CN105671047B - A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability - Google Patents
A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability Download PDFInfo
- Publication number
- CN105671047B CN105671047B CN201610121816.9A CN201610121816A CN105671047B CN 105671047 B CN105671047 B CN 105671047B CN 201610121816 A CN201610121816 A CN 201610121816A CN 105671047 B CN105671047 B CN 105671047B
- Authority
- CN
- China
- Prior art keywords
- wheat
- plant
- mirna
- sequence
- dna molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8267—Seed dormancy, germination or sprouting
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A kind of application the invention discloses miRNA and its in regulation and control wheat seeds sprouting speed and Spike sprouting ability.The present invention provides miRNA wz, as shown in the sequence 3 of sequence table.The present invention also protects the precursor of miRNA wz, as shown in the sequence 4 of sequence table.The DNA molecular of coding miRNA wz and the DNA molecular for encoding the miRNA wz precursors also belong to protection scope of the present invention.The present invention also protects the application of miRNA wz, the miRNA wz precursors or any description above DNA molecular, for following (c1), (c2), (c3) or (c4)：(c1) regulate and control plant Spike sprouting ability；(c2) regulate and control plant seed germination speed；(c3) plant Spike sprouting ability is reduced；(c4) plant seed germination speed is reduced.The present invention is to improve wheat anti growing out ability, reduces influence of the Spike sprouting to Wheat Production and provides technical support.
Description
Technical field
A kind of application the present invention relates to miRNA and its in regulation and control wheat seeds sprouting speed and Spike sprouting ability.
Background technology
MicroRNA abbreviations miRNA (microRNA) is the loop-stem structure precursor formed by non-protein encoding gene transcript,
The small RNA molecular that the length formed after shearing is ripe is 20-25nt, is widely present in animal and plant body.They can by with target
The almost complementation of mRNA causes target mrna degradation or not fully complementary combination to block mRNA translations, or inhibits target gene
Transcription.It is estimated that the about known of 1%-2% is made of miRNA in eucaryote, they have regulated and controled about 30%
Even more gene expression.Since being found, miRNA becomes the research hotspot of life science, and reason is this
Class small RNA molecular has extensive regulatory function in vital movement, has very to gene expression, growth and development and behavior etc.
Far-reaching and complicated effect.
Wheat is one of most important cereal crops in the world, and there are about 40% populations using wheat as staple food grain, the battalion of wheat
It supports and enriches, wheat can make the foods such as steamed bun, bread, biscuit after wearing into flour.However in the production process of wheat, wheat
Spike sprouting is a kind of very serious climate calamity, and Spike sprouting refers to that wheat meets with rainy weather or moist ring in preharvest period
Head sprouting phenomenon caused by border.It is reported that all there are problems that Spike sprouting in states such as Japan, the U.S., Australia, Canada,
In with Canada and Australia be particularly acute.Europe almost have Spike sprouting every year, caused by lose also very sternly
Weight.China is also the severely afflicated area of wheat ear germinating, the three big main producing region of wheat in China：Northeasten Spring Wheat Area of China, middle and lower reach of Yangtze River winter wheat
Area and southwestern Winter Wheat Area, are all that Spike sprouting endangers more serious area, also occasionally have hair in varieties in Huang-Huai-Hai Plain and northern Winter Wheat Area
It is raw, accounted for about the 83% of China's wheat gross area by the area of wheat that Spike sprouting endangers.The Spike sprouting of wheat is during Wheat Production
Improve wheat quality and yield urgent problem to be solved.
Invention content
The object of the present invention is to provide a kind of miRNA and its in regulation and control wheat seeds sprouting speed and Spike sprouting ability
Using.
The present invention provides a kind of miRNA, is named as miRNA-wz, wheat breed China spring is derived from, such as the sequence of sequence table
Shown in row 3.The present invention also protects a kind of RNA (precursor of miRNA-wz, abbreviation miRNA-wz precursors), such as the sequence 4 of sequence table
It is shown.
