CN105671047A - miRNA (microribonucleic acid) and application thereof in regulating wheat seed germination speed and pre-harvest sprouting capacity - Google Patents
miRNA (microribonucleic acid) and application thereof in regulating wheat seed germination speed and pre-harvest sprouting capacity Download PDFInfo
- Publication number
- CN105671047A CN105671047A CN201610121816.9A CN201610121816A CN105671047A CN 105671047 A CN105671047 A CN 105671047A CN 201610121816 A CN201610121816 A CN 201610121816A CN 105671047 A CN105671047 A CN 105671047A
- Authority
- CN
- China
- Prior art keywords
- dna
- sequence
- plant
- mirna
- dna molecular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8267—Seed dormancy, germination or sprouting
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an miRNA (microribonucleic acid) and application thereof in regulating wheat seed germination speed and pre-harvest sprouting capacity. The invention provides miRNA-wz disclosed as Sequence 3 in the sequence table. The invention also provides a miRNA-wz precursor disclosed as Sequence 4 in the sequence table. The DNA (deoxyribonucleic acid) molecule for coding the miRNA-wt and the DNA molecule for coding the miRNA-wz precursor also belong to the protection domain of the invention. The invention also provides application of the miRNA-wz, the miRNA-wz precursor or any DNA molecule above in (c1), (c2), (c3) or (c4): (c1) regulating the pre-harvest sprouting capacity of plants; (c2) regulating the plant seed germination speed; (c3) lowering the pre-harvest sprouting capacity of plants; or (c4) lowering the plant seed germination speed. The invention provides technical supports for enhancing the pre-harvest sprouting resistance of wheat and lowering the influence of pre-harvest sprouting on wheat production.
Description
Technical field
The present invention relates to a kind of miRNA and the application in regulation and control wheat seeds sprouting speed and Spike sprouting ability thereof.
Background technology
MicroRNA is called for short miRNA (microRNA), is the loop-stem structure precursor formed by non-protein encoding gene transcript, and shearing the ripe rear length formed is the small RNA molecular of 20-25nt, is extensively present in animal and plant body. They cause said target mrna to be degraded by the almost complete complementary with said target mrna, or not exclusively complementary combination blocks mRNA translation, or suppress transcribing of target gene. It is estimated that the known of nearly 1%-2% is made up of miRNA in eukaryote, they have regulated and controled about 30% even more genetic expression. Since being found, miRNA be the research focus of life science, its reason is that this kind of small RNA molecular has regulatory function widely in vital movement, to genetic expression, grows and behavior etc. has very far-reaching and complicated effect.
Wheat is one of food crop the most important in the world, about has the population of 40% to take wheat as staple food grain, wheat nutritious, and wheat can make the foods such as steamed bun, bread, biscuit after wearing into flour. But in the production process of wheat, the Spike sprouting of wheat is a kind of very serious climate calamity, Spike sprouting refers to that phenomenon of germinateing on the fringe that experience rainy weather or wet environment cause in earlier stage gathered in the crops by wheat. It is reported all there is Spike sprouting problem in states such as Japan, the U.S., Australia, Canada, wherein particularly serious with Canada and Australia. Almost having Spike sprouting to occur every year in Europe, the loss caused is also very serious. China is also the severely afflicated area of wheat ear germinating, the big main producing region of the wheat three of China: Northeasten Spring Wheat Area of China, winter wheat district, the middle and lower reach of Yangtze River and winter wheat district, southwest, it is all that Spike sprouting endangers more serious area, also occasionally having generation in varieties in Huang-Huai-Hai Plain and winter wheat district, the north, the Mai Qu by Spike sprouting harm accounts for the 83% of China's wheat total area.The Spike sprouting of wheat improves wheat quality and output problem demanding prompt solution in Wheat Production process.
Summary of the invention
It is an object of the invention to provide a kind of miRNA and the application in regulation and control wheat seeds sprouting speed and Spike sprouting ability thereof.
The present invention provides a kind of miRNA, called after miRNA-wz, derives from wheat breed China spring, as shown in the sequence 3 of sequence table. The present invention also protects a kind of RNA (precursor of miRNA-wz is called for short miRNA-wz precursor), as shown in the sequence 4 of sequence table.
The DNA molecular encoding described miRNA-wz also belongs to protection scope of the present invention. Described DNA molecular specifically can be (a1) or (a2) or (a3) as follows:
(a1) DNA molecular shown in sequence 1 in sequence table;
(a2) the DNA sequence dna hybridization limited with (a1) under strict conditions and the DNA molecular with identical function;
(a3) DNA sequence dna limited with (a1) has more than 90% homology and has the DNA molecular of identical function.
The DNA molecular encoding described miRNA-wz precursor also belongs to protection scope of the present invention. Described DNA molecular specifically can be (b1) or (b2) or (b3) as follows:
(b1) DNA molecular shown in sequence 2 in sequence table;
(b2) the DNA sequence dna hybridization limited with (b1) under strict conditions and the DNA molecular with identical function;
(b3) DNA sequence dna limited with (b1) has more than 90% homology and has the DNA molecular of identical function.
Above-mentioned stringent condition can be with 0.1 × SSPE (or 0.1 × SSC), and the solution of 0.1%SDS, hybridizes at 65 DEG C in DNA or RNA hybrid experiment and wash film.
Recombinant expression vector containing above arbitrary described DNA molecular, expression cassette, transgenic cell line or restructuring bacterium all belong to protection scope of the present invention.
Described recombinant vectors can be arbitrary described DNA molecular more than the multiple clone site or recombination site insertion of plant expression vector and obtains recombinant plasmid. Described recombinant vectors specifically can be the recombinant plasmid small segment between the SmaI restriction enzyme site of pWMB003 carrier and SacI restriction enzyme site being substituted by above arbitrary described DNA molecular and obtaining. Described recombinant vectors specifically can be the recombinant plasmid small segment between the SmaI restriction enzyme site of pAHC25 carrier and SacI restriction enzyme site being substituted by above arbitrary described DNA molecular and obtaining.
The total length of described DNA molecular that increases or the primer pair of its any fragment also belong to protection scope of the present invention. Described primer pair specifically can be made up of the single strand dna shown in the sequence 7 of the single strand dna shown in the sequence 6 of sequence table and sequence table.
The present invention also protects the application of described miRNA-wz, described miRNA-wz precursor or more arbitrary described DNA molecular, is following (c1), (c2), (c3) or (c4):
(c1) regulating plant Spike sprouting ability;
(c2) regulating plant seed germination speed;
(c3) plant Spike sprouting ability is reduced;
(c4) plant seed germination speed is reduced.
Described plant can be monocotyledons or dicotyledons. Described monocotyledons can be angiosperm. Described angiosperm can be standing grain this order plant. Described standing grain this order plant can be grass. Described grass can be Triticum plant. Described Triticum plant specifically can be wheat, such as wheat CB037 or Ji wheat 5265.
The present invention also protects a kind of method cultivating transgenic plant, is import above arbitrary described DNA molecular to set out in plant, obtains transgenic plant; Described transgenic plant meet at least one phenotype in following (d1) or (d2):
(d1) seed germination speed is lower than the described plant that sets out;
(d2) Spike sprouting ability is lower than the described plant that sets out.
The described plant that sets out can be monocotyledons or dicotyledons. Described monocotyledons can be angiosperm. Described angiosperm can be standing grain this order plant. Described standing grain this order plant can be grass. Described grass can be Triticum plant. Described Triticum plant specifically can be wheat, such as wheat CB037 or Ji wheat 5265.
Arbitrary described DNA molecular is by the plant that sets out described in recombinant expression vector importing above. Described recombinant expression vector can be arbitrary described DNA molecular more than the multiple clone site or recombination site insertion of plant expression vector and obtains recombinant plasmid. Described recombinant vectors specifically can be the recombinant plasmid small segment between the SmaI restriction enzyme site of pWMB003 carrier and SacI restriction enzyme site being substituted by above arbitrary described DNA molecular and obtaining. Described recombinant vectors specifically can be the recombinant plasmid small segment between the SmaI restriction enzyme site of pAHC25 carrier and SacI restriction enzyme site being substituted by above arbitrary described DNA molecular and obtaining.
The present invention also protects the application of above arbitrary described method, described miRNA, described miRNA-wz precursor or more arbitrary described DNA molecular in plant breeding. Described plant can be monocotyledons or dicotyledons. Described monocotyledons can be angiosperm. Described angiosperm can be standing grain this order plant. Described standing grain this order plant can be grass. Described grass can be Triticum plant. Described Triticum plant specifically can be wheat, such as wheat CB037 or Ji wheat 5265. The object of described breeding is the plant obtaining seed germination speed and/or the reduction of Spike sprouting ability.
In the present invention, by expression pattern analysis, transient overexpression checking etc., miRNA-wz carried out Function Identification, preliminary evaluation its on the impact of seed germination, it has been found that overexpression miRNA-wz inhibits seed germination speed and inhibits Spike sprouting. The present invention is for improving wheat anti growing out ability, reduce Spike sprouting and provide technical support to the impact of Wheat Production, simultaneously also for the later kind matter obtaining wheat anti growing out new by the biotechnologys such as transgenosis or screening high level expression miRNA wheat breed lays the foundation.
Accompanying drawing explanation
Fig. 1 is the expression of miRNA-wz in different plant.
Fig. 2 is the expression of miRNA-wz at the different development stage of wheat seed.
Fig. 3 is the percentage of germination result in embodiment 4.
Fig. 4 be embodiment 4 step 4 in cultivate the photo of 8 days.
Fig. 5 is the result of the expression of miRNA-wz in real-time quantitative PCR detection children's embryo in embodiment 4.
Fig. 6 be in embodiment 5 part T1 for the PCR qualification result of plant.
Fig. 7 is the result of the expression of real-time quantitative PCR detection miRNA-wz in embodiment 5.
Fig. 8 is Ji wheat 5265 seed and the OE5 strain seed quiescent culture photo after 24 hours and 48 hours.
Fig. 9 is the 1st day, the 2nd day and the 3rd day, the percentage of germination result of each strain.
Figure 10 is Ji wheat 5265 and the OE5 strain plant quiescent culture photo after 7 days.
Figure 11 is quiescent culture after 7 days, the Spike sprouting rate result of each strain.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention. Experimental technique in following embodiment, if no special instructions, is ordinary method. Test materials used in following embodiment, if no special instructions, is to buy from routine biochemistry reagent shop and obtains. Quantitative test in following examples, all arranges and repeats experiment for three times, results averaged.
PAHC25 carrier (also known as pAHC25 plasmid): reference: TaylorMG, VasilV, VasilIK.EnhancedGUSgeneexpressionincereal/grasscellsuspe nsionsandimmatureembryosusingthemaizeuhiquitin-basedplas midpAHC25 [J] .Plantcellreports, 1993,12 (9): 491-495..
PWMB003 carrier: reference: Yin Guixiang, Zhao wears, Hao Haonan, Li Jielin, Du Lipu, Zhang Pingzhi, She Maoyun, leaf is made the country prosperous. and (2014). three convenient and practical plant expression vector constructions and checking. plant genetic resources journal, 15 (6), 1327-1333..
Wheat " CB037 " (is called for short wheat CB037): reference: YIN, G.X., WANG, Y.L., SHE, M.Y., DU, L.P., XU, H.J., &YE, X.G. (2011) .Establishmentofahighlyefficientregenerationsystemforthe matureembryocultureofwheat.AgriculturalSciencesinChina, 10 (1), 9-17..
Wheat " China spring " (is called for short wheat China spring): reference: Peng Yuanying, Peng Zhengsong, Song Huixing. the chromosomal localization [J] of E. elongata photosynthesis genes involved under wheat China spring background. Scientia Agricultura Sinica, 2005,38 (11): 2182-2188.
Wheat " Yangmai No.158 " (abbreviation Yangmai No.158): reference: Du Chenglin, Zhu Bin, Tao Shuaiping, etc. execute potassium to the impact [J] of the nutrition absorption of the wheat breeds such as Yangmai No.158 and biological yield. soil journal, 2001,38 (3): 301-307..
Wheat " TDD " (is called for short wheat TDD): reference: YuM, CarverBF, YanL.TamiR1123originatedfromafamilyofminiatureinverted-r epeattransposableelements (MITE) includingoneinsertedintheVrn-Alapromoterinwheat [J] .PlantScience, 2014,215:117-123..
Wheat " 3338 " (is called for short wheat 3338): reference: Ni Zhongfu, Sun Qixin. between the different superior hybrid crosses of common wheat and parent thereof, gene expression difference compares research [J]. China Agricultural University's journal, 2000,5 (1): 1-8..
Barley " Morex " (is called for short barley Morex): reference: Xie Songfeng, KANSAYEALY, Du Xianghong, Nie little Jun, Fang Guiying, Yang Jiantao, the peaceful .30 part of Li Kang, Zhang Baojun, Song Wei is introduced barley variety (being) Seedling Salt-tolerance and is comprehensively analyzed [J]. Practaculture Science, 2010,27 (4): 127-133..
Paddy rice " in spend 11 " (is called for short in paddy rice and spends 11): reference: Xie Daoxin, Fan Yunliu, Ni Pichong. B. thuringiensis insecticidal channel genes Chinese cultivated rice varieties is spent No. 11 obtain transfer-gen plant [J]. Chinese science .1991 (08).
Corn " combines 3 " (be called for short corn and combine 3): reference: Yang Hui, kingdom's English, Dai Jingrui. and maize elite inbred line is combined 3, is combined the Study on Transformation [J] of 31. Agricultural biotechnologies journal .2001 (04).
Wheat " Ji wheat 5265 " (is called for short Ji wheat 5265): reference: Liu Yuping, Wang Jianghao, Zhao Aiju, Chen Xiyong. high yield extensively fits the seed selection [J] of New Winter Wheat Variety Ji 5265. Hebei agricultural sciences, 2009,13 (2): 60-b1..
The discovery of embodiment 1, miRNA-wz
Extract the total serum IgE of wheat breed China spring, and reverse transcription is cDNA. Through a large amount of sequential analysis, expression analysis and functional verification, from cDNA, find the encoding sequence of a miRNA, as shown in the sequence 1 of sequence table, the miRNA (called after miRNA-wz) shown in sequence 3 of polynucleotide. The precursor sequence of the miRNA shown in sequence 3 of sequence table is as shown in the sequence 4 of sequence table, and the encoding sequence of this precursor sequence is as shown in the sequence 2 of sequence table.
Embodiment 2, miRNA-wz expression pattern analysis
One, the expression of miRNA-wz in different plant
Sample to be tested is: spend 11 or corn comprehensive 3 in wheat China spring, Yangmai No.158, wheat TDD, wheat 3338, barley Morex, paddy rice.
1, get the embryo of sprouting of sample to be tested, extract total serum IgE.
2, enrichment tiny RNA from the total serum IgE that step 1 obtains.
(1) total serum IgE step 1 obtained mixes with damping fluid equal-volume, is then placed in and places 2 hours on ice, and then 4 DEG C, the centrifugal 10min of 12000rpm, get supernatant liquor.
Damping fluid: containing 10g/100mlPEG8000With the aqueous solution of 1MNaCl.
(2) supernatant liquor that step (1) obtains is got, add the dehydrated alcohol of 2 times of volumes and the sodium-acetate (3M of 1/10 volume, pH5.2),-70 DEG C of hold over night, then 4 DEG C, the centrifugal 20min of 12000rpm, collecting precipitation, is tiny RNA (length < 200), uses DEPC-H after air-dry2030 μ l dissolves.
3, get the tiny RNA that step 2 obtains, carry out transferring film successively in accordance with the following steps:
(1) get acrylamide (acr: bis=19: 1) the glue 40ml of 15%, add 10%APS80 μ l, TEMED20 μ l, polymerization 20min;
(2) 250v constant voltage prerunning 1h, runs out of impurity such as unnecessary APS, urea, TEMED;
(3) 250v, 16 DEG C of electrophoresis 2h;
(4) 200mA transferring film 1.5h, clamps air-dry with filter paper;
(5) the UV-crosslinked 1.5min of 1.25J, then 80 DEG C are dried 1.5h.
4, after completing steps 3, detected the expression of miRNA-wz by northern hybridization (probe that northern hybridization adopts is the single strand dna shown in the sequence 5 of sequence table), the results are shown in Figure 1.
In Fig. 1, swimming lane 1 is wheat China spring, swimming lane 2 is Yangmai No.158, swimming lane 3 is wheat TDD, swimming lane 4 is wheat 3338, swimming lane 5 is barley Morex, swimming lane 6 for paddy rice spends 11, swimming lane 7 be corn comprehensive 3. Result shows, the miRNA-wz that the present invention finds is the special miRNA of wheat species, can't detect in the embryo of sprouting of barley, paddy rice and corn.
Two, miRNA-wz is at the expression of the different development stage of wheat seed
Sample to be tested is respectively: the embryo of the embryo of the embryo of the embryo of the embryo of the embryo of the embryo of the embryo of the embryo of the seed that wheat 3338 is pollinated latter 15 days, the seed pollinated latter 20 days, the seed pollinated latter 28 days, the ripe dry seeds not carrying out any process, the water suction mature seed after 3 hours, the water suction mature seed after 6 hours, the water suction mature seed after 9 hours, the water suction mature seed after 12 hours or the water suction mature seed after 24 hours.
1, get sample to be tested, extract total serum IgE and reverse transcription.
2, the reverse transcription product that step 1 obtains is got, by the expression level of the real-time quantitative PCR of Taqman probe detection miRNA-wz.
For detecting the target sequence of the Taqman probe of miRNA-wz it is: UCUGGCGAGGGACAUACACUGU.
Adopt U6 gene to be internal reference, for detecting the target sequence of the Taqman probe of internal reference it is: UAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGC ACAAAUCGAGAAAUGGUCCAAAUUU.
PCR program: 95 DEG C of sex change 10min; 95 DEG C of sex change 15s, 60 DEG C of annealing 60s, 40 circulations. Adopt compare threshold method that real-time quantitative PCR result is carried out quantitative analysis, fluorescence thresholding is set by hand, it is determined that specific cycle number Ct value under this fluorescence thresholding, calculate C value according to Ct value, C=2-Δ CT, Δ Ct=Ct target gene-Ct internal standard gene.
The results are shown in Figure 2. In Fig. 2, the embryo, 7 of 1 be the pollination embryo, 2 of seed of latter 15 days be the embryo, 3 of the pollination seed of latter 20 days be the embryo, 4 of the pollination seed of latter 28 days be the embryo, 5 of the mature seed not carrying out any process be the embryo, 6 of the mature seed of water suction after 3 hours the be mature seed after absorbing water 6 hours is the embryo, 8 of the mature seed after absorbing water 9 hours be the embryo, 9 of the mature seed after absorbing water 12 hours is the embryo of the mature seed after absorbing water 24 hours. Result shows: miRNA-wz up-regulated expression gradually in Seed development; In Seed sprouting process, miRNA-wz Seed imbibition after 6 hours expression level reach the highest, and within for some time afterwards, keep the expression of higher level, illustrate that miRNA-wz may play some effect in seed germination process.
Embodiment 3, recombinant expression vector build
1, extract Chinese spring embryo of sprouting total serum IgE and reverse transcription is cDNA, take cDNA as template, adopt SmaI-L and SacI-R composition primer pair carry out pcr amplification, obtain pcr amplification product.
SmaI-L:5 '-TCCCCCGGGCAACGATTGATTCGTCGTAGGA-3 ';
SacI-R:5 '-CGAGCTCGGATTTGTTCTCAATTACACAG-3 ';
In SmaI-L and SacI-R, underscore marks SmaI and SacI restriction enzyme site respectively.
2, with the pcr amplification product of Restriction enzyme Sma I and SacI double digestion step 1, digestion products is reclaimed.
3, with Restriction enzyme Sma I and SacI double digestion pAHC25 carrier, the carrier framework of about 7.9kb is reclaimed.
4, by the carrier framework connection of the digestion products of step 2 and step 3, recombinant plasmid pAHC25-miRwz is obtained. According to sequencing result, recombinant plasmid pAHC25-miRwz is carried out structure and is described below: the small segment between SmaI and the SacI restriction enzyme site of pAHC25 carrier is replaced in order to the double chain DNA molecule shown in the sequence 2 of sequence table.
5, with Restriction enzyme Sma I and SacI double digestion pWMB003 carrier, the carrier framework of about 4.5kb is reclaimed.
6, by the carrier framework connection of the digestion products of step 2 and step 5, recombinant plasmid pWMB003-miRwz is obtained. According to sequencing result, recombinant plasmid pWMB003-miRwz is carried out structure and is described below: the small segment between SmaI and the SacI restriction enzyme site of pWMB003 carrier is replaced in order to the double chain DNA molecule shown in the sequence 2 of sequence table.
Embodiment 4, wheat immature embryo transient expression
1, getting the pollination wheat CB037 seed of latter 10-12 days, first with 70% Ethanol Treatment 2min, then process 15min with chlorine bleach liquor's (available chlorine 0.5%, volume ratio), then sterilizing washes three times.
2, get the seed that step 1 obtains, separation children's embryo, and children's embryonic shield sheet is placed on the 1/2MS solid medium containing 200mg/LMES and 150g/L maltose upward, 25 DEG C of dark processing 3-4h.
3, particle gun bullet is made with recombinant plasmid pWMB003-miRwz or pWMB003 carrier, the young embryo that implant steps 2 obtains.
4, after completing steps 3, get children's embryo, dark processing 1 day, then children's embryonic shield sheet is transferred on the 1/2MS solid medium containing 200mg/L and 30g/L maltose down, 25 DEG C of cultivations, every 24 hours statistics percentage of germination in culturing process.
Percentage of germination the results are shown in Figure 3 (X-coordinate is number of days, and every 24 hours is 1 day). Fig. 4 is shown in by the photo cultivated 8 days in step 4. Result shows, the percentage of germination of the young embryo of bombardment recombinant plasmid pWMB003-miRwz, significantly lower than the young embryo of bombardment pWMB003 carrier, illustrates that overexpression miRNA-wz provided by the invention can suppress the sprouting of children's embryo.
5, after step 4 being cultivated 4 days, utilize the expression (method is with the step 2 of embodiment 2) of miRNA-wz in real-time quantitative PCR detection children's embryo of Taqman probe, the results are shown in Figure 5. Result shows, in the young embryo of bombardment recombinant plasmid pWMB003-miRwz, the expression level of miRNA-wz is obviously higher than the young embryo of bombardment pWMB003 carrier.
Embodiment 5, functional analysis
One, transfer-gen plant is obtained
1, get recombinant plasmid pAHC25-miRwz, adopt the Immature embryo calli of particle gun bombardment Ji wheat 5265, obtain T0 for plant.
2, T0 is for plant selfing, obtains T1 for plant. T1, for plant selfing, obtains T2 for plant. T2, for plant selfing, obtains T3 for plant.
3, T0 carries out following PCR qualification for plant, T2 for plant for plant, T1: extract plant genomic dna to be measured, the primer pair (target sequence is the Barsta gene in carrier framework) of BAR1 and BAR2 composition is adopted to carry out PCR qualification, if obtain the amplified production of about 450bp, plant to be measured is transfer-gen plant, if not obtaining described amplified production, treating measuring plants being non-transgenic plant. For a certain transgenosis T1 for plant, if the T2 of this plant and sampling Detection thereof is transfer-gen plant for plant, this plant is the transfer-gen plant isozygotied, and this plant and self progeny thereof are the transgenic line isozygotied. Part T1 is shown in Fig. 6 (each swimming lane represents 1 plant) for the PCR qualification result of plant.
BAR1:5 '-GTCTGCACCATCGTCAACC-3 ';
BAR2:5 '-GAAGTCCAGCTGCCAGAAAC-3 '.
4, the T3 getting 3 Transgenic wheat lines (OE5, OE6 and OE8) at random, for plant, utilizes the expression (method is with the step 2 of embodiment 2) of the real-time quantitative PCR detection miRNA-wz of Taqman probe, the results are shown in Figure 7. Result shows, in transgenic line, the expression level of miRNA-wz at least improves 2 times.
Two, acquisition turns empty carrier plant
Replace recombinant plasmid pAHC25-miRwz to carry out step one with pAHC25 carrier, obtain turning empty carrier plant.
Three, wheat germination character observation
1, miRNA-wz is on the impact of wheat seeds sprouting speed
The T3 getting 3 Transgenic wheat lines (OE5, OE6 and OE8) at random, for seed, gets the T3 turning empty carrier plant for seed, gets Ji wheat 5265 seed, carries out following parallel test respectively:
By seed embryo upwards, abdomen ditch be placed in downwards in the little culture dish (diameter is 5cm) being lined with two layers of filter paper, add 5ml sterile purified water, 23-25 DEG C of quiescent culture, taking seed grain sprout as germinate, every 24 hours statistics number of shoots, calculate percentage of germination.
Carry out three revision tests, each strain 35 seeds in each revision test, results averaged.
Ji wheat 5265 seed and OE5 strain seed quiescent culture are shown in Fig. 8 with the photo of quiescent culture after 48 hours in 24 hours. 1st day, the 2nd day and the 3rd day, the percentage of germination of each strain the results are shown in Figure 9 (X-coordinate is number of days, and every 24 hours is 1 day).
Result shows, the seed of transgenic line at the percentage of germination of quiescent culture after 24 hours and 48 hours significantly lower than Ji wheat 5265, miRNA-wz inhibits seed germination, but the seed of the percentage of germination of quiescent culture seed of transgenic line after 72 hours and Ji wheat 5265 does not have notable difference, this illustrates that miRNA-wz is only reduction of the speed of germination of seed, does not reduce the percentage of germination of seed. Quiescent culture is after 24 hours, 48 hours and 72 hours, and the seed of the percentage of germination and Ji wheat 5265 that turn the seed of empty carrier plant does not all have significant difference.
2, miRNA-wz is on the impact of wheat ear germinating
The T3 getting 3 Transgenic wheat lines (OE5, OE6 and OE8) at random, for plant, gets the T3 turning empty carrier plant for plant, gets Ji wheat 5265 plant, carries out following parallel test respectively:
Getting ripe plant, 5 fringes are bundled into a bundle, take out in water after soaking at room temperature 1h, be placed in plastics bag and tighten bag mouth after throwing away the unnecessary globule, and 23-25 DEG C of quiescent culture 7 days, then adds up Spike sprouting rate (have taking seed grain and sprout or sprouts as germination).
Carry out three revision tests, each strain 5 fringe in each revision test, results averaged.
Figure 10 is shown in by Ji wheat 5265 and the photo of OE5 strain plant quiescent culture after 7 days. Quiescent culture is after 7 days, and the Spike sprouting rate of each strain the results are shown in Figure 11. Result shows, the ability of the Spike sprouting of transgenic line is significantly lower than Ji wheat 5265, and Spike sprouting is had restraining effect by overexpression miRNA-wz. Quiescent culture is after 7 days, and the Spike sprouting rate and the Ji wheat 5265 that turn empty carrier plant do not have significant difference.
Claims (10)
1. cultivate a method for transgenic plant, comprise the steps: specific DNA molecular is imported the plant that sets out, obtain the transgenic plant that Spike sprouting ability reduces; Described specific DNA molecular is following (1) or (2) or (3) or (4):
(1) DNA molecular shown in sequence 1 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table;
(3) the DNA sequence dna hybridization limited with (1) or (2) under strict conditions and the DNA molecular with identical function;
(4) DNA sequence dna limited with (1) or (2) has more than 90% homology and has the DNA molecular of identical function.
2. cultivate a method for transgenic plant, comprise the steps: specific DNA molecular is imported the plant that sets out, obtain the transgenic plant of seed germination decrease in velocity; Described specific DNA molecular is following (1) or (2) or (3) or (4):
(1) DNA molecular shown in sequence 1 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table;
(3) the DNA sequence dna hybridization limited with (1) or (2) under strict conditions and the DNA molecular with identical function;
(4) DNA sequence dna limited with (1) or (2) has more than 90% homology and has the DNA molecular of identical function.
3. a miRNA, as shown in the sequence 3 of sequence table.
4. encode the DNA molecular of miRNA described in claim 3, it be following (a1) or (a2) or (a3):
(a1) DNA molecular shown in sequence 1 in sequence table;
(a2) the DNA sequence dna hybridization limited with (a1) under strict conditions and the DNA molecular with identical function;
(a3) DNA sequence dna limited with (a1) has more than 90% homology and has the DNA molecular of identical function.
5. a RNA, as shown in the sequence 4 of sequence table.
6. encode the DNA molecular of RNA described in claim 5, it be following (b1) or (b2) or (b3):
(b1) DNA molecular shown in sequence 2 in sequence table;
(b2) the DNA sequence dna hybridization limited with (b1) under strict conditions and the DNA molecular with identical function;
(b3) DNA sequence dna limited with (b1) has more than 90% homology and has the DNA molecular of identical function.
7. recombinant vectors containing DNA molecular described in claim 4 or 6, expression cassette, transgenic cell line or restructuring bacterium.
8. the application of miRNA described in claim 3 or DNA molecular described in claim 4 is following (c1), (c2), (c3) or (c4):
(c1) regulating plant Spike sprouting ability;
(c2) regulating plant seed germination speed;
(c3) plant Spike sprouting ability is reduced;
(c4) plant seed germination speed is reduced.
9. the application of RNA described in claim 5 or DNA molecular described in claim 6 is following (c1), (c2), (c3) or (c4):
(c1) regulating plant Spike sprouting ability;
(c2) regulating plant seed germination speed;
(c3) plant Spike sprouting ability is reduced;
(c4) plant seed germination speed is reduced.
10. method described in claim 1 or 2, or, miRNA described in claim 3, or, DNA molecular described in claim 4, or, RNA described in claim 5, or, the application of DNA molecular described in claim 6 in plant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610121816.9A CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610121816.9A CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671047A true CN105671047A (en) | 2016-06-15 |
| CN105671047B CN105671047B (en) | 2018-09-28 |
Family
ID=56307942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610121816.9A Active CN105671047B (en) | 2016-03-03 | 2016-03-03 | A kind of miRNA and its application in regulation and control wheat seeds sprouting speed and Spike sprouting ability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671047B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101952444A (en) * | 2007-12-21 | 2011-01-19 | 巴斯夫植物科学有限公司 | Plants with increased yield (KO NUE) |
| CN104651366A (en) * | 2015-02-09 | 2015-05-27 | 山东农业大学 | microRNA408 of wheat as well as coded gene and application of microRNA408 |
| CN105177001A (en) * | 2015-09-15 | 2015-12-23 | 中国科学院遗传与发育生物学研究所 | MiR167d related to barley powdery mildew resistance and application thereof |
-
2016
- 2016-03-03 CN CN201610121816.9A patent/CN105671047B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101952444A (en) * | 2007-12-21 | 2011-01-19 | 巴斯夫植物科学有限公司 | Plants with increased yield (KO NUE) |
| CN104651366A (en) * | 2015-02-09 | 2015-05-27 | 山东农业大学 | microRNA408 of wheat as well as coded gene and application of microRNA408 |
| CN105177001A (en) * | 2015-09-15 | 2015-12-23 | 中国科学院遗传与发育生物学研究所 | MiR167d related to barley powdery mildew resistance and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| RAN HAN等: "《Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)》", 《BMC GENOMICS》 * |
| YINGYIN YAO等: "《Cloning and characterization of microRNAs from wheat (Triticum aestivum L.). Genome Biology》", 《GENOME BIOLOGY》 * |
| 王波等: "《植物中microRNA的合成及在发育和抗逆中的作用》", 《植物生理学通讯》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671047B (en) | 2018-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102559666B (en) | Plant virus inhibitory artificial miRNA (microRNA) and construction and application thereof | |
| CN104830847A (en) | Nucleic acid sequence for detecting corn plant DBN9936, and detection method thereof | |
| Beena et al. | Association mapping of drought tolerance and agronomic traits in rice (Oryza sativa L.) landraces | |
| CN104878091A (en) | Nucleic acid sequence for detecting corn plant DBN9978 and detection method of nucleic acid sequence | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| CN110144363A (en) | Pest-resistant herbicide-resistant corn transformation event | |
| CN108368515A (en) | Drought tolerant corn | |
| CN104878092A (en) | Nucleic acid sequence for detecting corn plant DBN9953 and detecting method thereof | |
| CN117082972A (en) | Plant resistance genes and means for their identification | |
| CN101805399B (en) | Protein associated with thousand grain weight of wheat and encoding gene and application thereof | |
| CN103160584B (en) | Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance | |
| CN104830983A (en) | Nucleic acid sequence for detecting corn plant DBN9968, and detection method thereof | |
| CN105331689B (en) | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof | |
| CN108795944A (en) | Cotton long-chain non-coding RNA-lnc973 and its application in plant salt endurance | |
| CN113179884B (en) | Method for cultivating high-yield wheat with gibberellic disease resistance in Huanghuai wheat area based on polygene polymerization | |
| CN112410460B (en) | Stably expressed molecular marker closely linked with cold-resistant QTL (quantitative trait locus) in rice germination stage and application thereof | |
| WO2022266081A2 (en) | Agronomic practices and sustainability methods involving yield traits | |
| CN105671047A (en) | miRNA (microribonucleic acid) and application thereof in regulating wheat seed germination speed and pre-harvest sprouting capacity | |
| CN103397081B (en) | Primer for detecting exogenous gene in transgenic rice T1C-19, and detection method thereof | |
| CN103305529B (en) | ZmWRKY50 gene improves the application of plant alumite | |
| Carsono et al. | Agronomic characteristics and genetic relationship of putative transgenic rice lines of cv. Fatmawati with the Glu-1Dx5 transgene | |
| CN107779522B (en) | Specific codominant molecular marker of brown planthopper resistant gene Bph15 of rice and application thereof | |
| CN104846084A (en) | Nucleic acid sequence for detecting corn plant DBN9927 and detection method of nucleic acid sequence | |
| CN106497924B (en) | The construction method of anti-snout moth's larva resistance glyphosate transgenic paddy rice KCRC04 | |
| CN104878097A (en) | Nucleotide sequence and detection method for detecting corn plant DBN9981 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |