CN105695487A

CN105695487A - Application of sucrose synthase gene in improvement of plant salt tolerance

Info

Publication number: CN105695487A
Application number: CN201410690926.8A
Authority: CN
Inventors: 戎均康; 丁明全; 陈爱群; 王敏华
Original assignee: Zhejiang A&F University ZAFU
Current assignee: Zhejiang A&F University ZAFU
Priority date: 2014-11-25
Filing date: 2014-11-25
Publication date: 2016-06-22

Abstract

The present invention discloses application of sucrose synthase (GaSuS3) gene in improvement of plant salt tolerance. In particular, the present invention relates to use of sucrose synthase (GaSuS3) or a coding gene thereof, and the use is selected from the group: (i) use for increasing the plant salt tolerance and (ii) use for improving plant peroxidase activity. The gene can be used in preparation of anti-salt and salt-tolerant transgenic plant new varieties.

Description

Sucrose synthase gene application in improving plant salt tolerance ability

Technical field

The present invention relates to the application of the exploitation of genetically engineered plants and salt tolerant thereof, in particular it relates to the preparation method of the expression vector of cotton sucrose synthase gene and salt tolerant transgenic plant and salt tolerant purposes thereof。

Background technology

Salt stress is the key factor affecting growth and development of plants, and plant is produced to coerce harm by it by the approach such as osmotic pressure, Ion toxicity。Under salt stress environment, all can there is a series of physicochemical change from physiological metabolism to overall growth promoter in plant, as photosynthesis, Repiration etc. all can be influenced to different extents。The approach causing salt stress specifically include that one be in soil salt concentration too high cause soil water potential decline and osmotic pressure raise, this causes that plant root moisture reduces and affects plant growth rate；Two is that sodium ion in soil pours in plant cell, and plant cell too much will certainly be caused Ion toxicity effect by sodium ion accumulation, and affects the absorption of other indispensable elements, thus affecting the growth promoter of plant further。The salt stress response of plant belongs to the complex character of polygenes regulation and control, and its biochemical reactions is gene interaction, the common result regulated。

Therefore, how all sidedly, understand plant salt tolerance gene in depth, grasp Mechanism of Salt-tolerant, improve the ability of plant resistant salt stress；How reasonable development and to utilize salinization soil resource be problem demanding prompt solution。

Summary of the invention

Present invention finds a kind of sucrose synthase gene (GaSuS3) that can improve plant salt tolerance ability。

In first aspect present invention, it is provided that the purposes of a kind of sucrose synthase (GaSuS3) or its encoding gene, described purposes is selected from lower group:

I () is for improving the salt resistance ability of plant；

(ii) for improving the peroxidase activity of plant。

In another preference, described plant includes Malvaceae, Cruciferae, grass family, pulse family, Pedaliaceae, Compositae, Chenopodiaceae, Theaceae, Rubiaceae, Sterculiaceae, Solanaceae, Araliaceae, Polyporaceae, Liliaceae, Fagaceae, Palmae, Agavaceae。

In another preference, described plant includes: arabidopsis (Arabidopsisthaliana), Cotton Gossypii, Semen Tritici aestivi, Oryza sativa L., Semen Maydis, Herba bromi japonici, rye (Secale cereale L.), Fructus Hordei Vulgaris, foxtail millet, Sorghum vulgare Pers., Semen avenae nudae, crudefiber crop, Semen arachidis hypogaeae, Brassica campestris L, Semen Sesami, Semen sojae atricolor, Helianthi, Radix Betae, Caulis Sacchari sinensis, Folium Camelliae sinensis, coffee bean, cocoa, Nicotiana tabacum L., Radix Ginseng, Ganoderma, Bulbus Fritillariae Uninbracteatae, rubber, Cortex cocois radicis, Elaeis guineensis Jacq. and Folium Agaves Sisalanae。

In another preference, the Genebank accession number of described GaSuS3 gene: JQ995524。

In another preference, the aminoacid sequence of described GaSuS3 is selected from lower group:

I () has the albumen of aminoacid sequence shown in SEQIDNO.:6；

(ii) the such as aminoacid sequence shown in SEQIDNO.:6 is formed through the replacement of one or several amino acid residue, disappearance or interpolation, there is the albumen derivative by (i) of the peroxidase activity improving plant salt tolerance ability or raising plant；Or

(iii) aminoacid sequence and homology >=95% (preferably >=98%) of aminoacid sequence shown in SEQIDNO.:6, have the albumen of the peroxidase activity improving plant salt tolerance ability or raising plant。

In another preference, the encoding gene of described sucrose synthase is optionally from lower group:

(A) coding polynucleotide of polypeptide as shown in SEQIDNO.:6；

(B) the sequence such as polynucleotide shown in SEQIDNO.:5；

(C) polynucleotide of homology >=95% (preferably >=98%) of sequence shown in nucleotide sequence and SEQIDNO.:5；

(D) 5 ' ends and/or 3 ' of polynucleotide as shown in SEQIDNO.:5 are held truncates or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) nucleotide；

(E) polynucleotide that described polynucleotide arbitrary with (A)-(D) are complementary。

In another preference, it is shown that sucrose synthase derive from Cotton Gossypii。

Second aspect present invention, it is provided that a kind of method of peroxidase activity improving plant salt tolerance ability and/or raising plant, including step:

A) will promote or antagonism GaSuS3 gene or the activity of its albumen and/or the material of expression give plant, plant seed, plant cell, tissue or organ；With

B) plant, plant seed, plant cell, tissue or the organ that incubation step a) obtains。

In another preference, described activity and/or the expression promoting GASUS3 gene or its albumen refers to compared with the control, and the expression of GASUS3 gene or its albumen raises or process LAN, and/or the protein variant that expression activity is higher；Activity and/or the expression of described antagonism GASUS3 gene or its albumen refer to compared with the control, and the expression of GASUS3 gene or its albumen reduces or do not express, and/or expression activity reduces or inactive GASUS3 albumen。

In another preference, described promotion GASUS3 gene or the activity of its albumen and/or the material of expression include GASUS3 gene itself。

In another preference, described suppression GASUS3 gene or the activity of its albumen and/or the material of expression include: the antisense RNA of GASUS3 gene or the antibody of GASUS3 albumen。

Another preferred embodiment in, the polynucleotide of coding GASUS3 albumen are proceeded to plant, plant seed, plant cell, tissue or organ by described step a), it is thus achieved that be transformed into the coding plant of polynucleotide of GASUS3 albumen, plant seed, plant cell, tissue or organ。

In another preference, the Agrobacterium (Agrobacteriumtumefaciens) of plant, plant seed, plant cell, tissue or organ with the polynucleotide carried containing coding GASUS3 albumen is contacted by step a), so that the polynucleotide of coding GASUS3 albumen proceed to plant cell, and it is incorporated on the chromosome of plant cell。

Third aspect present invention, it is provided that a kind of expression vector, described expression vector contains the nucleotide sequence expressing GASUS3。

In another preference, described is expressed as constitutive expression。

Fourth aspect present invention, it is provided that a kind of plant callus or plant cell, described plant callus or plant cell contain the carrier described in third aspect present invention, or the chromosomal integration of described plant cell has the nucleotide sequence of GASUS3。

Fifth aspect present invention, it is provided that the nucleotide sequence of described GASUS3 includes GASUS3 full length gene or the cDNA of coding GASUS3 albumen。

Sixth aspect present invention, it is provided that the purposes of plant callus described in fourth aspect present invention or plant cell, for preparing the transgenic plant with salt tolerant activity。

Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus constituting new or preferred technical scheme。As space is limited, tired no longer one by one state at this。

Accompanying drawing explanation

Fig. 1 shows the Agrobacterium bacterium solution PCR gel electrophoresis figure detected。M represents Marker5000；1 represents positive control；2 represent negative control；3-5 represents different Agrobacterium colonies。

Fig. 2 shows the transfer-gen plant purpose fragment primer PCR Gel electrophoresis results detected。M represents Marker5000；1 represents wildtype Arabidopsis thaliana；2-6 represents transgenic arabidopsis；7 represent positive plasmid。

Fig. 3 shows the RT-PCR expression analysis result of transgenic arabidopsis。AtGAPC is arabidopsis glyceraldehyde phosphate dehydrogenase gene, as internal reference；Gene for the purpose of GaSuS3。

Fig. 4 shows wild type and the statistical result of transgenic arabidopsis seed germination rate。WT: wild type；L5, L9, L10: transgenic arabidopsis；In each cylindricality, capitalization difference represents difference extremely notable (P < 0.01)。

Fig. 5 shows wild type and transgenic arabidopsis root length measurement result。WT: wild type；L5, L9, L10: transgenic arabidopsis；In each cylindricality, capitalization difference represents difference extremely notable (P < 0.01)。

Fig. 6 shows transgenic Arabidopsis plants growing way result。A represents matched group；B represents NaCl and coerces group；C represents NaCl and coerces group individual plant；1 represents wild type；2-4 represents transgenic arabidopsis。

Fig. 7 shows the result figure of 4 weeks transgenic Arabidopsis plants of 100mmol/LNaCl salt stress。1 represents comparison；2 represent 100mmol/LNaCl salt stress processes；A represents wildtype Arabidopsis thaliana；B represents transgenic arabidopsis。Arrow show wild-type inflorescences and wilts。

Fig. 8 shows the result figure of 200mmol/LNaCl salt stress transgenic Arabidopsis plants after 2 weeks。A represents matched group；B represents NaCl process group；1 represents wild type；2 represent transgenic arabidopsis。

After Fig. 9 shows that salt stress processes, and transgenic arabidopsis peroxidase activity ascensional range relatively wild type is higher。

Detailed description of the invention

The present inventor, through extensive and deep research, is unexpectedly found that sucrose synthase (SuS3) gene first in Cotton Gossypii, makes this gene by process LAN in arabidopsis, it is possible to make the resistance to salt stress ability of arabidopsis significantly improve。Therefore, this gene can be applied to prepare the transgenic plant new varieties of anti-salt, salt tolerant。On this basis, the present invention is completed。

Term

As used herein, term " gene of the present invention ", " GASUS3 gene ", " the raising peroxidase activity gene of the present invention ", " salt-resistant related gene of the present invention " can exchange use, all referring to the sucrose synthase gene and the variant thereof that derive from plant (preferably from Cotton Gossypii or similar plants)。A kind of typical nucleotide sequence of the gene of the present invention is such as shown in SEQIDNO.:5。

As used herein, term " albumen of the present invention ", " GASUS3 enzyme ", " the raising peroxidase activity albumen of the present invention ", " protein related to salt tolerance of the present invention " can exchange use, all referring to the sucrose synthase gene and the variant thereof that derive from plant (preferably from Cotton Gossypii or similar plants)。A kind of typical aminoacid sequence of polypeptide of the present invention is such as shown in SEQIDNO.:6。

As used herein, term " plant " has no particular limits, and includes, but is not limited to: flower plant, fruit plant, forestry plant, vegetable, crops etc., for instance Oryza sativa L., Semen Tritici aestivi, corn and soybean, Sorghum vulgare Pers. etc.。

Described plant includes Cruciferae, grass family, pulse family, Pedaliaceae, Compositae, Chenopodiaceae, Theaceae, Rubiaceae, Sterculiaceae, Solanaceae, Araliaceae, Polyporaceae, Liliaceae, Fagaceae, Palmae, Agavaceae。

The invention provides a kind of gene relevant to plant salt endurance, described gene is the GASUS3 gene of the encoding sucrose synzyme deriving from diploid Asiatic cotton (Gossypiumarboreumacc.A2-47) or its variant。A kind of preferred full length gene CDS nucleotide sequence is such as shown in SEQIDNO.:5。The gene of the present invention can effectively maintain raising plant survival ability under salt stress, improves crop yield, it is to avoid or reduce the adverse effect that plant is produced by high salt。Therefore the gene of the present invention may be used for specificity and improves the salt resistant character of plant。

Present invention additionally comprises the preferred nucleotide sequence with the present invention (SEQIDNO.:5) and have 50% or above (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, it is most preferred that more than 98%, such as 99%) nucleic acid of homology, described nucleic acid also can be effectively improved plant survival ability under salt stress and the peroxidase activity in this plant。" homology " refers to the percentage ratio identical according to position, the similar level (i.e. sequence similarity or homogeneity) between two or more pieces nucleic acid。In this article, the variant of described gene can pass through to insert or delete regulation and control region, carries out random or rite-directed mutagenesis etc. and obtains。

In the present invention, nucleotide sequence in SEQIDNO.:5 can pass through replacement, lacks or add one or more, generate the derived sequence of SEQIDNO.:5, simple well due to codon, even if relatively low with the homology of SEQIDNO.:5, also basic coding the aminoacid sequence as shown in SEQIDNO.:6 can be gone out。Additionally, the implication of " nucleotide sequence in SEQIDNO.:5 is through replacing, lacking or add at least one nucleotide derived sequence " also include can under moderate stringency conditions, more preferably under high stringent condition with the nucleotide sequence of the nucleotide sequence hybridization of SEQIDNO.:5。These variant forms include (but and little be limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance of nucleotide, insertion and/or replacement, and add at 5 ' and/or 3 ' ends and several (to be generally within 60, it is preferably within 30, is more preferably within 10, within being 5 best) nucleotide。

It should be understood that, although the gene source provided in the example of the present invention is in Cotton Gossypii, but be derived from other similar plant (especially belonging to the plant of same section or genus with Cotton Gossypii) and the present invention's sequence is (preferably, sequence is such as shown in SEQIDNO.:5) there is the sucrose synthase gene sequence of certain homology (conservative), the information that those skilled in the art provide according to the application after having read the application it is intended to be included within the scope of the present invention, as long as can separate easily from other plant obtains this sequence。

The invention provides a vegetable salt resistant protein and variant thereof, in a preference of the present invention, the aminoacid sequence of described polypeptide is such as shown in SEQIDNO.:6。The polypeptide of the present invention can be effectively improved plant survival ability under salt stress, improves plant peroxidases activity, improves crop yield, it is to avoid or effectively reduce the adverse effect that plant is produced by high salt。

Present invention additionally comprises and have 50% or above (preferably more than 60% with sequence shown in the SEQIDNO.:6 of the present invention, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, such as 99%) polypeptide with same or similar function of homology or albumen。

Described " same or similar function " refers to: " improve plant salt tolerance ability or improve the peroxidase activity of plant "。

In the present invention, described protein variant is the aminoacid sequence as shown in SEQIDNO.:6, (it is generally 1-60 through several, preferably 1-30, more preferably 1-20,1-10 best) replace, lack or add the derived sequence of at least one aminoacid gained, and add one or several at C-terminal and/or N-terminal and (be generally within 20, it is preferably within 10, is more preferably within 5) aminoacid。Such as, in described albumen, when replacing with similar nature or similar aminoacid, the function of typically not change protein, C-terminal and/or end add one or several aminoacid and generally also will not change the function of protein。These conservative variation are replaced preferably based on table 1 and produce。

Table 1

Present invention additionally comprises the analog of albumen required for protection。These analog and natural SEQIDNO.:6 difference can be the difference on aminoacid sequence, it is also possible to be do not affect the difference on the modified forms of sequence, or have both at the same time。The analog of these albumen includes natural or induction genetic variant。Induction variant can be obtained by various technology, as produced random mutagenesis by radiating or be exposed to mutagenic agent, also by site-directed mutagenesis or other known divided biological technology。Analog also includes the analog with the residue (such as D-aminoacid) being different from natural L-amino acids, and there is non-naturally-occurring or the analog of aminoacid (such as β, gamma-amino acid) of synthesis。Should be understood that the albumen of the present invention is not limited to the above-mentioned representational albumen enumerated。

(generally the not changing primary structure) form of modification includes: the chemically derived form such as acetoxylation or carboxylated of inner or in vitro albumen。Modify and also include glycosylation, as those carry out glycosylation modified in protein synthesis and processing。This modification can carry out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and complete by being exposed to by albumen。Modified forms also includes the sequence with phosphorylated amino acid residue (such as phosphotyrosine, phosphoserine, phosphothreonine)。

Present invention also offers the recombinant vector of a kind of gene including the present invention。As the preferred mode of one, the promoter downstream of recombinant vector comprises multiple clone site or at least one restriction enzyme site。When the object of the invention gene expressed by needs, genes of interest is connected in applicable multiple clone site or restriction enzyme site, thus genes of interest is operably connected with promoter。As another kind of optimal way, described recombinant vector includes (from 5 ' to 3 ' direction): promoter, genes of interest, and terminator。If it is required, described recombinant vector can also include the element being selected from lower group: 3 ' polymerized nucleoside acidifying signals；Untranslated nucleotide sequence；Transhipment and targeting nucleotide sequence；Resistance selective marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.)；Enhancer；Or operator。

It is well known to those of ordinary skill in the art for preparing the method for recombinant vector。Expression vector can be bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers。In a word, as long as it can replicate and stable in host, any plasmid and carrier are all can be adopted。In the example of the present invention, described recombinant vector is binary vector pBI121。

Those of ordinary skill in the art can use the method known to build the expression vector containing gene of the present invention。These methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.。When using the gene constructed recombinant expression carrier of the present invention, any enhancement mode, composing type, organizing specific type or inducible promoter can be added before its transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin (Ubiquitin) gene promoter (pUbi) etc., they can be used alone or be combined use with other promoter。

Including gene of the present invention, expression cassette or carrier may be used for converting suitable host cell so that host expresses protein。Host cell can be prokaryotic cell, such as escherichia coli, and streptomyces, Agrobacterium: or the eukaryotic cell such as low, such as yeast cells；Or higher eucaryotic cells, such as plant cell。Persons skilled in the art are all clear how to select suitable carrier and host cell。Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell。When host is prokaryote (such as escherichia coli), it is possible to use CaCl₂Method processes, it is also possible to electroporation carries out。When host is eukaryote, can be selected for following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging etc.)。Convert plant and be used as the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, for instance leaf disk method, rataria conversion method, bud infusion method etc.。Conventional method regeneration plant can be used, thus obtaining the plant of transgenic for the plant cell converted, tissue or organ。

A kind of optimal way as the present invention, the method preparing transgenic plant is: the carrier carrying promoter and genes of interest (both are operably connected) is proceeded to Agrobacterium, and the carrier segments containing promoter and genes of interest is incorporated on the chromosome of plant by Agrobacterium again。The transgene receptor plant related to is such as arabidopsis, Nicotiana tabacum L., fruit tree etc.。

For the ease of transgenic plant cells or plant being identified and screening, plant expression vector used can be processed, express, as being added in plant, enzyme or the gene (gus gene, GFP gene, luciferase genes etc.) of luminophor, the antibiotic marker thing (gentamycin label, kanamycin label etc.) with resistance or anti-chemical reagent marker gene (such as anti-herbicide gene) etc. that color change can be produced。From the security consideration of transgenic plant, any selected marker can be not added with, directly screen transformed plant with adverse circumstance。

The method have the benefit that

1) technical scheme is more excellent: drive cotton sucrose synthase gene GaSuS3 to express in transgenic arabidopsis by the strong promoter of CaMV35S constitutive expression, it is thus achieved that to have the arabidopsis transfer-gen plant of notable resistance to salt stress ability。

2) realize better effects if: technology maturation, easy and simple to handle efficiently；Significantly improve the anti-salt of plant, Salt-endurance；

3) decrease fertilizer and pesticide to use, utilize protection ring border and the utilization of resources。

Embodiment 1. builds the construction method of the expression vector of CaMV35S promoters driven GaSuS3 gene

(1) amplification of GaSuS3 coded sequence: with Asiatic cotton (Gossypiumarboreumacc.A2-47) leaf cDNA for template; utilizing SuS3F1 and SuS3R1 to expand for primer PCR, PCR primer 5 ' and 3 ' two ends are respectively provided with BamHI and SacI restriction enzyme site and 3 protection bases。PCR primer, after gel-purified, takes 4ul purified product and is connected with 1ulpEasy-Blunt cloning vehicle (purchased from Beijing Transgene company), and 25 DEG C connect and convert competent escherichia coli cell after 15 minutes。SuS3F1 and SuS3R1 primer sequence is as follows, wherein underlined sequences respectively BamHI and SacI restriction enzyme enzyme action recognition sequence:

SuS3F1:5'gcgggatccatggctgatcgtgtgatcact3'(SEQIDNO.:1)

SuS3R1:5'ggcGAGCTCttactcctctgccaatggaact3'(SEQIDNO.:2)

(2) colibacillary conversion: adopt conventional heat shock method to convert bacillus coli DH 5 alpha competent cell, positive colony order-checking (is provided order-checking service by Jin Sirui company)。The correct clone that checks order extracts plasmid and cuts the GaSuS3 coding sequence fragment containing BamHI and SacI sticky end with BamHI and SacI double digestion (purchased from Dalian Takara company) from pEasy-Blunt carrier (purchased from Beijing Transgene company)。Binary expression vector pBI121 BamHI and SacI double digestion being removed gus reporter gene, linearizing digestion products is connected with GaSuS3 coded sequence by T4DNA ligase (purchased from Takara company) after reclaiming simultaneously。Coupled reaction system is 10ul: wherein linearizing pBI121 carrier sequence 2ul, GaSuS3 coded sequence 6ul, T4DNA ligase and each 1ul of 10XBuffer。Product after connecting 8 hours converts bacillus coli DH 5 alpha competent cell through heat shock method。Positive colony extracts plasmid, recombiant plasmid called after pBI-SuS3 after sequence verification is correct。The method that clicked on by recombiant plasmid pBI121 and pBI-SuS3 converts Agrobacterium strain EHA105 (being provided by Zhejiang A & F University)。By said method, complete the structure of the expression vector of CaMV35S promoters driven GaSuS3 gene。

Concrete outcome is shown in Fig. 1。Fig. 1 is the gel electrophoresis figure of Agrobacterium bacterium solution PCR detection。M represents Marker5000；1 represents positive control；2 represent negative control；3-5 represents different Agrobacterium colonies。As can be seen from Figure 1, after recombinant plasmid transformed Agrobacterium EHA105, picking monoclonal carries out bacterium solution PCR detection, there is purpose fragment in 1% sepharose electrophoresis detection, the success of explanation Agrobacterium-mediated Transformation, extraction positive colony plasmid enzyme restriction, sequence verification are errorless, and namely Agrobacterium bacterium solution can be used for the conversion of next step transgenic plant。

The preparation of embodiment 2. transfer-gen plant

Agrobacterium characteristic is utilized to carry out the genetic transformation of arabidopsis by arabidopsis inflorescence dip method。Gather in the crops the seed of arabidopsis after infecting, screen through Kan resistance Selective agar medium, after molecular Biological Detection and selfing purification, obtain T3 for plant for subsequent experimental。

The plantation of 2.1 arabidopsiss

1) take and be only paved with arabidopsis seed sterilized water bottom 1.5ml centrifuge tube and wash once, of short duration centrifugal after discard sterilized water；

2) adding the alcoholic solution of 75% in centrifuge tube, reverse mixing sterilizing 90s, with aseptic water washing 3 times, then with 2% liquor natrii hypochloritis sterilizing 10min, with aseptic water washing 4 times；

3) by the seed uniform spreading after sterilizing on MS solid medium, suck dry moisture sealed membrane is sealed, after 4 DEG C of lucifuge vernalization 3d, be placed in culturing room (20 DEG C, 16h illumination/8h dark, average intensity of illumination is 4000lx) cultivate；

4) select healthy and strong seedling replanting after 14 days in culturing pot。Culture matrix is according to Nutrition Soil: the ratio mixing of organic (3:1), 121 DEG C of autoclaving 20min, waters permeable after cooling in loading small flower；

5) arabidopsis covers preservative film after transplanting, and throws off overlay film after arabidopsis restoration ecosystem, and normal condition cultivates (20 DEG C, 16h illumination/8h is dark, and average intensity of illumination is 4000lx)。

The preparation of 2.2 arabidopsiss

When arabidopsis starts bolting, cut its nascent inflorescence, promote the more secondary inflorescence of its eruption。Convert when the existing flower opened on a small quantity and a large amount of petal in secondary inflorescence after one week。The angle fruit grown up to should be cut off before conversion, and water permeable evening before that day in converting。

The preparation of 2.3 Agrobacteriums

1) by Agrobacterium bacterium solution, it is inoculated in the 6ml LB fluid medium containing Kan (50mg L-1) and Rif (50mg L-1), 200rpm, 28 DEG C of shaken cultivation 24-36h；

2) drawing 1ml Agrobacterium bacterium solution and be inoculated in 50ml containing in corresponding antibiotic LB fluid medium, 28 DEG C of concussions are cultured to about OD600=0.6-0.8；

3) the centrifugal 10min of 4000rpm collects thalline, and with the freshly prepared resuspended Agrobacterium of 1/4MS solution containing 6% sucrose of equal-volume, adjusting OD600 is about 0.8。

2.4 inflorescences infect arabidopsis thaliana transformation

1) in agrobacterium suspension, add SilwetL-77 to final concentration of 0.02%, mix immediately；

2) conversion is infiltrated liquid and be placed in plate, make arabidopsis inflorescence be soaked in about 1min in infiltration liquid, along with the increase of bacterium solution access times, suitably increase infiltrating time, every kind of Agrobacterium-mediated Transformation 6 basin；

3) by the plant traverse that converted in clean vinyl disc, sealing with preservative film, lucifuge is thrown off overlay film after processing 1-2 days and is normally cultivated；

4) repeat after one week to convert once；

5) after arabidopsis is solid, seed is collected。

The screening of embodiment 3. transfer-gen plant and qualification

The screening of 3.1 transfer-gen plants

After being infected by Agrobacterium, the arabidopsis seed of results is after 75% alcoholic solution and 2% liquor natrii hypochloritis's sterilizing, is laid in the MS culture medium containing Kan (50mg L-1)。Transgenic Arabidopsis plants can on resistance culture base normal growth, after nontransgenic plants can not be sprouted or emerge, albefaction is dead。After 14 days, the healthy and strong transgenic seedlings of choosing is transplanted in culturing pot, and overlay film is placed in culturing room and continues to cultivate (20 DEG C, 16h illumination/8h is dark, and average intensity of illumination is 4000lx), throw off overlay film normal management after arabidopsis restoration ecosystem。

3.2 transgenic arabidopsis Molecular Identification

3.2.1, before the Arabidopsis thaliana Seedlings bolting filtered out on Kan resistance culture base, it is stored in-80 DEG C after clip blade liquid nitrogen flash freezer, for the extraction of arabidopsis DNA and RNA。Detected by the PCR of purpose fragment-specific primer, it is determined that whether Cotton Gossypii GaSuS3 gene has successfully been incorporated in arabidopsis gene group。The primer sequence is:

SuS3F2:CCTTCTTGCTCACAGGAAC(SEQIDNO.:3)

SuS3R2:ATTTTGAAAGAGTTGGGCGG(SEQIDNO.:4)

Concrete outcome is shown in Fig. 2。Fig. 2 is the Gel electrophoresis results of transfer-gen plant purpose fragment primer PCR detection。M represents Marker5000；1 represents wildtype Arabidopsis thaliana；2-6 represents transgenic arabidopsis；7 represent positive plasmid。As can be seen from Figure 2, the seedling replanting obtained by resistance culture base primary dcreening operation continues to be trained Seedling in culturing pot, clip Arabidopsis leaf extracts genomic DNA, PCR detection is carried out with purpose fragment primer, there is purpose band in 1% sepharose electrophoresis, it was shown that GaSuS3 gene has successfully been incorporated in arabidopsis gene group。

3.2.2 extracting PCR further and detect positive plant RNA, utilize RT-PCR method, design primer carries out expressing checking, with determine the gene proceeded to can in arabidopsis normal expression。The primer sequence is such as shown in SEQIDNO.:3-4。

Concrete operation step includes:

Transfer-gen plant organization material is fully ground through liquid nitrogen, the total serum IgE of plant after using Trizol reagent (Invitrogen company) extraction to convert。Carrying out reverse transcription reaction by the RNA extracted and prepare cDNA sample. the reaction system of reverse transcription includes 2 μ L5 × AMV buffer buffer, 1 μ LdNTP mixture (concentration of every kind of composition is 10mM, Takara company), 0.5 μ LAMV (Takara company), 2 μ LRNA (1 μ g/ μ L) and 0.5 μ LmicroRNA specific reverse primers mixture。

Cumulative volume is that 10 μ L, reactions steps are 16 DEG C and hatch 30 minutes, and 42 DEG C are reacted 30 minutes, hatch 5 minutes for 85 DEG C。

Concrete outcome is shown in Fig. 3。Fig. 3 is the RT-PCR expression analysis result of transgenic arabidopsis。AtGAPC is arabidopsis glyceraldehyde phosphate dehydrogenase gene, as internal reference；Gene for the purpose of GaSuS3。From figure 3, it can be seen that result display Ga-Sus3 gene can in arabidopsis normal expression。Subsequent physiological experiment is may be used for after the positive plant selfing purification screened。

The Salt Tolerance Analysis of embodiment 4. transgenic plant

Under 4.1 salt stresses, the germination rate of transfer-gen plant is better than wild type

By the wild type after sterilizing and transgenic arabidopsis planting seed in the MS culture medium not adding and adding 100mmol L-1NaCl。Proceed to after 4 DEG C of dark vernalization 3d and cultivate under normal condition (19-21 DEG C, 16h illumination/8h is dark)。Choose 3 repetitions after cultivating 7d, often repeat about 100 seeds, the sprouting situation of statistics arabidopsis。

Concrete outcome is shown in Fig. 4。Fig. 4 is wild type and the statistical result of transgenic arabidopsis seed germination rate。WT: wild type；L5, L9, L10: transgenic arabidopsis；In each cylindricality, capitalization difference represents difference extremely notable (P < 0.01)。

From fig. 4, it can be seen that under same culture conditions, do not contain on the flat board of NaCl, the seed germination rate of transgenic arabidopsis and wild type does not have notable difference；On the flat board containing 100mmol L-1NaCl, there is pole significant difference in the germination rate of transgenic arabidopsis and wild type。Wildtype Arabidopsis thaliana growth is subject to strong suppression, and germination rate is decreased obviously, and decreases by 20%。Though and transgenic arabidopsis is also affected by certain suppression, but sprouting state is substantially better than wild type, still 92% can be reached。Result shows, proceeding to of GaSuS3 gene, improves arabidopsis and resists the ability of salt stress。

Under 4.2 salt stresses, the main root length of transfer-gen plant is better than wild type

After arabidopsis Seed sterilization, it is seeded in blank and the MS culture medium containing 100mmol L-1NaCl, normally cultivates after vernalization。After upright cultivation 2 weeks, choose 3 repetitions, often repeat 30 strain seedling, carry out measurement and the record of main root length。

Concrete outcome is shown in Fig. 5。Fig. 5 is wild type and transgenic arabidopsis root length measurement result。WT: wild type；L5, L9, L10: transgenic arabidopsis；In each cylindricality, capitalization difference represents difference extremely notable (P < 0.01)。

From fig. 5, it can be seen that after growing 2 weeks in MS culture medium, the arabidopsis main root length turning GaSuS3 gene is shorter than wild type。When growing into the 14th day, the average root of transgenic arabidopsis is about 4.5cm, and the average root length of wild type can reach 5.6cm。After adding 100mmol L-1NaCl in culture medium, wild type root length is decreased obviously, and average is only 2.2cm, decreases by 4.4cm。And transgenic arabidopsis root length average is 3.4cm, the range of decrease is 1.9cm, relatively the long 1.2cm of wild type, shows the toleration that salt stress is stronger。

Under 4.3 salt stresses, the overground part of transfer-gen plant is grown and is better than wild type

After arabidopsis Seed sterilization, it is seeded in blank and the MS culture medium containing 100mmol L-1NaCl, normally cultivates after vernalization。After level cultivates 3 weeks, choose 3 repetitions, often repeat 30 strain seedling, observation plant forms Taking Pictures recording。

Concrete outcome is shown in Fig. 6。Fig. 6 is transgenic Arabidopsis plants growing way result。A represents matched group；B represents NaCl and coerces group；C represents NaCl and coerces group individual plant；1 represents wild type；2-4 represents transgenic arabidopsis。

In MS culture medium, wild type and transgenic arabidopsis overground part upgrowth situation are basically identical, the Arabidopsis thaliana Seedlings color grown emerald green, healthy sturdy (Fig. 6 A1-4)；And containing in 100mmol L-1NaCl culture medium, the aerial parts of wildtype Arabidopsis thaliana is grown and is markedly less than transgenic arabidopsis。After coercing and growing 3 weeks in culture medium, wildtype Arabidopsis thaliana still only has 2 pairs of blades and button in leaf margin, and blade is little and color depth, and vitrification phenomenon is obvious, and plant is overall thin and weak short and small, and growth promoter is seriously obstructed (Fig. 6 B1-4, C1-4)。Under same culture conditions, transgenic arabidopsis then shows well adapting to property, and plant is relatively big, normal differentiation can go out 3-5 to blade, and blade is big and color is emerald green, leaf margin is open and flat。Showing that the impact that transgenic arabidopsis is caused by salt stress is significantly less than wild type, transgenic arabidopsis has better salt resistance ability。

Under 4.4 pouring salt treatment, the tolerance of transfer-gen plant is better than wild type

Arabidopsis Seed sterilization is laid in MS culture medium, normally cultivates after vernalization after processing。The healthy and strong seedling replanting of choosing (Nutrition Soil: organic matter=3:1) in culturing pot after 14d, overlay film is placed in culturing room and continues to cultivate (19-21 DEG C, 16h illumination/8h is dark), throw off overlay film after arabidopsis restoration ecosystem。Choose the 1 monthly age Arabidopsis plant that growing way is consistent, water analog salt Stress treatment with 100 and 200mmol/LNaCl solution respectively, matched group pouring clear water。Observation Taking Pictures recording Arabidopsis plant upgrowth situation。

Concrete outcome is shown in Fig. 7 and Fig. 8。Fig. 7 is the result figure of 4 weeks transgenic Arabidopsis plants of 100mmol/LNaCl salt stress。1 represents comparison；2 represent 100mmol/LNaCl salt stress processes；A represents wildtype Arabidopsis thaliana；B represents transgenic arabidopsis。Arrow show wild-type inflorescences and wilts。

From figure 7 it can be seen that transgenic arabidopsis and wildtype Arabidopsis thaliana do not have notable difference under normal management。The Arabidopsis thaliana Seedlings at 1 monthly age being carried out after 100mmol/LNaCl solution pouring analog salt coerces 4 weeks, wild-type Arabidopsis plants occurs substantially to wilt, and plant entirety lodges, and inflorescence is sagging, leaves water loss。And transgenic arabidopsis growth conditions is good, inflorescence is straight and upright, and blade is open and flat, wilting phenomenon does not occur, well-grown。

Fig. 8 is the result figure of 200mmol/LNaCl salt stress transgenic Arabidopsis plants after 2 weeks。A represents matched group；B represents NaCl process group；1 represents wild type；2 represent transgenic arabidopsis。

From figure 8, it is seen that after watering Arabidopsis thaliana Seedlings 2 weeks with 200mmol/LNaCl solution, wild type yellow is dead, transgenic arabidopsis then still has certain green blade, it is possible to maintain plant strain growth。

These results are all the direct results that process LAN Cotton Gossypii GaSuS3 gene raising arabidopsis resists salt stress ability。

The peroxidase activity analysis of embodiment 5. transgenic plant

Measure the catalase activity of 200mmol L-1NaCl 3d Arabidopsis thaliana Seedlings before and after treatment respectively, before result is shown in process, transgenic arabidopsis catalase activity level maintains 1600U g-1 (FW), wild type is then only 1250U g-1 (FW), illustrates that the catalase activity level of transgenic arabidopsis before treatment is apparently higher than wild type。After salt stress processes, wildtype Arabidopsis thaliana peroxidase activity is increased to about 1850U g-1 (FW), and transgenic arabidopsis is 2450U g-1 (FW), ascensional range is slightly higher compared with wild type, is still kept above the catalase activity (Fig. 9) of wild type。

Result shows, namely transgenic arabidopsis has higher catalase activity under normal growing conditions, coercing rear ascensional range also above wild type, illustrate that turning GaSus3 gene improves the ability of arabidopsis Oxidative Stress, this is probably a kind of performance that transgenic arabidopsis salt tolerance strengthens。

The all documents mentioned in the present invention are incorporated as reference all in this application, are individually recited as reference such just as each section of document。In addition, it is to be understood that after the above-mentioned teachings having read the present invention, the present invention can be made various changes or modifications by those skilled in the art, these equivalent form of values fall within the application appended claims limited range equally。

Claims

1. the purposes of sucrose synthase (GaSuS3) or its encoding gene, it is characterised in that described purposes is selected from lower group:

I () is for improving the salt resistance ability of plant；

(ii) for improving the peroxidase activity of plant。

2. purposes as claimed in claim 1, it is characterised in that the aminoacid sequence of described GaSuS3 is selected from lower group:

I () has the albumen of aminoacid sequence shown in SEQIDNO.:6；

3. purposes as claimed in claim 1, it is characterised in that the encoding gene of described sucrose synthase is optionally from lower group:

(A) coding polynucleotide of polypeptide as shown in SEQIDNO.:6；

(B) the sequence such as polynucleotide shown in SEQIDNO.:5；

4. purposes as claimed in claim 1, it is characterised in that shown sucrose synthase derives from Cotton Gossypii。

5. the method for the peroxidase activity improving plant salt tolerance ability and/or raising plant, it is characterised in that include step:

6. method as claimed in claim 5, it is characterised in that described promotion GASUS3 gene or the activity of its albumen and/or the material of expression include GASUS3 gene itself。

7. an expression vector, it is characterised in that described expression vector contains the nucleotide sequence expressing GASUS3。

8. a plant callus or plant cell, it is characterised in that described plant callus or plant cell contain the carrier described in claim 7, or the chromosomal integration of described plant cell has the nucleotide sequence of GASUS3。

9. plant callus as claimed in claim 8 or plant cell, it is characterised in that the nucleotide sequence of described GASUS3 includes GASUS3 full length gene or the cDNA of coding GASUS3 albumen。

10. the purposes of plant callus described in claim 8 or plant cell, it is characterised in that for preparing the transgenic plant with salt tolerant activity。