The DNA molecular for encoding the miRNA-wz also belongs to protection scope of the present invention.The DNA molecular is concretely such as
Under (a1) or (a2) or (a3)：
(a1) DNA molecular shown in sequence 1 in sequence table；
(a2) hybridize and DNA molecular with the same function with (a1) DNA sequence dna limited under strict conditions；
(a3) DNA sequence dna limited with (a1) has 90% or more homology and DNA molecular with the same function.
The DNA molecular for encoding the miRNA-wz precursors also belongs to protection scope of the present invention.The DNA molecular specifically may be used
For following (b1) or (b2) or (b3)：
(b1) DNA molecular shown in sequence 2 in sequence table；
(b2) hybridize and DNA molecular with the same function with (b1) DNA sequence dna limited under strict conditions；
(b3) DNA sequence dna limited with (b1) has 90% or more homology and DNA molecular with the same function.
Above-mentioned stringent condition can be with 0.1 × SSPE (or 0.1 × SSC), and the solution of 0.1%SDS is miscellaneous in DNA or RNA
It hands over and hybridizes at 65 DEG C in experiment and wash film.
Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing any description above DNA molecular belong to
In protection scope of the present invention.
The recombinant vector can be multiple cloning sites or recombination site the insertion any description above in plant expression vector
DNA molecular obtains recombinant plasmid.The recombinant vector is concretely by the SmaI restriction enzyme sites of pWMB003 carriers and SacI digestions
Small fragment between site is substituted by the recombinant plasmid that any description above DNA molecular obtains.The recombinant vector is concretely
Small fragment between the SmaI restriction enzyme sites and SacI restriction enzyme sites of pAHC25 carriers is substituted by any description above DNA molecular
Obtained recombinant plasmid.
The primer pair of the overall length or its arbitrary segment that expand the DNA molecular also belongs to protection scope of the present invention.It is described
Primer pair specifically can single strand dna shown in single strand dna and the sequence of sequence table 7 shown in the sequence 6 by sequence table
Composition.
The present invention also protects the application of the miRNA-wz, the miRNA-wz precursors or any description above DNA molecular,
For following (c1), (c2), (c3) or (c4)：
(c1) regulate and control plant Spike sprouting ability；
(c2) regulate and control plant seed germination speed；
(c3) plant Spike sprouting ability is reduced；
(c4) plant seed germination speed is reduced.
The plant can be monocotyledon or dicotyledon.The monocotyledon can be angiosperm.The quilt
Sub- plant can be Poales plant.The Poales plant can be grass.The grass can be that Triticum is planted
Object.The wheat platymiscium concretely wheat, such as wheat CB037 or Ji wheat 5265.
The present invention also protects a kind of method for cultivating genetically modified plants, is that the importing of any description above DNA molecular is set out
In plant, genetically modified plants are obtained；The genetically modified plants meet following at least one of (d1) or (d2) phenotype：
(d1) seed speed of germinating is less than the plant that sets out；
(d2) Spike sprouting ability is less than the plant that sets out.
The plant that sets out can be monocotyledon or dicotyledon.The monocotyledon can be angiosperm.Institute
It can be Poales plant to state angiosperm.The Poales plant can be grass.The grass can be wheat
Platymiscium.The wheat platymiscium concretely wheat, such as wheat CB037 or Ji wheat 5265.
Any description above DNA molecular sets out plant described in being imported by recombinant expression carrier.The recombinant expression carries
Body can obtain recombination matter to be inserted into any description above DNA molecular in the multiple cloning sites or recombination site of plant expression vector
Grain.The recombinant vector is concretely by the small fragment between the SmaI restriction enzyme sites of pWMB003 carriers and SacI restriction enzyme sites
It is substituted by the recombinant plasmid that any description above DNA molecular obtains.The recombinant vector is concretely by pAHC25 carriers
Small fragment between SmaI restriction enzyme sites and SacI restriction enzyme sites is substituted by the recombination matter that any description above DNA molecular obtains
Grain.
The present invention also protects any description above method, the miRNA, the miRNA-wz precursors or any description above
Application of the DNA molecular in plant breeding.The plant can be monocotyledon or dicotyledon.The monocotyledon can
For angiosperm.The angiosperm can be Poales plant.The Poales plant can be grass.The grass family
Plant can be wheat platymiscium.The wheat platymiscium concretely wheat, such as wheat CB037 or Ji wheat 5265.It is described to educate
The purpose of kind is the plant for obtaining seed speed of germinating and/or the reduction of Spike sprouting ability.
In the present invention, Function Identification is carried out to miRNA-wz by expression pattern analysis, transient overexpression verification etc., just
Step identifies its influence sprouted to seed, it is found that overexpression miRNA-wz inhibits seed speed of germinating and fringe is inhibited to send out
Bud.The present invention is to improve wheat anti growing out ability, reduces influence of the Spike sprouting to Wheat Production and provides technical support, while
It is new to obtain wheat anti growing out by the biotechnologys such as transgenosis or screening high level expression miRNA wheat breeds later
Germplasm lays the foundation.
Description of the drawings
Fig. 1 is expressions of the miRNA-wz in different plants.
Fig. 2 is expressions of the miRNA-wz in the different development stage of wheat seed.
Fig. 3 is the germination percentage result in embodiment 4.
Fig. 4 be embodiment 4 step 4 in cultivate 8 days photos.
Fig. 5 is the result that real-time quantitative PCR detects the expression of miRNA-wz in rataria in embodiment 4.
Fig. 6 is fractional t1 in embodiment 5 for the PCR qualification results of plant.
Fig. 7 is the result for the expression that real-time quantitative PCR detects miRNA-wz in embodiment 5.
Fig. 8 is the photo of 5265 seed of Ji wheat and OE5 strain seeds stationary culture after 24 hours and 48 hours.
Fig. 9 is the 1st day, the 2nd day and the 3rd day, the germination percentage result of each strain.
Figure 10 is the photo of Ji wheat 5265 and OE5 strain plant stationary culture after 7 days.
Figure 11 is stationary culture after 7 days, the Spike sprouting rate result of each strain.
Specific implementation mode
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
PAHC25 carriers (also known as pAHC25 plasmids)：Bibliography：Taylor M G, Vasil V, Vasil I
K.Enhanced GUS gene expression in cereal/grass cell suspensions and immature
Embryos using the maize uhiquitin-based plasmid pAHC25 [J] .Plant cell reports,
1993,12 (9)：491-495..
PWMB003 carriers：Bibliography：Yin Guixiang, Zhao wear, Hao Haonan, Li Jielin, Du Lipu, Zhang Pingzhi, She Maoyun,
Leaf make the country prosperous tri- convenient and practical plant expression vector constructions of (2014) with verification plant genetic resources journals, 15 (6),
1327-1333.。
Wheat " CB037 " (abbreviation wheat CB037)：Bibliography：YIN, G.X., WANG, Y.L., SHE, M.Y., DU,
L.P., XU, H.J. , ＆YE, X.G. (2011) .Establishment of a highly efficient regeneration
System for the mature embryo culture of wheat.Agricultural Sciences in China,
10 (1), 9-17..
Wheat " China spring " (abbreviation wheat China spring)：Bibliography：Peng Yuanying, Peng Zhengsong, Song can emerging wheats China springs
Chromosome mapping [J] Scientia Agricultura Sinicas of E. elongata Photosynthesis Related Genes, 2005,38 (11) under background：
2182-2188。
Wheat " Yangmai No.158 " (abbreviation Yangmai No.158)：Bibliography：Du Chenglin, Zhu Bin, Tao Shuaiping wait to apply potassium to raising wheat
Influence [J] soil journals of the Nutrient Absorption and biological yield of 158 equal wheat breeds, 2001,38 (3)：301-307..
Wheat " TDD " (abbreviation wheat TDD)：Bibliography：Yu M, Carver B F, Yan L.TamiR1123
originated from a family of miniature inverted-repeat transposable elements
(MITE)including one inserted in the Vrn-Ala promoter in wheat[J].Plant
Science, 2014,215：117-123..
Wheat " 3338 " (abbreviation wheat 3338)：Bibliography：Ni Zhongfu, its letter common wheat difference advantages hybridization of grandson
Gene expression difference comparative studies [J] China Agricultural University journal between kind and its parent, 2000,5 (1)：1-8..
Barley " Morex " (abbreviation barley Morex)：Bibliography：Loosening peak, KANSAYE ALY, Du Xianghong, Nie little Jun,
It (is) Seedling Salt-tolerance comprehensive analysis [J] grass that peaceful .30 parts of Fang Guiying, Yang Jiantao, Li Kang, Zhang Baojun, Song Wei, which introduces barley variety,
Industry science, 2010,27 (4)：127-133..
Rice " in spend 11 " (spending 11 in abbreviation rice)：Bibliography：Xie Daoxin, Fan Yunliu, Ni is big to rush Su Yun gold gemma
Bacillus killing gene, which imports in Chinese cultivated rice varieties, spends No. 11 acquisition transfer-gen plant [J] Chinese sciences .1991 (08).
Corn " comprehensive 3 " (comprehensive 3) of abbreviation corn：Bibliography：Yang Hui, kingdom's English, wear the auspicious maize elite inbred lines of scape it is comprehensive 3,
Comprehensive 31 Study on Transformation [J] Journal of Agricultural Biotechnologies .2001 (04).
Wheat " Ji wheat 5265 " (abbreviation Ji wheat 5265)：Bibliography：The brave high of Liu Yuping, Wang Jianghao, Zhao Aiju, Chen Xi
Wide selection and breeding [J] the Hebei Agricultural Sciences for fitting New Winter Wheat Variety Ji 5265 of production, 2009,13 (2)：60-b1..
The discovery of embodiment 1, miRNA-wz
The total serum IgE of wheat breed China spring is extracted, and reverse transcription is cDNA.By a large amount of sequence analyses, expression analysis
With functional verification, the coded sequence of a miRNA is found that from cDNA, as shown in the sequence 1 of sequence table, polynucleotide
MiRNA (being named as miRNA-wz) shown in sequence 3.The precursor sequence such as sequence table of miRNA shown in the sequence 3 of sequence table
Shown in sequence 4, the coded sequence of the precursor sequence is as shown in the sequence 2 of sequence table.
Embodiment 2, miRNA-wz expression pattern analysis
One, expressions of the miRNA-wz in different plants
Sample to be tested is：Spent in wheat China spring, Yangmai No.158, wheat TDD, wheat 3338, barley Morex, rice 11 or
Corn comprehensive 3.
1, the Germinating Embryo of sample to be tested is taken, total serum IgE is extracted.
2, it is enriched with tiny RNA in the total serum IgE obtained from step 1.
(1) total serum IgE that step 1 obtains is mixed in equal volume with buffer solution, is subsequently placed in and places 2 hours on ice, then 4
DEG C, 12000rpm centrifuge 10min, take supernatant.
Buffer solution：PEG containing 10g/100ml8000With the aqueous solution of 1M NaCl.
(2) supernatant for taking step (1) to obtain, be added 2 times of volumes absolute ethyl alcohol and 1/10 volume sodium acetate (3M,
PH5.2), standing overnight for -70 DEG C, then 4 DEG C, 12000rpm centrifugation 20min collect precipitation, as tiny RNA (length ＜ 200),
DEPC-H is used after air-drying20 30 μ l dissolvings.
3, the tiny RNA for taking step 2 to obtain carries out transferring film in accordance with the following steps successively：
(1) it takes 15% acrylamide (acr: bis=19: 1) glue 40ml, 80 20 μ l of μ l, TEMED of 10%APS is added,
It polymerize 20min；
(2) 250v constant pressures prerunning 1h runs out of the impurity such as extra APS, urea, TEMED；
(3) 250v, 16 DEG C of electrophoresis 2h；
(4) 200mA transferring films 1.5h is clamped air-dried with filter paper；
(5) then 1.25J UV crosslinking 1.5min dries 1.5h for 80 DEG C.
4, after completing step 3, by northern hybridization, (probe that northern hybridization uses is the sequence 5 of sequence table
Shown in single strand dna) detection miRNA-wz expression, the result is shown in Figure 1.
In Fig. 1, swimming lane 1 is wheat China spring, swimming lane 2 is Yangmai No.158, swimming lane 3 is wheat TDD, swimming lane 4 is wheat
3338, swimming lane 5 is barley Morex, swimming lane 6 is that 11, swimming lane 7 is spent in rice is corn comprehensive 3.The result shows that present invention discover that
MiRNA-wz is the special miRNA of wheat species, be can't detect in the Germinating Embryo of barley, rice and corn.
Two, expressions of the miRNA-wz in the different development stage of wheat seed
Sample to be tested is respectively：The embryo of 20 days seeds, pollination after the embryo of 15 days seeds, pollination after the pollination of wheat 3338
Afterwards the embryo of 28 days seeds, do not carry out any processing ripe dry seeds embryo, water suction 3 hours after mature seed embryo, inhale
The embryo of mature seed after the embryo of mature seed after the embryo of mature seed of the water after 6 hours, water suction 9 hours, water suction 12 hours
Or the embryo of the mature seed after absorbing water 24 hours.
1, sample to be tested, extraction total serum IgE and reverse transcription are taken.
2, the reverse transcription product for taking step 1 to obtain detects the table of miRNA-wz by the real-time quantitative PCR of Taqman probes
Up to level.
The target sequence of Taqman probes for detecting miRNA-wz is：UCUGGCGAGGGACAUACACUGU.
Use U6 genes for internal reference, the target sequence of the Taqman probes for detecting internal reference is：
UAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCACAAAUCGAGAAAUGGUCCAA
AUUU。
PCR programs：95 DEG C of denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of annealing 60s, 40 recycle.Using comparing threshold method
Quantitative analysis is carried out to real-time quantitative PCR result, fluorescence thresholding is set by hand, determines recurring number specific under the fluorescence thresholding
Ct values calculate C values, C=2- Δ CT, Δ Ct=Ct target gene-Ct internal standard genes according to Ct values.
As a result see Fig. 2.In Fig. 2,1 is that the embryo of 15 days seeds, 2 are that the embryo of 20 days seeds, 3 are to award after pollinating after pollinating
The embryo of 28 days seeds after powder, 4 be the embryo for the mature seed for not carrying out any processing, 5 be mature seed after absorbing water 3 hours
Embryo, 6 be absorb water 6 hours after mature seed embryo, 7 be absorb water 9 hours after mature seed embryo, 8 be water suction 12 hours after
Mature seed embryo, 9 be absorb water 24 hours after mature seed embryo.The result shows that：MiRNA-wz is in Seed development
In gradual up-regulated expression；During Seed sprouting, miRNA-wz expressions after Seed imbibition 6 hours reach highest, and
The expression that higher level is kept within a period of time later, illustrates that miRNA-wz may play certain works in Seed Germination
With.
Embodiment 3, recombinant expression carrier structure
1, simultaneously reverse transcription is cDNA to the total serum IgE of the Germinating Embryo of extraction Chinese spring, using cDNA as template, using SmaI-L
PCR amplification is carried out with the primer pair of SacI-R compositions, obtains pcr amplification product.
SmaI-L：5’-TCCCCCGGGCAACGATTGATTCGTCGTAGGA-3’；
SacI-R：5’-CGAGCTCGGATTTGTTCTCAATTACACAG-3’；
In SmaI-L and SacI-R, underscore marks SmaI and SacI restriction enzyme sites respectively.
2, with the pcr amplification product of Restriction enzyme Sma I and SacI double digestion steps 1, digestion products are recycled.
3, with Restriction enzyme Sma I and SacI double digestion pAHC25 carriers, the carrier framework of about 7.9kb is recycled.
4, the digestion products of step 2 are connected with the carrier framework of step 3, obtains recombinant plasmid pAHC25-miRwz.Root
According to sequencing result, structure is carried out to recombinant plasmid pAHC25-miRwz and is described as follows：By SmaI the and SacI enzymes of pAHC25 carriers
Small fragment between enzyme site replaces double chain DNA molecule shown in the sequence 2 for sequence table.
5, with Restriction enzyme Sma I and SacI double digestion pWMB003 carriers, the carrier framework of about 4.5kb is recycled.
6, the digestion products of step 2 are connected with the carrier framework of step 5, obtains recombinant plasmid pWMB003-miRwz.Root
According to sequencing result, structure is carried out to recombinant plasmid pWMB003-miRwz and is described as follows：By the SmaI and SacI of pWMB003 carriers
Small fragment between restriction enzyme site replaces double chain DNA molecule shown in the sequence 2 for sequence table.
Embodiment 4, wheat immature embryo transient expression
1,10-12 days wheat CB037 seeds after pollination are taken, first with 70% alcohol treatment 2min, then it is molten with sodium hypochlorite
Liquid (effective chlorine 0.5%, volume ratio) handles 15min, and then sterilizing is washed three times.
2, the seed for taking step 1 to obtain, detaches rataria, and rataria scultellum is placed on upward containing 200mg/L MES and
On the 1/2MS solid mediums of 150g/L maltose, 25 DEG C of dark processing 3-4h.
3, gene shotgun is made with recombinant plasmid pWMB003-miRwz or pWMB003 carrier, what implant steps 2 obtained
Rataria.
4, after completing step 3, take rataria, dark processing 1 day that then rataria scultellum is transferred to downward containing 200mg/L
On the 1/2MS solid mediums of 30g/L maltose, 25 DEG C are cultivated, every 24 hours statistics germination percentages in incubation.
Germination percentage result is shown in Fig. 3 (abscissa is number of days, and every 24 hours are 1 day).The photo cultivated 8 days in step 4 is shown in figure
4.The result shows that the germination percentage of the rataria of bombardment recombinant plasmid pWMB003-miRwz is substantially less than the children for bombarding pWMB003 carriers
Embryo illustrates that the sprouting of rataria can be inhibited by overexpressing miRNA-wz provided by the invention.
5, after being cultivated 4 days in step 4, the table of miRNA-wz in the real-time quantitative PCR detection rataria of Taqman probes is utilized
Up to (method is with the step of embodiment 2 two), Fig. 5 is as a result seen.The result shows that the rataria of bombardment recombinant plasmid pWMB003-miRwz
The expression of middle miRNA-wz is apparently higher than the rataria of bombardment pWMB003 carriers.
Embodiment 5, functional analysis
One, transfer-gen plant is obtained
1, recombinant plasmid pAHC25-miRwz is taken, using the Immature embryo calli of biolistic bombardment Ji wheat 5265, obtains T0
For plant.
2, T0 obtains T1 for plant for plant selfing.T1 obtains T2 for plant for plant selfing.T2 is obtained for plant selfing
To T3 for plant.
3, T0 carries out following PCR identifications for plant, T2 for plant, T1 for plant：Plant genomic DNA to be measured is extracted, is adopted
The primer pair (target sequence is the Barsta genes in carrier framework) formed with BAR1 and BAR2 carries out PCR identifications, if obtained
The amplified production of about 450bp, plant to be measured are transfer-gen plant, if not obtaining the amplified production, waiting for measuring plants to be non-
Transfer-gen plant.For a certain transgenosis T1 is for plant, if the T2 of the plant and its sampling Detection is to turn for plant
Gene plant, the plant are the transfer-gen plant of homozygosis, the plant and its transgenic line that self progeny is homozygosis.Fractional t1
See Fig. 6 for the PCR qualification results of plant (each swimming lane represents 1 plant).
BAR1：5’-GTCTGCACCATCGTCAACC-3’；
BAR2：5’-GAAGTCCAGCTGCCAGAAAC-3’.
4, it takes the T3 of 3 Transgenic wheat lines (OE5, OE6 and OE8) for plant at random, utilizes the reality of Taqman probes
When quantitative PCR detection miRNA-wz expression (method is with the step of embodiment 2 two), as a result see Fig. 7.The result shows that transgenosis
The expression of miRNA-wz at least improves 2 times in strain.
Two, it obtains and turns empty carrier plant
It replaces recombinant plasmid pAHC25-miRwz to carry out step 1 with pAHC25 carriers, obtains turning empty carrier plant.
Three, wheat germination character observation
1, influences of the miRNA-wz to wheat seeds sprouting speed
It takes the T3 of 3 Transgenic wheat lines (OE5, OE6 and OE8) for seed at random, takes the T3 generations for turning empty carrier plant
Seed takes 5265 seed of Ji wheat, carries out following parallel test respectively：
Seed embryo is upward, ventral groove is placed in downwards in the small culture dish (a diameter of 5cm) for being lined with two layers of filter paper, adds 5ml
Sterile purified water, 23-25 DEG C of stationary culture are sprouted with seed for germination, and every 24 hours statistics germinative numbers calculate germination percentage.
It carries out repeating to test three times, repeats 35 seeds of each strain in testing every time, results are averaged.
5265 seed of Ji wheat and OE5 strain seeds stationary culture are shown in Fig. 8 in 24 hours with photo of the stationary culture after 48 hours.
1st day, the 2nd day and the 3rd day, the germination percentage result of each strain was shown in Fig. 9 (abscissa is number of days, and every 24 hours are 1 day).
The result shows that germination percentage of the seed of transgenic line after stationary culture 24 hours and 48 hours is substantially less than Ji
Wheat 5265, miRNA-wz inhibits seed to sprout, but the stationary culture germination percentage of the seed of transgenic line and Ji after 72 hours
The seed of wheat 5265 does not have notable difference, this illustrates that miRNA-wz is only reduction of the speed of germination of seed, and there is no reduce kind
The germination percentage of son.After stationary culture 24 hours, 48 hours and 72 hours, turn germination percentage and the Ji wheat of the seed of empty carrier plant
5265 seed is not significantly different.
2, influences of the miRNA-wz to wheat ear germinating
It takes the T3 of 3 Transgenic wheat lines (OE5, OE6 and OE8) for plant at random, takes the T3 generations for turning empty carrier plant
Plant takes 5265 plant of Ji wheat, carries out following parallel test respectively：
Ripe plant, 5 fringes is taken to be bundled into a bundle, taken out after soaking at room temperature 1h in water, plastics are placed on after throwing away extra droplet
In bag and tighten sack, 23-25 DEG C of stationary culture 7 days, then counting Spike sprouting rate (has with seed and sprout or sprouts to send out
Bud).
It carries out repeating to test three times, repeats 5 fringe of each strain in testing every time, results are averaged.
The photo of Ji wheat 5265 and OE5 strain plant stationary culture after 7 days is shown in Figure 10.After stationary culture 7 days, each strain
Spike sprouting rate the result is shown in Figure 11.The result shows that the ability of the Spike sprouting of transgenic line is substantially less than Ji wheat 5265, overexpression
MiRNA-wz has inhibiting effect to Spike sprouting.After stationary culture 7 days, the Spike sprouting rate and Ji wheat 5265 that turn empty carrier plant do not have
Significant difference.
Claims (7)
1. a kind of method for cultivating genetically modified plants, includes the following steps：Specific DNA molecular is imported into the plant that sets out, obtains fringe
The genetically modified plants that germinating capacity reduces；The specific DNA molecular is following (1) or (2)：
(1) DNA molecular shown in sequence 1 in sequence table；
(2) DNA molecular shown in sequence 2 in sequence table；
The plant is wheat.
2. a kind of method for cultivating genetically modified plants, includes the following steps：Specific DNA molecular is imported into the plant that sets out, is planted
The genetically modified plants that sub- speed of germinating reduces；The specific DNA molecular is following (1) or (2)：
(1) DNA molecular shown in sequence 1 in sequence table；
(2) DNA molecular shown in sequence 2 in sequence table；
The plant is wheat.
3. the application of the DNA molecular of miRNA shown in sequence 3 or the coding miRNA, for following (c1) or (c2)：
(c1) plant Spike sprouting ability is reduced；
(c2) plant seed germination speed is reduced；
The plant is wheat.
4. application according to claim 3, it is characterised in that：In the DNA molecular such as sequence table shown in sequence 1.
5. the application of the DNA molecular of RNA shown in sequence 4 or the coding RNA, for following (c1) or (c2)：
(c1) plant Spike sprouting ability is reduced；
(c2) plant seed germination speed is reduced；
The plant is wheat.
6. application according to claim 5, it is characterised in that：In the DNA molecular such as sequence table shown in sequence 2.
7. application of claims 1 or 2 the method in reducing wheat ear germinating ability or reducing wheat seeds sprouting speed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610121816.9A CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610121816.9A CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671047A CN105671047A (en) | 2016-06-15 |
| CN105671047B true CN105671047B (en) | 2018-09-28 |
Family
ID=56307942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610121816.9A Active CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671047B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101952444A (en) * | 2007-12-21 | 2011-01-19 | 巴斯夫植物科学有限公司 | Plants with increased yield (KO NUE) |
| CN104651366A (en) * | 2015-02-09 | 2015-05-27 | 山东农业大学 | microRNA408 of wheat as well as coded gene and application of microRNA408 |
| CN105177001A (en) * | 2015-09-15 | 2015-12-23 | 中国科学院遗传与发育生物学研究所 | MiR167d related to barley powdery mildew resistance and application thereof |
-
2016
- 2016-03-03 CN CN201610121816.9A patent/CN105671047B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101952444A (en) * | 2007-12-21 | 2011-01-19 | 巴斯夫植物科学有限公司 | Plants with increased yield (KO NUE) |
| CN104651366A (en) * | 2015-02-09 | 2015-05-27 | 山东农业大学 | microRNA408 of wheat as well as coded gene and application of microRNA408 |
| CN105177001A (en) * | 2015-09-15 | 2015-12-23 | 中国科学院遗传与发育生物学研究所 | MiR167d related to barley powdery mildew resistance and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| 《Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biology》;Yingyin Yao等;《Genome Biology》;20070601;第8卷(第6期);全文 * |
| 《Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)》;Ran Han等;《BMC Genomics》;20141231;第15卷(第1期);第8页表3倒数第2行，第13页附件6 * |
| 《植物中microRNA的合成及在发育和抗逆中的作用》;王波等;《植物生理学通讯》;20060630;第42卷(第3期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671047A (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102732554B (en) | A kind of method improving plant anti-insect ability | |
| US20130019334A1 (en) | Corn event mzdt09y | |
| US20140237685A1 (en) | SPL16 compositions and methods to increase agronomic performance of plants | |
| JP2011504728A5 (en) | ||
| CN110699361B (en) | Rice salt stress resistance related gene Os16 and encoding protein and application thereof | |
| CN109385431B (en) | Application of OsERF2 gene in regulation and control of rice grain size | |
| CN109369789B (en) | ZmDRR206 protein and application of coding gene thereof in regulation and control of plant disease resistance and growth development | |
| CN107090464A (en) | Pest-resistant antiweed corn transformation event and its method for creating and detection method | |
| CN116410977A (en) | Insect-resistant glyphosate-resistant transgenic corn event KJ1172 and detection method thereof | |
| CN108642065A (en) | A kind of paddy endosperm silty related gene OsSecY2 and its coding protein and application | |
| CN101805399A (en) | Protein associated with thousand grain weight of wheat and encoding gene and application thereof | |
| CN107406844A (en) | The transgenic rice plant of improvement | |
| CN103451225B (en) | Application of rice WRKY transcription factor gene OsWRKY21 in cultivation of resistant varieties of plants | |
| CN110616225B (en) | Corn auxin transport gene ZmABCB15 and application thereof in rough dwarf resistance | |
| CN106916826A (en) | Paddy gene OsNF YC4 and its application | |
| CN107988225B (en) | Corn grain development related gene miR169o and application thereof | |
| CN105671047B (en) | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN101886083B (en) | Application of rice OsEATB gene in modifying rice yield traits | |
| WO2022266081A2 (en) | Agronomic practices and sustainability methods involving yield traits | |
| CN108795944A (en) | Cotton long-chain non-coding RNA-lnc973 and its application in plant salt endurance | |
| CN105132428B (en) | A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| CN108034662A (en) | The breeding method of application and Rust resistance bacterium wheat of the wheat stripe rust PSTG_06025 genes in stripe rust prevention | |
| CN104774826B (en) | A kind of histone deacetylase and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |