistance of striped rice borer；B: transformation event is in field to the resistance of rice leaf roller.Arrow is designated as by rice leaf roller harm Blade.

Fig. 6 is the specific detection result of transformation event in the embodiment of the present invention 2.A: regular-PCR is to the qualitative of KCRC04 Detection and genotype detection.M, DL2000plus DNA marker, size are labeled in side；+ /+indicates KCRC04 homozygous gene Type；+/- expression KCRC04 heterozygous genotypes；/-indicates not containing the genotype of KCRC04；B:Realtime-PCR is to KCRC04 Quantitative detection.1-4 is respectively the amplification curve product of KCRC04 different content template.1,512pg genomic DNA；2,64pg Genomic DNA；3,8pg genomic DNAs；4,1pg genomic DNAs.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment According to conventional laboratory conditions, such as Sambrook molecular cloning experiment handbook (Sambrook J&Russell DW, Molecular cloning:a laboratory manual, 2001), or according to the condition of manufacturer's specification suggestion.

The acquisition of the anti-snout moth's larva resistance glyphosate transgenic paddy rice of embodiment 1

The construction method of anti-snout moth's larva resistance glyphosate transgenic paddy rice is as follows:

1, the synthesis of gene, the building of genetic transformation carrier and the acquisition of transgenic plant

According to sequence, artificial synthesized cp4 epsps and cry1C base shown in SEQ ID NO:15 and SEQ ID NO:16 Cause.It is building up in same genetic transformation carrier pZHZH15003.The specific building process of carrier pZHZH15003 are as follows: by CP4 piece Section with PU130 carrier (carrier be pCambia3300 derivative vector, building process is: pCambia3300 through XhoI with HindIII digestion processing replaces the part P35s-Bar to obtain PU130 with Pubi) BamHI and SacI digestion is used respectively, after connection Obtain skeleton carrier Pubi-CP4-T35spolyA；PCR amplification rbcs promoter and its both ends add respectively HindIII and XmaI restriction enzyme site is connected on the cloning vector pGEM 7Z from Promega company, obtains intermediate vector 7Z-rbcs；It closes At cry1C-Tnos segment and add restriction enzyme site XmaI and SphI；The segment and intermediate vector are cut with XmaI and SphI respectively 7Z-rbcs obtains intermediate vector Prbcs-cry1C-Tnos after connection；Use PmeI single endonuclease digestion skeleton carrier Pubi-CP4- T35spolyA, and dephosphorylation is handled with CIP；Using SacI digestion intermediate vector Prbcs-cry1C-Tnos, and filling-in is sticky End.Treated skeleton segment and Insert Fragment Prbcs-cry1C-Tnos are connected, building obtains pZHZH15003 load Body.

Carrier T-DNA area schematic is shown in Fig. 1, and T-DNA region nucleotide sequence is as shown in SEQ ID NO:1.It will recombination PZHZH15003 carrier is imported into rice varieties ' no loadtransformer ' by agrobcterium-mediated transformation.It is specific to import The step of are as follows: the expression vector that building obtains is transformed into Agrobacterium；Agrobacterium bacterium solution is infected to the embryo callus subculture group of rice It knits；Callus is transferred on the Selective agar medium for be added to glyphosate and carries out screening and culturing, selects resistant calli；It will Resistant calli is transferred to differential medium and carries out differentiation culture, and the regeneration seedling being differentiated to form is transferred in root media and is trained It supports, hardening, transplanting, obtain transgenic paddy rice transformant after seedling takes root.

2, the Molecular Identification of Transgenic Rice Plants

These transformation event copy numbers and carrier framework are analyzed, while analyzing CP4 EPSPS and cry1C albumen Expression, screen single copy and without carrier framework other than the region T-DNA, protein normal expression transgenosis T0 plant kind to warm Room simultaneously harvests T1 for seed.The Molecular Identification of KCRC04 the results are shown in Table 1.

The DNA positive identification result of 1 KCRC04 of table

Note: RQ value represents the DNA copy ratio of foreign gene Yu endogenous gene Actin.

RQ value is at the section 0.1-0.6, it is believed that target gene is single copy insertion.But since there is certain for detection RQ value Error needs Southern method to be verified, and concrete operations carry out in accordance with the following steps.

1) CTAB method extracts transformed plant total genomic dna.Divide single plant to take blade 0.5-1g, be put into the mortar of pre-cooling, Liquid nitrogen is added quickly by blade grind into powder, pours into 2mL centrifuge tube.It 700 μ l is added is preheated to 65 DEG C of 1.5%CTAB and mention It takes liquid and shakes up, 65 DEG C of water-baths keep the temperature 30-60min, during which shake several times；After room temperature is cooling, 700 μ l chloroforms are added, after shaking up, Reverse jog 10min, 8000rpm is centrifuged 10min at room temperature；Supernatant is moved in another centrifuge tube, isometric precipitating is added Liquid (isopropanol) precipitates at -20 DEG C 30 minutes, and 8000rpm is centrifuged 10min at room temperature；2-3 is rinsed with 700 μ l, 75% ethyl alcohol It is secondary, it is dissolved in 50 μ l TE after air-drying, -20 DEG C save backup.

2) digestion of genomic DNA.Select restriction enzyme HindIII digestion transformed plant total genomic dna, digestion Reaction system is as follows:

5 μ l digestion products are first taken to carry out prerunning, detection digestion effect in 37 DEG C of digestion 10-18h or so after mixing, after digestion Fruit.It is overnight that total DNA after digestion is finally carried out to low-voltage (30-40V) electrophoresis in 1% Ago-Gel.

3) transferring film.The lower right corner is cut after gel is modified as label, is immersed in 0.25mol/L HCl to bromophenol blue change Huang, distillation washing is twice；45min, deionized water rinsing are denaturalized in alkaline denaturation liquid (1.5M NaCl, 0.5M NaOH)；Neutralizer 30min is rinsed in (Tris-HCl of 1M pH7.4,1.5M NaCl), replacement neutralizer rinses 15min；It is placed in the transferring film put up On platform, use 10 × SSC as transferring film liquid, the rinsing of Hybond-N+ nylon membrane is in deionized water liquid level, until completely wet, immersion In transfering buffering liquid；Capillary tube method transfer 16-20h is carried out with 10 × SSC solution, the DNA on glue is transferred on nylon membrane.Turn After shifting, after nylon membrane is simply rinsed with 2 × SSC solution, after being crosslinked 1min on UV crosslinking instrument, room temperature is dried, with guarantor Fresh film wraps film, saves backup at 4 DEG C.

4) probe synthesis and hybridization and development.Probe label and hybridization and development use Roche company DIG High Primer DNALabeling and Detection Starter Kit I, illustrates to be operated according to kit.This hair It is bright using CP4 Gene Partial sequence as hybridization probe.

5) hybridize.It heats hybridization solution DIG Easy Hyb (10ml/100cm2), prehybridization 30 divides at 42 DEG C in hybrid heater Clock；Denatured probe (25ng/ml) at 95 DEG C, is placed on ice after five minutes；Denatured probe is added to pre-heated DIG Easy In Hyb (3.5ml/100cm2), mix；Prehybridization solution is outwelled, the probe of denaturation is added；Hybridize 4h-O/ at 42 DEG C in hybrid heater N。

6) film is washed.Hybridization solution is outwelled, is then washed twice at room temperature with 2 × SSC, 0.1%SDS, 5 minutes every time；Finally It is washed twice at 0.5 × SSC, 0.1%SDS, 65 DEG C, 15 minutes every time.

7) it develops the color.It is operated with probe in detecting.As a result as shown in Figure 2 A, KCRC04 transformation event is the mono- copy of external source T-DNA It is inserted into the event of genome.

As follows using Shanghai You Long Biotechnology Co., Ltd product AntiCP4 and AntiCry1C test strips Detect the albumen in plant tissue.Sampling: measurement tissue (blade, root, pollen etc.) is taken, the broken sample of water mill is added；Detection: test paper is taken Sample is immersed in item, test side；As a result observe: as a result, control line shows, expression test is normal for observation after 5-10 minutes.Detection line Whether show and indicates whether containing detection albumen.As shown in Figure 2 B, the transgenic plant of PCR tests positive all can detecte Shaping is brought, and band is not detected in wild type control material.The cp4 epsps gene and cry1C gene for showing external source can To give expression to albumen in Transgenic rice cells.

3, the glyphosate resistance of Transgenic Rice Plants and genotyping

T1 germination sprays glyphosate after 15 days, choose glyphosate resistance and sensitive plant meets Mendelian inheritance rule The strain of rule, sample detection genotype choose homozygous strain and harvest T2 seed；

In order to detect transgenic paddy rice to the resistance of glyphosate herbicidal, the Yu Liangye phase is sweet with the grass of 0.6% (V/V) concentration Phosphine sprays, and observes plant phenotype after a week.As the result is shown after herbicide spraying transgenic plant can with normal growth wild type Material gradually dries up, dead (as shown in figure 3, photograph taking in herbicide spraying after a week).This demonstrate turn containing the present invention The transgenic paddy rice of change event is resistant to glyphosate herbicidal.Simultaneously as single copy insertion of foreign gene, in T0 generation When show as heterozygous state, have gene and trait segregation phenomenon after selfing harvest T1 seed and meet mendelian inheritance, Therefore the ratio of statistics glyphosate resistance and sensitive plant can verify the Integration of foreign gene.In table 2 statistics indicate that, The genetic characteristics of KCRC04 transformation event meet mendelian inheritance.

Herbicid resistant and separation situation result of 2 KCRC04T1 of table for strain

4, the snout moth's larva Resistance Identification of Transgenic Rice Plants

T2 is sowed for seed, identifies its tolerance to glyphosate various concentration and the resistance to the snout moth's larva of rice.It chooses anti- Property good strain harvest T3 seed.

Glyphosate tolerant analysis is realized by following steps.Sowing: by transgenosis and control seed sowing in hole tray, To seedling length to three leaves, wholeheartedly to five leaves, wholeheartedly period carries out Glyphosate Spray.The leaf of plant is observed and recorded after application in two weeks Situations such as color and growing way.It is 0,0.3%, 2.4%, 4.8% that Glyphosate Spray 8 gradients of design, which are glyphosate content respectively, 6%, 9%, 15%, 24% (V/V).As a result as shown in Figure 4 (photograph taking in herbicide spraying after two weeks), 0.3% is producer The field spraying concentration of recommendation, wild type control i.e. can be withered after spraying 0.3% glyphosate, and transgenic paddy rice can be resistant to 9% (V/V) concentration below, can be resistant to by being equivalent to by 30 times that recommend spraying concentration.In the grass for spraying 15% and 24% concentration Transgenic plant can show blade tip flavescence after sweet phosphine, and growth slows down, but can still survive.

Snout moth's larva Resistance Identification is assessed by indoor biometrics and field investigation two ways.Indoor biometrics experiment passes through following step It is rapid to realize.Sowing: by transgenosis and control seed sowing in hole tray, wait germinate 25 days or so it is spare；Connect worm: in culture dish 3-5 piece rice leaf or the stalk of 2cm long is added, one layer of filter paper completely moistened is added in bottom, accesses 10 striped rice borer and just incubates Larva is sealed with breathable adhesive tape, then is covered with the suitable black cloth of a block size, and rubber band is fixed；Culture: it is placed on after inoculation Culturing room's culture, condition of culture: 28 DEG C of temperature, humidity 85% ± 5%, light application time 16L/8D；Statistics: it is counted after connecing worm 5 days The striped rice borer death rate and corrected mortality.The death rate is corrected with adjoining tree, calculation formula are as follows:

Field investigation mode is to randomly select 10 plants of rice, calculates the whole strain number of blade and leaf roll number is commented with calculating leaf roll rate Estimate the resistance to rice leaf roller；It calculates whole strain tiller number and withered calculation resists rice-stem borer with calculating withered heart rate to assess Property.Snout moth's larva Resistance Identification the results are shown in Table 3 and Fig. 5, statistics indicate that better resistance of the KCRC04 to the snout moth's larva of rice, can effectively drop The harm of low snout moth's larva, to reduce the amount of application of pesticide.

Resistance of 3 KCRC04 of table to the snout moth's larva of rice.

5, the comprehensive agronomy character of Transgenic Rice Plants

Analysis of agronomic characters uses RANDOMIZED BLOCK DESIGN, 10.8 square meter of plot area, plant line space 26cm × 16.5cm (five or eight cun), cell is interior to plant 20 plants × 15 rows, transgenosis and control 3 repetitions of each plantation.Entire breeding time is using normal Field management measure.When harvest, the plant for excluding two row of cell surrounding randomly selects 10 plant conducts in remaining range Sample, measurement Correlated Yield Characters are simultaneously for statistical analysis, assess the comprehensive agronomy character of strain.The comprehensive agronomy of KCRC04 Shape performance is shown in Table 4.Statistics indicate that snout moth's larva there is no or the good situation of control of insect measure, the comprehensive agronomy of KCRC04 Character will not be than the difference of wild type control.

The comprehensive agronomy character of 4 KCRC04 of table

6, the Flanking sequence isolation in the area T-DNA and insertion position determine

Choose the flanking sequence in the excellent strain separation area T-DNA of economical character.Obtained flanking sequence and paddy gene Group database is compared, and specifies the insertion position external source T-DNA.

Transgenic fragment insertion position is analyzed using Adaptor-PCR, the specific steps are as follows:

It is spare that genomic DNA is prepared with 2mL centrifugal pipe process.

With ddH2O by adapter-primer AD-L (CTAATACGAGTCACTATAGCGCTCGAGCGGCCGCCGGGGAGGT) and AD-S (Pi-ACCTCCCC-NH2) is diluted to 100 μm of ol/L respectively, isometric to mix, and 94 DEG C of water-baths are denaturalized 4min, natural cooling It is the connector of 50 μm of ol/L after to room temperature.

Following reaction system is added in the 0.5mL centrifuge tube of sterilizing, (25 DEG C) incubation 16h of room temperature:

65 DEG C of water-bath 10min terminate reaction after reaction.

The template reacted using the digestion connection product in step 3 as first round PCR.Reaction system is as follows:

Wherein, the nucleotide sequence of the SP1 and VP1 is as shown in SEQ ID NO:11 and shown in SEQ ID NO:13.

First run PCR response procedures are as follows: 94 DEG C, 5min；(94 DEG C, 30sec；72 DEG C, 3min) × 7cycles；(94 DEG C, 30sec；67 DEG C, 3min) × 32cycles；67 DEG C, 7min；25 DEG C, 10min.

The second wheel PCR amplification is carried out by template of PCR product corresponding in step 4, reaction system is as follows:

Wherein, the nucleotide sequence of the SP2 and VP2 is as shown in SEQ ID NO:12 and shown in SEQ ID NO:14.

Two wheel PCR response procedures: 94 DEG C, 5min；(94 DEG C, 30sec；72 DEG C, 3min) × 5cycles；(94 DEG C, 30sec；67 DEG C, 3min) × 20cycles；67 DEG C, 7min；25 DEG C, 10min.

The product of 5 μ L second wheel PCR electrophoresis detection in 1% (w/v) 0.5 × TBE Ago-Gel is taken, has been selected The PCR product of 250bp or more DNA fragmentation is sequenced with dideoxy chain termination.

Sequencing result (http://rice.plantbiology.msu.edu/) in RGAP database uses BLASTN tool With Rice Genome Sequence carry out it is homologous compare, using best matching result as insertion point.

Obtained flanking sequence is as shown in SEQ ID NO:2 and shown in SEQ ID NO:3.

The mono- copy of transformation event KCRC04 obtained using above step is inserted into rice genome the first chromosome chr01: The position 39516775-39516790, the resistance with snout moth's larva and glyphosate, and other economical characters and ' no loadtransformer ' reference substance Kind no significant difference.Transgenic plant comprising the transformation event can go to cut weeds with the method that large area is sprayed and hybrid strain, Improve working efficiency.Such transgenic plant can prevent snout moth's larva from reducing the amount of application of pesticide to the harm of rice plant simultaneously, To guarantee the stabilization of yield, working feature is reduced, reduces pollution of the pesticide to environment.In addition, the transformation event can be used as Donor is imported in other rice plants by the methods of sexual hybridization or fixed point insertion so that other rice plants are resisted The characteristic of snout moth's larva resistance glyphosate.As long as therefore containing T-DNA segment same as KCRC04 transformation event and being inserted into same base Because the rice plant of group position belongs to protection category of the present invention.

The detection method of the anti-snout moth's larva resistance glyphosate transgenic paddy rice of embodiment 2

The Rice Genome Sequence design of external source T-DNA area's border sequence and flank according to KCRC04 transformation event is drawn Object, by PCR method specific amplification band, to detect in rice sample whether contain T- same as KCRC04 transformation event DNA fragmentation and it is inserted into the event of same genomic locations and the genotype of transformation event and content.Concrete operations are according to such as Lower step carries out.

1) extract rice leaf genomic DNA (specific method is shown in embodiment 1).

2) regular-PCR method is used, specific primer LBF1, LBR and RBR, sequence such as SEQ ID NO:4, SEQ are designed It is detected shown in ID NO:6, SEQ ID NO:7.It is 20 μ l:DNA template, 2 μ l, 10 × PCR buffer that PCR, which reacts total volume, 2 μ l, 10mM dNTP0.4 μ l, 10mM LBF1 primer, 0.8 μ l, 10mM LBR and each 0.4 μ l, Taq archaeal dna polymerase of RBR primer 0.2 μ l adds water to 20 μ l.PCR reaction condition is as follows: 1. 94 DEG C initial denaturation 4 minutes, is 2. denaturalized 0.5 minute for 94 DEG C, 3. moves back for 58 DEG C 4. fire 0.5 minute extends 0.5 minute for 72 DEG C, 5. from 2. -4. circulation 35 times, 6. extends 10 minutes for 72 DEG C, 7. 4 DEG C of preservations.PCR Product electrophoresis detection on 1% Ago-Gel, as a result as shown in Figure 6A.When carrying out PCR amplification with this specific primer, expand The material of a 448bp size banding pattern is the material of KCRC04 homozygous genotype out, expands the material of a 590bp size banding pattern For the material without KCRC04 event, expands two strip-types and size be respectively the material of 448bp and 590bp is KCRC04 heterozygosis The material of genotype.The nucleotide sequence of PCR product is as shown in SEQ ID NO:8 and SEQ ID NO:9.

3) Realtime-PCR method is used, specific primer LBF2 and LBR, sequence such as SEQ ID NO:5 and SEQ are designed It is detected shown in ID NO:6.It is 10 μ l:DNA template 0.5 μ l, 10mM LBF2 and each 0.2 μ of LBR primer that PCR, which reacts total volume, L, FastStart Universal SYBR Green Master [ROX] 5 μ l, adds water to 10 μ l.PCR reaction condition is as follows: 1. 95 DEG C initial denaturation 10 minutes, be 2. denaturalized 10 seconds for 95 DEG C, 3. 60 DEG C of annealing extend 30 seconds, 4. from 2. -3. circulation 40 times. Realtime-PCR amplification curve is as shown in Figure 6B, and amplified production is as shown in SEQ ID NO:10.The method lowest detection arrives KCRC04 Genome DNA content is 8pg, shows the detection method high sensitivity.

The foundation of KCRC04 transformation event detection method, can be confirmed whether transgenic paddy rice sample contains the transformation event And the genotype and content of transformation event.This can not only be applied to when KCRC04 transgenic paddy rice is mass produced to its turn Gene element is detected, monitored and is identified, moreover it is possible to be played in terms of target fragment tracking during crossbreeding important Effect.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.

Claims (6)

1. the nucleic acid fragment of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04, which is characterized in that the nucleic acid fragment includes sequence Arrange the T-DNA region nucleotide sequence as shown in SEQ ID NO:1；And sequence area T-DNA as shown in SEQ ID NO:3 A left side for right margin flanking sequence and sequence the T-DNA region nucleotide sequence as shown in SEQ ID NO:2 of nucleotide sequence Boundary flanking sequence.

2. for regular-PCR qualitative detection KCRC04 transformation event and the specific primer pair of genotype, comprising:

LBF1:GGAAACAGCTGCCTGGGAT；

LBR:CAGTACATTAAAAACGTCCGCAAT；

RBR:TGTGACGATCGAAAAAATACGAAT。

3. being used for the specific primer pair of Realtime-PCR quantitative detection KCRC04 transformation event, comprising:

LBF2:AGCTTAGCCAACACGGACTTG；

LBR:CAGTACATTAAAAACGTCCGCAAT。

4. the detection method of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04, which comprises the following steps:

1) total DNA of transgenic paddy rice to be measured is extracted；

2) common to carrying out using claim 2 and specific primer as claimed in claim 3 using the DNA of step 1) as template PCR or Realtime-PCR amplification；

3) pcr amplification product or Realtime-PCR amplification curve are analyzed.

5. according to the method described in claim 4, it is characterized in that, DNA profiling dosage is in 8pg or more.

6. application of the detection method described in claim 4 in the genotype for judging KCRC04 transformation event, which is characterized in that

The material of only one 448bp size banding pattern is the material of KCRC04 homozygous genotype；

The material of only one 590bp size banding pattern is the material without KCRC04 event；

Have two strip-types and size be respectively 448bp and 590bp material be KCRC04 heterozygous genotypes material.