CN105567715B - Schizochytrium limacinum alpha-tubulin related sequence and application thereof - Google Patents

Abstract

The invention relates to a Schizochytrium alpha-tubulin related sequence and application thereof, in particular to a Schizochytrium alpha-tubulin gene sequence shown in SEQ ID NO. 1, a Schizochytrium alpha-tubulin sequence shown in SEQ ID NO. 2 and a non-coding region sequence at the 3' end of the Schizochytrium alpha-tubulin gene shown in SEQ ID NO. 3. The invention also relates to fragments of the gene sequences, recombinant nucleic acid molecules containing the gene sequences or the fragments thereof, application of the recombinant nucleic acid molecules in homologous recombination, and a method for analyzing gene functions by using the recombinant nucleic acid molecules.

Description

Schizochytrium limacinum alpha-tubulin related sequence and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a Schizochytrium limacinum alpha-tubulin related sequence and application thereof.

Background

Schizochytrium sp grows rapidly, biomass can reach 200g/L, and DHA yield can reach 0.69g/L.h (CN 1416320A). It is clearly an excellent engineered bacterial group if it can produce enzyme proteins while maintaining such high growth performance. Can be fermented in high density, grows fast, has little extracellular protein, and the schizochytrium has the potential of becoming an exogenous gene expression host.

The use of Schizochytrium sp for foreign gene expression is disclosed at home and abroad, such as Bayne et al extracellular expression of recombinant Hemagglutinin (Hemaglutinin) [ Bayne AC, Boltz D, Owen C, etc. ], vaccine against fluxuenza with recombinant Hemagglutinin expressed by Schizochytrium sp. sensors protective immunity, PLOS,8(4) ]; SexI secretion signal-mediated secretion expression disclosed in CN 102648207A; CN 102220369 agrobacterium is transformed into GUS gene and EGFP gene to be expressed in Schizochytrium TI 01101; US7759097 discloses a terminator using the Elongation factor (Elongation factor 1 α), actin (actin), glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase) genes and a homologous integration strategy based on the 18S rDNA nucleic acid sequence. There is no report on the expression of lipase in schizochytrium limacinum.

Currently, at home and abroad, only tubulin promoter, expression system of Labyrinth μ lomycota, terminator using Elongation factor (Elongation factor 1 α), actin (actin), glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase) gene and 18S rDNA nucleic acid sequence-based homologous integration strategy are disclosed. Homologous integration means introducing a foreign nucleic acid vector into the genome will certainly alter the sequence and structure at the site of integration, resulting in gene inactivation or altered expression levels. For example, a promoter (typically a segment downstream of the promoter region) would obviously be a homologous integration site that would move the coding region of the gene away from the original location of the promoter, and thus away from possible expression regulatory elements upstream of the promoter region used for recombination, and cell growth would be affected almost certainly; the gene is inactivated by using the coding gene as a homologous site. In addition, rDNA is used as an integration site, but rDNA transcriptional control mechanism is very complicated, and 18S is used as a homologous integration site, which may affect cell growth. In most microorganisms, this difference may be of less importance. However, the schizochytrium limacinum can accumulate DHA, and the biomass yield is very important to the DHA yield, so that the growth of thalli is not inhibited as much as possible while exogenous genes are expressed. The existing invention and technical disclosure do not refer to the growth change of the recombinant schizochytrium.

Eukaryotic organisms use the genome as a template, and the transcribed mRNA usually contains a 5 'cap, a coding part, a 3' UTR, an AAUAAA site, a poly A site 10-30bp after AAUAAA, and a poly (A) tail (Wuneligo. gene engineering principles, Beijing: science publishers, second edition 2001), where AAUAAA is the recognition site required for dissociation of mRNA precursors from transcription complexes and polyadenylation (poly (A)) modification, and is highly conserved (Benjamin Levin. GENES VIII, Upper Sable River: Pearson Prentice Hall, 2004; Li Ming Dyn., advanced molecular genetics, Beijing: science publishers, first edition 2004). Obviously, the terminal AATAAA site of the gene corresponds to the genome and is a sequence necessary for the normal expression of the gene. The sequence between the polyA recognition site at the 3' end of the gene and the stop codon is used as the site of homologous recombination, and the expression of the gene is probably influenced, so that the growth characteristics of the host cell are changed. However, it is theoretically impossible to affect the host cell by using the sequence following the polyA site as a homologous integration site or the entire sequence from the stop codon to the polyA site as a homologous integration site. The invention obtains the tubulin 3' end with 1600bp, and no AATAAA conserved sequence exists.

For a microorganism whose genome is not sequenced, it is necessary to use "capture" technology (trap) in order to obtain functional genomic fragments, such as promoters, secretion signal peptides, terminators, etc. That is, a cis-element is composed of a reporter gene and an unknown genome fragment, and the activity of the reporter gene is used to examine whether the inserted genome fragment is functional. Then, the inserted sequence was obtained by PCR amplification and sequencing. This work is simple for microorganisms with episomal plasmids but is cumbersome for microorganisms without episomal plasmids, since the vector for the trap must integrate into e.g.the genome, which requires that the vector must have fragments on the host genome; therefore, after the trap vector enters the cell, the integration occurs at the homologous site of the fragment to be screened, which brings great trouble to the subsequent sequence acquisition work, because the sequence to be acquired is only the sequence at the side of the reporter gene and is clear, researchers do not know the sequence at the other end of the gene to be detected, and can only go through a strategy of genome read-through to amplify a little, and the difficulty is large, and the workload is complicated; in addition, the length of the functional fragment cannot be confirmed, and a large amount of inspection work is required.

Therefore, there is still a need for an improved homologous recombination tool with which the skilled person can perform homologous integration without affecting the growth of the host and can perform capture of promoters, terminators or secretion signal peptides, etc.

Disclosure of Invention

The invention obtains the tubulin whole gene and the non-coding region at the 3' end of the gene by degenerate primers and a chromosome walking technology according to the known partial tubulin gene promoter sequence. The alpha-tubulin gene of the invention has 1362bp, and the whole or a part of the alpha-tubulin gene can be used as a homologous integrated fragment; the 3' end non-coding region of the alpha-tubulin has 1597bp, and the whole or a part of the alpha-tubulin can also be used as a site for homologous integration of a foreign gene into a genome.

The invention uses a section of sequence at the 3' end of the tubulin gene as a site for homologous integration, and finds that the growth influence on host cells is small. The biomass of the recombinant schizochytrium limacinum obtained by the invention is 96.5-97.1% of that of the wild type strain respectively. The tubulin promoter sequence disclosed in CN02812059 is used as the promoter of the exogenous gene and the only homologous integration site, and the recombinant schizochytrium limacinum is cultured in the same way, and the biomass of the obtained recombinant schizochytrium limacinum is 78.2-86.5% of that of the wild strain. The region disclosed in the present invention does not affect the growth of the host bacterium, and it is presumed that the nucleic acid comprising the homologous integration region used for homologous recombination (extension of the sequence at both ends alone or both) does not affect the growth of the host.

In particular, the present invention provides an isolated nucleic acid molecule selected from the group consisting of:

(1) 1 or 3 or a fragment of SEQ ID NO 1 or 3 or a nucleotide sequence comprising SEQ ID NO 1 or 3 or a fragment thereof;

(2) a nucleotide sequence complementary to the nucleotide sequence of (1); and

(3) a nucleic acid molecule which hybridizes with the nucleotide sequence of (1) or (2) under stringent conditions.

In a specific embodiment, the fragment is at least 200 contiguous nucleotides, at least 300 contiguous nucleotides, at least 400 contiguous nucleotides, at least 500 contiguous nucleotides, at least 600 contiguous nucleotides, at least 700 contiguous nucleotides, at least 800 contiguous nucleotides, at least 900 contiguous nucleotides, or at least 1000 contiguous nucleotides in length.

In one embodiment, the fragment comprises at least nucleotides 1 to 756 of SEQ ID NO. 1.

In a specific embodiment, the fragment contains at least nucleotides 1-562 of SEQ ID NO. 3.

In one embodiment, the fragment comprises at least nucleotides 1-797 of SEQ ID NO. 3.

The invention provides a recombinant nucleic acid molecule which comprises a nucleotide sequence shown in SEQ ID NO. 1 or 3 or a fragment thereof.

The recombinant nucleic acid molecule of the invention may be a vector for providing SEQ ID NO 1 or 3 or fragments thereof.

The recombinant nucleic acid molecule of the invention may also be an expression vector for the recombinant expression of tubulin encoded by SEQ ID NO. 1.

The recombinant nucleic acid molecules of the invention may contain the nucleic acid molecules of the invention as well as the foreign gene of interest.

The recombinant nucleic acid molecule of the invention may also be a targeting vector for homologous recombination of a gene of interest into the host genome (e.g., an insertion vector) or to disable a gene of interest (e.g., an alternative vector).

In a particular embodiment, the genes of interest include, but are not limited to, lipase genes, protease genes, esterases, phospholipases, and cellulases.

The recombinant nucleic acid molecule of the invention may also be a capture vector for screening, obtaining and/or identifying functional genomic fragments of interest, such as promoters, secretion signal peptides and terminators, etc., in a host.

In one embodiment, the capture vector comprises a first reporter gene, a second reporter gene, a host constitutively expressed tubulin gene and a test gene sequence, wherein the first reporter gene is expressed in fusion with the host constitutively expressed tubulin gene, and the second reporter gene is a reporter gene of the test gene sequence; inserting a gene sequence to be detected into the upstream of the second reporter gene to verify whether the gene sequence has the function of a promoter; or inserting a gene sequence to be detected into the downstream of the second reporter gene to verify whether the gene sequence has a transcription termination function; or introducing a promoter at the upstream of a second reporter gene, and inserting a gene sequence to be tested between the promoter and the second reporter gene to verify whether the gene fragment has the function of secreting a signal peptide.

In one embodiment, the first reporter gene is a zeocin antibiotic resistance gene (ble gene, for short) expressed in fusion with a host gene to be analyzed. The host gene is a constitutively expressed gene; the fusion expression is the fusion expression of the 5' end peptide segment of the constitutive expression gene coding region and the second amino acid of the ble gene.

Preferably, the constitutive expression gene is a tubulin gene. In a specific embodiment, the constitutively expressed tubulin gene is set forth in SEQ ID NO 1.

In one embodiment, the second reporter gene is a gene with characterizable activity, including but not limited to chemical manifestation (e.g., galactosidase, β -glucuronidase, phosphatase, phospholipase, protease, lipase, etc., genes that exhibit color with a particular substrate on the screen plate), chemiluminescence (e.g., luciferase gene, horseradish peroxidase, alkaline phosphatase, etc.), resistance genes (ampicillin, kanamycin, hygromycin, G418, etc.), and the like.

The present invention relates to the use of the nucleic acid molecules or recombinant nucleic acid molecules or vectors of the invention for homologous recombination and for screening, obtaining and/or identifying functional genomic segments of interest in a host, etc.

The present invention provides a host cell comprising a recombinant nucleic acid molecule of the present invention.

In a specific embodiment, the host cell is from schizochytrium and expresses a rhizomucor miehei lipase.

The present invention also provides a method for analyzing gene function, comprising:

(1) transforming a host cell with a recombinant nucleic acid molecule of the invention; and

(2) analyzing the function of the gene according to the expression condition of the reporter gene.

In one embodiment, the host cell is transformed with a recombinant nucleic acid molecule comprising: the recombinant nucleic acid molecule is a capture vector and contains a first reporter gene, a second reporter gene, a tubulin gene constitutively expressed by the host and a gene sequence to be detected, wherein the first reporter gene is expressed by fusion with the tubulin gene constitutively expressed by the host, and the second reporter gene is the reporter gene of the gene sequence to be detected; wherein, a gene fragment to be detected is inserted into the upstream of the second reporter gene; wherein, when the second reporter gene is expressed, the gene sequence to be detected is indicated to have the function of a promoter.

In one embodiment, the host cell is transformed with a recombinant nucleic acid molecule comprising: the recombinant nucleic acid molecule is a capture vector and contains a first reporter gene, a second reporter gene, a host constitutive expression tubulin gene and a gene sequence to be detected, wherein the first reporter gene and the host constitutive expression tubulin gene are subjected to fusion expression, and the second reporter gene is the reporter gene of the gene sequence to be detected; wherein, the gene sequence to be tested is inserted into the downstream of the second reporter gene, and when the second reporter gene has activity, the inserted segment can terminate the transcription of the gene, namely has the function of transcription termination.

In one embodiment, the host cell is transformed with a recombinant nucleic acid molecule comprising: the recombinant nucleic acid molecule is a capture vector and contains a first reporter gene, a second reporter gene, a host constitutive expression tubulin gene and a gene sequence to be detected, wherein the first reporter gene and the host constitutive expression tubulin gene are subjected to fusion expression, and the second reporter gene is the reporter gene of the gene sequence to be detected; wherein, a promoter is introduced at the upstream of the second reporter gene, and a test gene sequence is inserted between the promoter and the second reporter gene, when the activity of the second reporter gene is detected outside cells, the incorporated test gene sequence can guide the reporter gene to secrete outside cells, namely, the peptide segment coded by the gene sequence has the function of secreting signal peptide.

The present invention also provides a method of homologous recombination using a gene of α -tubulin or a fragment thereof or a gene of α -tubulin 3' non-coding region or a fragment thereof as a fragment for homologous integration.

In a specific embodiment, the alpha-tubulin gene is represented by SEQ ID NO 1.

In a specific embodiment, the fragment comprises at least nucleotides 1 to 756 of SEQ ID NO. 1, or at least nucleotides 1 to 562 of SEQ ID NO. 3, or at least nucleotides 1 to 797 of SEQ ID NO. 3.

The invention also provides a kit for homologous recombination or a product for analyzing gene function, the kit or the product comprising the recombinant nucleic acid molecule of the invention, or comprising an alpha-tubulin gene or a fragment thereof or an alpha-tubulin 3' non-coding region gene or a fragment thereof; preferably, the product is a kit.

In a specific embodiment, the alpha-tubulin gene is represented by SEQ ID NO 1.

In a specific embodiment, the fragment comprises at least nucleotides 1 to 756 of SEQ ID NO. 1, or at least nucleotides 1 to 562 of SEQ ID NO. 3, or at least nucleotides 1 to 797 of SEQ ID NO. 3.

Drawings

FIG. 1: electrophoresis picture of PCR product of amplified tubulin gene. The numerical label is the name of the downstream primer used and the arrow indicates the band of successfully amplified PCR product. Of the six primers, only "300" successfully completed amplification.

FIG. 2: and (3) a gradient PCR result graph with the schizochytrium RNA solution and the RNA reverse transcription product as templates. M is 1000bp DNA Ladder of Takara company, and A-H is electrophoresis of amplification products of six temperature gradients. Four labeled A, B, E, F products were used for subsequent experiments.

FIG. 3: schematic diagram of a scheme for amplifying tubulin sequence by gene read-through mode. Primers represent the four degenerate primers described above for AD 1-4.

FIG. 4: the gene reads the third round of the product electrophoretogram. In the figure, AD1, AD2, AD3 and AD4 are degenerate primers designed by the invention; AP1, AP3 and AP4 are degenerate primers provided by Takara Genome Walking kit.

FIG. 5: and (3) selecting the homologous recombination mediated by the 3' non-coding region of the tubulin for later use, and carrying out enzyme digestion on the plasmid to check an electrophoretogram.

FIG. 6: after zeocin-resistant colonies obtained from the screening plates were transferred to rhodamine plates, the resulting photographs were cultured. 4. 6, 38 and 39 are strain numbers.

FIG. 7: identification of recombinant Schizochytrium sp.is a schematic representation of the position of primers used in the 3' non-coding region of tubulin.

FIG. 8: the 39# recombinant schizochytrium sp electrophoretogram was checked by PCR across the integration sites.

FIG. 9: and (3) taking the recombinant schizochytrium 39# genome DNA as a template, and carrying out PCR (polymerase chain reaction) test on a result graph.

FIG. 10: and the rhodophyta schizochytrium fermentation supernatant (CS), the thallus homogenate (CH) and the thallus Homogenate Supernatant (HS) are used as rhodamine flat plate color development result photos. 39#, 38# are two recombinant Schizochytrium cultures, Wild is Wild type strain (Wild type) culture.

FIG. 11: and (3) performing electrophoresis image on RML recombinant schizochytrium limacinum and wild schizochytrium limacinum cell lysate supernatant. The Marker is a protein standard, the left side of the Marker is a recombinant schizochytrium limacinum protein Ni purification electrophoresis pattern, and the right side of the Marker is a wild type schizochytrium limacinum protein Ni purification electrophoresis pattern. In the figure, WTLS is a supernatant of a wild schizochytrium limacinum lysate, RSLS is a supernatant of a recombinant schizochytrium limacinum lysate, Pentrate is protein which is not adsorbed by Ni, and Elute 1(2) is a sample for eluting for the first time and the second time. Marker was the protein Ladder prepigmented by PageR μ lerTM (#26616) from Thermo Scientific.

FIG. 12: the tubulin transcription termination region is used as a homologous integration site, and the vector schematic diagram of introducing the mortierella alpina gene into the schizochytrium genome is shown.

FIG. 13: wild type schizochytrium limacinum lipid gas chromatogram.

FIG. 14: TTM recombinant Schizochytrium limacinum lipid gas chromatogram.

FIG. 15: 8M recombinant Schizochytrium limacinum lipid gas chromatogram.

FIG. 16: structure of tubzeo1301 plasmid.

FIG. 17: the position of the obtained fragment having promoter activity on the genome is captured (Trap). The sequence of the trap product is in black and the gene coding sequence beginning with the start codon is in grey. The blank is the gap between the trap product and its actual codon of the gene. The upper numbers indicate the positions on the scaffold corresponding to the beginning and end of the nucleic acid of the present invention in the genome sequencing results.

Detailed Description

As shown in the examples, the sequence of the alpha-tubulin coding sequence and the 3' non-coding region of Schizochytrium (Schizochytrium) is obtained by a series of steps. The alpha-tubulin coding sequence is shown in SEQ ID NO. 1, the coded amino acid sequence is shown in SEQ ID NO. 2, and the 3' non-coding region sequence is shown in SEQ ID NO. 3.

The invention utilizes alpha-tubulin gene and its 3' end non-coding sequence or its fragment as exogenous vector to homologously integrate into the target region of schizochytrium genome.

"fragment" refers to a sequence that is contiguous with a portion of the full-length sequence. Typically, the length of a fragment of an α -tubulin gene of the invention or a non-coding sequence 3' thereto is at least 200 contiguous nucleotides, at least 300 contiguous nucleotides, at least 400 contiguous nucleotides, at least 500 contiguous nucleotides, at least 600 contiguous nucleotides, at least 700 contiguous nucleotides, at least 800 contiguous nucleotides, at least 900 contiguous nucleotides or at least 1000 contiguous nucleotides.

In specific embodiments of the present application, the fragment is nucleotides 1-756, 1-797 or 1-562 of SEQ ID NO. 1, SEQ ID NO. 3. However, it is understood that the length of the fragment may be appropriately lengthened or shortened for the purpose of achieving homologous recombination, which can be easily determined by those skilled in the art in view of practical circumstances.

The invention also includes nucleotide sequences complementary to SEQ ID NO 1, 3 or fragments thereof, and sequences that hybridize under hybridization conditions to SEQ ID NO 1, 3 or fragments thereof. The hybridization conditions described by the inventors, including standard hybridization conditions, moderately stringent hybridization conditions, and highly stringent hybridization conditions, are described in CN 1556850a, which is incorporated herein by reference in its entirety.

The full-length sequence of the nucleic acid molecule of the present invention or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, the nucleic acid molecules of the invention can be obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art.

A method of amplifying DNA using PCR technology is preferably used to obtain the gene of the present invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

For the purpose of homologous recombination, the nucleic acid molecules of the invention are generally constructed in the form of vectors. The vector may contain the nucleic acid molecule of the invention, a foreign gene of interest, a marker gene, and other elements that fulfill the function of homologous recombination. For different homologous recombination purposes, the vector may also contain corresponding elements, such as promoters, enhancers, etc. of the foreign gene of interest.

The "foreign gene" as referred to herein refers to a gene introduced from the outside of a host, regardless of whether the host itself already has the gene.

Thus, the vectors of the invention may be, for example, targeting vectors for homologous recombination of a gene of interest into the host genome (e.g., or insertion-type vectors), or for loss of function of a gene of interest (e.g., alternative vectors); it may also be a capture vector for screening, obtaining and/or identifying functional genomic fragments of interest in a host, such as promoters, secretion signal peptides and terminators.

As an example of the vector of the present invention, the vector of the present invention is constructed using a pGAPZ alpha-A vector based on Invitrogen corporation. The construction process uses endonuclease, ligase, dephosphorylation, PCR enzyme, etc. familiar to researchers in this field, and is performed according to the manufacturer's instructions. The vector contains Rhizomucor Miehei Lipase (RML) gene (GenBank: A02536.1); initiating the expression of RML using a yeast transcription elongation factor promoter (pTEF) from the vector pGAPZ α a; the expression uses the yeast alcohol oxidase gene termination sequence (3 'AOX) to terminate the expression of RML, the 3' AOX being from the yeast expression vector pGAPZ α a; the expression uses the schizochytrium tubulin gene termination region as a homologous integration site.

The end of RML gene on the vector is fused and expressed with a 6 XHIS label on pGAPZ alpha-A vector, so that the product expressed by exogenous RML gene can be purified by the specific adsorption of Nickel (NI) to HIS. The invention uses gel (NI bead for short) with covalent cross-linked NI to purify the protein in the cell fluid of the recombinant Schizochytrium limacinum, and adsorbs the protein in the cell fluid of the wild strain as a contrast. The NI beads having adsorbed proteins were washed thoroughly, and then the adsorbed proteins were eluted with an eluent and detected by SDS-PAGE electrophoresis. The adsorption, washing and elution operations were performed according to the NI bead product instructions and the SDS-PAGE electrophoresis was an experimental operation well known to researchers in the field. The invention discovers that the protein expressed by the recombinant schizochytrium limacinum is difficult to adsorb to NI in a natural state, so that the purification and elution operations of the invention are carried out under the high-variability condition, and the activity of an adsorption band cannot be detected. The invention uses p-nitrophenol palmitate (PNPP) which is well known by lipase researchers as a substrate for detecting the activity of lipase to detect whether exogenous RML is expressed or not. The methods and procedures for detecting the enzyme activity are well known to researchers in the field.

Further information on the carrier may be found in CN 1556850a, the disclosure of which is incorporated herein by reference in its entirety.

The nucleic acid molecule or vector of the present invention can realize gene knockout, gene replacement, etc.

The gene of interest includes various functional genes such as lipase genes, protease genes, esterases, phospholipases, cellulases, and the like.

The nucleic acid molecules or vectors of the invention may also be used to screen, obtain and/or identify functional genomic fragments of interest in a host, such as promoters, secretion signal peptides and terminators.

In one embodiment, the present invention provides a novel capture method using a capture support as follows: the vector contains two reporter genes, one of which is zeocin, which is expressed fused to the 5' end of the coding region of a constitutively expressed tubulin gene. Only when the capture vector is integrated into the host genome in the tubulin coding region will the expression of the tubulin-zeocin gene be initiated by the tubulin promoter, thereby conferring zeocin resistance on the recombinant cell. The vector also contains a second reporter gene (e.g., hygromycin) which is a reporter gene for capturing the promoter of interest, and the second reporter gene is expressed in the recombinant cell only when the genomic fragment inserted before the second reporter gene (e.g., hygromycin resistance gene) has the promoter function, so that the recombinant cell exhibits the corresponding biological activity, e.g., hygromycin resistance.

When the recombinant cell has zeocin and hygromycin dual resistance, the exogenous vector is integrated at a tubulin position in a fixed point manner in the recombinant cell, and the inserted segment before hygromycin has a promoter function. The invention is characterized in that the part of the fragment inserted before hygromycin is ensured to have activity, and the two edges of the fragment are clear and are elements on the vector, so that the workload of PCR amplification for obtaining the inserted fragment is small and the doubt is less. There is no question of how long amplification should be. The invention uses a part of the 5' end of the tubulin coding region of the constitutive gene of the schizochytrium limacinum as a site for homologous integration, and has the advantages that the constitutive expression can not cause silence due to the change of environment, thereby bringing false negative of capture; secondly, tubulin is generally present in several copies, and insertion at a single site does not result in cell death. Zeocin is one of bleomycin or bleomycin (bleomycin/phleomycin) families, and Zeocin is activated after entering a cell, and then binds to and cleaves the genome, resulting in cell death. The antibiotic has toxicity to bacteria, fungi, plant and animal cells, and has wide application range. The resistance gene for Zeocin antibiotics encodes a protein that binds reversibly to Zeocin and thereby prevents its cleavage of DNA.

The zeocin is used as a reporter gene, and the advantage is that the resistance of the gene is represented by reversibly combining with the antibiotic instead of modifying and cutting the antibiotic by other resistance genes, so that the resistance activity of the gene is not easily influenced by fusion during fusion expression.

Another reporter gene may be other than hygromycin, but other reporter-active genes, such as fluorescent, chemiluminescent, enzymes that display activity on the plate.

Similarly, in the vector, if the fragment to be analyzed is ligated downstream of the reporter gene, a genomic fragment having a transcription termination function can be selected; if a defined promoter is introduced upstream of the second reporter gene and then the genomic fragment to be analyzed is inserted between the promoter and the second reporter gene, a genomic fragment having the function of secreting a signal peptide can be selected.

The present invention also includes a host transformed with the vector of the present invention, particularly a host transformed with the vector of the present invention and expressing a lipase.

The invention will be made hereinafter by way of specific examples. It should be understood that the present invention is not limited to the following specific examples. In the examples, unless otherwise specified, the procedures were carried out according to the manufacturer's methods or the conventional methods.

Example one

According to the published promoter sequence of the alpha tubulin of the schizochytrium limacinum, an upstream primer is designed:

TubU：5’ACAAGGTCGATAAACTAAGCTCCTCAC(SEQ ID NO:4)；

several downstream primers were designed based on tubulin conservation:

31:TGATGCGCTCGAGCTGGAGGT(SEQ ID NO:5)；

206:TAGTGGCCCTTGGCCCAGTTGTTGC(SEQ ID NO:6)；

300:GTGGGTGATCTGGAAGCCCTGGAGGCAG(SEQ ID NO:7)；

547:GGGTGGTGAGCTTGAGGGTGCGGAAG(SEQ ID NO:8)；

796:CGGCGCACATCATGTTCTTGGCAT(SEQ ID NO:9)；

schizochytrium limacinum (ATCC 20888) was shake-cultured in YPDS medium (10g/L yeast powder, 10g/L peptone, 10g/L glucose, 18g/L sea salt, pH 6.8) at 28 ℃ and 200rpm for 3 days, centrifuged at 6000rpm for 10min to collect the cells, immediately pulverized in liquid nitrogen, and genomic DNA was extracted using 9770Q DNAiso reagent from Takara. The genomic DNA of Schizochytrium limacinum was used as a template, and amplified using Ex-taq enzyme from Takara. All PCR upstream primers are TubU, and downstream primers are different respectively; after each group of system components are added, the mixture is gently mixed, 25 mul/tube is subpackaged into 8 reaction tubes, and 8 PCR reactions with different temperatures are carried out. PCR was performed in a BIO-RAD MyCycler gradient PCR apparatus set at 64-55 ℃ with 8 gradients. The DNA was amplified using Takara Ex-Taq DNA polymerase, and the PCR system was as follows: 15 mul of water; 10 XPCR buffer 2.5. mu.l, dNTPs 2. mu.l at a concentration of 2.5mM each, 20uM primers 2. mu.l each, Ex-taq 0.1. mu.l, 100 ng/. mu.l genomic DNA 0.5. mu.l. The PCR program was set to 95 ℃ for 4 min; 33 cycles of: 94 ℃ for 30s, gradient 50s, 72 ℃ for 90 s; 10min at 72 ℃. The PCR products were analyzed by 1% agarose electrophoresis, and the results are shown in FIG. 1 (8 temperature conditions for each primer combination, 8 wells for smoking). A specific PCR product band was obtained using 300 as the downstream primer combination (FIG. 1, arrow).

Sequencing this band, resulting in the partial sequence of the tubulin:

ATGCGTGAGGTCATCTCCATCCACATCGGCCAGGCCGGTGTTCAGGTCGGTAACGCCTGCTGGGAGCTCTACTGCCTCGAGCATGGCATCCAGCCGGACGGCCAGATGCCCTCGGACAAGACCATTGGCGGCGGCGATGATGCCTTCAACACCTTCTTCTCCGAGACTGGCGCCGGCAAGCACGTGCCCCGCGCCGTGCTCGTCGATCTCGAGCCCACCGTCTGTGACGAGGTCCGCACCGGCACCTACCGCGCTCTTTACCACCCCGAGCAGATCATCACCGGCAAGGAGGACGCTGCCAACAACTACGCTCGTGGCCACTACACCATCGGCAAGGAGATCGTCGACCTCGTCCTCGACCGCATCCGCAAGCTCGCCGACAACTGCACTGGCCTCCAGGGCTTCCAGATCACCCAC

the sequence starts with the expected start codon ATG and has a continuous code, and the predicted amino acid sequence is aligned at NCBI and has the highest homology with the alpha-tubulin sequence. Considering that RNA is transcribed and then polyA is modified at the 3' end, it is considered that RNA is reverse transcribed, and then nested PCR amplification is performed using oligo dT as a downstream primer and 2 upstream specific primers designed according to known sequences so as to obtain tubulin sequences. Total RNA from Schizochytrium was extracted by Takara RNase Plus reagent (shown on the left in FIG. 2), and then reverse transcribed using the Fermentas reverse First Strand cDNA Synthesis Kit. The reverse transcription system reaction system and process are as follows: 250ng RNA, 1. mu.l Oligo dT (50uM), 1. mu.l dNTP (2.5 mM each), adding water to 10. mu.l, mixing, heating in a water bath at 65 ℃ for 5 minutes, and immediately performing ice bath; then 4. mu.l of 5 XTRT buffer, 0.5. mu.l of RNase inhibitor, 1. mu.l of reverse transcriptase and water to 20. mu.l were added. The reverse transcription procedure was: 60min at 42 ℃; 15min at 70 ℃. The reverse transcription product is used as a template for subsequent PCR, and the system of the first round of PCR is as follows: mu.l of water, 5. mu.l of 10 Xbuffer, 4. mu.l of dNTPS at a concentration of 2.5mM each, 2. mu.l of 20uM primer TU0(atgcgtgaggtcatctccatccacatc, SEQ ID NO:48), 1. mu.l of a kit-of-parts with 50uM Oligo dT primer, 0.3. mu.l of Ex-Taq, and 2. mu.l of a reverse transcription product solution. The procedure for the PCR reaction was: 5min at 94 ℃; 16 cycles of: 95 ℃ for 50s, gradient for 50s, 72 ℃ for 2min, 95 ℃ for 50s, 44 ℃ for 50s, 72 ℃ for 2 min; 10min at 72 ℃. The gradient was set at 64-50 ℃ with 8 temperature steps (A-H). The gradient PCR products were checked on a 1% agarose gel electrophoresis (fig. 2).

The gel block of the suspected band was cut out and recovered by using a gel recovery kit of Omega. The recovered fragment was ligated into the pMD18-T vector in the following manner: 15.5. mu.l of water, 2. mu.l of 10 XT 4DNA ligase buffer, 2. mu.l of PCR product, 0.5. mu.l of pMD 18-T. The ligation conditions were 22 ℃ for 30 minutes. The ligation was transformed into E.coli DH 5. alpha. by heat shock as described above, and single clones were selected, plasmids were extracted and identified by electrophoresis. Sending out plasmid sequencing, and splicing the obtained sequence with the existing sequence to obtain the following sequence:

ATGCGTGAGGTCATCTCCATCCACATCGGCCAGGCCGGTGTTCAGGTCGGTAACGCCTGCTGGGAGCTCTACTGCCTCGAGCATGGCATCCAGCCGGACGGCCAGATGCCCTCGGACAAGACCATTGGCGGCGGCGATGATGCCTTCAACACCTTCTTCTCCGAGACTGGCGCCGGCAAGCACGTGCCCCGCGCCGTGCTCGTCGATCTCGAGCCCACCGTCTGTGACGAGGTCCGCACCGGCACCTACCGCGCTCTTTACCACCCCGAGCAGATCATCACCGGCAAGGAGGACGCTGCCAACAACTACGCTCGTGGCCACTACACCATCGGCAAGGAGATCGTCGACCTCGTCCTCGACCGCATCCGCAAGCTCGCCGACAACTGCACTGGTCTCCAGGGCTTCCTCTGCTTCAACGCCGTCGGCGGTGGTACCGGCTCCGGTCTCGGTTCGCTCCTCCTCGAGCGTCTGAGCGTCGACTACGGCCGCAAGTCCAAGCTCGGCTTCTGCGTCTACCCCTCGCCCCAGGTGTCGACCGCTGTCGTCGAGCCCTACAACTGCGTGCTCTCGACGCACTCGCTCCTCGAGCACACCGATGTCGCCGTCATGCTCGACAACGAGGCCATCTACGACATCTGCCGTCGTTCGCTCGACATTGAGCGCCCGACCTACACCAACCTGAACCGCCTGGTCGCTCAGGTCATCTCGTCGCTGACCGCCTCGCTTCGCTTCGATGGTGCTCTCAACGTCGATATCACCGAGTTCCAGACCAACCTGGTCCCGTACCCGCGCGGATGTGGATGGAGATGACCTCACGCAT

the sequence starts with the expected start codon ATG and has a continuous code, and the predicted amino acid sequence is aligned at NCBI and has the highest homology with alpha-tubulin. Because the currently available sequences are still deficient compared to the 1300-base length of typical a-tubulin, it is contemplated to use gene walk-through to obtain longer sequences.

Design 3 sets of target sequence specific primers:

SP1:ATGCGTGAGGTCATCTCCATCCACATC(SEQ ID NO:10)；

SP2:TCTTTACCACCCCGAGCAGATCATCAC(SEQ ID NO:11)；

SP3:GACCGCTGTCGTCGAGCCCTACAACTG(SEQ ID NO:12)

four degenerate primers were designed:

AD1:SWGANAWGAA(SEQ ID NO:13)；

AD2:GTNCGASWCANAWGTT(SEQ ID NO:14)；

AD3:WGTGNAGWANCANAGA(SEQ ID NO:15)；

AD4:NTCGASTWTSGWGTT(SEQ ID NO:16)。

wherein N (A/T/G/C), S (G/C) and W (A/T). A schematic diagram of the gene read-through strategy is shown in FIG. 3. Three rounds of PCR are needed for gene reading, and the system of the first round of PCR is as follows: mu.l of water, 25. mu.l of 2 XGC I buffer, 8. mu.l of dNTPs each having a concentration of 2.5mM, 1. mu.l of primer SP120uM 1, 5. mu.l of primer ADx 20uM, 0.5. mu.l of Takara LA-taq, 1. mu.l of 100 ng/. mu.l of gDNA. The PCR procedure was: 1min at 94 ℃; 1min at 98 ℃; 5 cycles of: 94 ℃ for 30s, 65 ℃ for 1min and 72 ℃ for 2 min; 30s at 94 ℃, 3min at 25 ℃ and 2min at 72 ℃; 16 cycles of: 94 ℃ for 30s, 65 ℃ for 1min, 72 ℃ for 2min, 94 ℃ for 30s, 44 ℃ for 1min, 72 ℃ for 2 min; 10min at 72 ℃. The PCR products were analyzed on a 1% agarose gel, and the suspected bands were excised and sequenced. The read-through PCR product was electrophoresed as shown in FIG. 4.

Cutting and recovering the bands of about 2K obtained by amplifying 7 random primers, sending the bands to Shanghai workers for sequencing by using SP3 primers, splicing the sequencing result with a known sequence to obtain a gene sequence of 1362bp from an initiation codon to a termination codon, wherein the gene sequence is shown as SEQ ID NO. 1; the amino acid sequence is shown in SEQ ID NO. 2.

In addition, the partial sequence of the non-coding region at the 3' end of the alpha-tubulin coding sequence is obtained by sequencing, and is shown as SEQ ID NO. 3.

Example two

The BlastN (nucleic acid sequence alignment) comparison results are shown in table one:

table one: the result of the alignment of the tubulin nucleic acid sequences obtained by the invention on GeneBank

The termination region sequences were aligned on GENEBANK and no sequences were found to have sufficient homology to the present sequence as reported by Blastn. Apparently, these are two new sequences, with the highest target for amino acid identity in the coding region being Phytophthora infestans, which is of the same genus as Oomycetes (stramenopiles) of the family thraustochytriaceae. The highest similarity for nucleic acid alignment was Micromonas (Micromonas). Alpha-tubulin sequences have not been disclosed in genus schizochytrium, family thraustochytriaceae, order thraustochytriales.

EXAMPLE III

Site-directed recombination was performed using the 3' noncoding region of tubulin as a target region for homologous integration. According to the idea, a vector for recombination of schizochytrium limacinum is constructed.

Primers RmlMaU were used: aaaccatggGAAATCAACGAACTTAC (SEQ ID NO:17) and RmlDSal: aaaGTCGACagtacacaaaccggtgttaat (SEQ ID NO:18), using the RML gene vector as a template, amplifying the RML lipase gene so that the 5 'and 3' ends thereof carry Nco I and Sal I cleavage sites, respectively. The PCR system was 18.1. mu.l of water, 2. mu.l of dNTPs (2.5 mM each), 2.5. mu.l of 10 XPCR buffer, 1. mu.l of 20uM primers each, 0.4. mu.l of rTaq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 52 ℃ 50s, 72 ℃ 1 min; 10min at 72 ℃. After the PCR product was purified by Omega Cycle Pure kit, restriction enzymes Nco I and Sal I were used for double digestion under the conditions specified in the product instructions, the total digestion amount was 50. mu.l, and the amount of the PCR product was 20. mu.l.

The pGAPZ. alpha.A vector plasmid (purchased from Pekinet Biotechnology (Beijing) Ltd.) was digested with BamHI, NcoI restriction enzymes (purchased from Takara Co.), and the digested product was subjected to 1% agarose gel electrophoresis to separate pTEF element on the plasmid. The pGAPZ. alpha.A vector plasmid (purchased from Pekinet Biotechnology (Beijing) Ltd.) was digested with Bgl II, Sal I restriction enzymes (purchased from Takara), and the remaining large fragment of the plasmid pGAPZ. alpha.A, a band of about 2350bp, was separated by 1% agarose gel electrophoresis of the digested product. The RML digested fragment, pTEF element fragment, pGAPZ. alpha.A vector BglII, Sal I fragment were recovered by using a gel recovery kit of Omega. The recovered products from the RML and pTEF gels were ligated using Fermentas T4DNA ligase as follows: 15 mul of water, 2 mul of buffer solution of T4DNA ligase, 0.5 mul of pGAPZ alpha A and 2 mul of RML enzyme digestion fragment, and preserving heat for 2 hours in a water bath at 16 ℃; then adding pGAPZ alpha A vector BglII and Sal I fragments, and supplementing ligase T4DNALigase 0.5. mu.l was incubated overnight in a water bath at 16 ℃. Ligation with 200. mu.l CaCl₂The prepared Escherichia coli DH5 alpha is mixed gently, ice-bathed for 30 minutes, heat-shocked in 42 ℃ water bath for 90 seconds, then immediately transferred into ice-bathed for 3 minutes, added with 800 mul LB culture solution, placed in 37 ℃ shaking table with 200rpm shaking culture for 1 hour, spread on LB plate containing 50 mug/ml zeocin, and cultured in 37 ℃ incubator overnight. The zeocin resistance colony obtained is subjected to colony PCR screening by RmMaU and RmDSal primers and rTaq DNA polymerase of Takara company, and the specific method comprises the following steps: about 1mm of colony culture³Adding into 10 μ l sterile water, mixing, adding 2 μ l dNTPs, 2.5 μ l 10 XPCR buffer solution, 1 μ l each primer, 0.4 μ l rTaq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 33 cycles of 95 ℃ 50s, 52 ℃ 50s, 72 ℃ 1 min; 10min at 72 ℃. The PCR products were separated by 1% agarose gel electrophoresis, and colonies with an approximately 1kb band were obtained as colonies that were successfully cloned. The colonies were inoculated into 5ml LB medium containing 50. mu.g/ml zeocin, incubated overnight at 37 ℃ with shaking at 200rpm, plasmids were extracted using Axygen's mini plasmid extraction kit for future use, designated pGAPZ. alpha.A-RML, using the pTEF promoter to initiate RML gene expression and leaving the ends of the RML gene with 6 HIS tags.

Primer TTE 5' was used: gcgagcacaactgcttggcttcagct (SEQ ID NO:19) and primer tubTT3 Ba: aatctagacgtgtcgctgctccagacaaag (SEQ ID NO:20), using a Schizochytrium limacinum genomic DNA solution as a template, and using LA-Taq DNA polymerase with GC set of Takara corporation to amplify a nucleic acid sequence of a tubulin terminator region part by the following amplification system: 2 XGC I buffer 25. mu.l, dNTPs 6. mu.l, primers 2. mu.l each, gDNA 2ng, LA-Taq DNA polymerase 0.5. mu.l, sterile deionized water to 50. mu.l. The PCR conditions were: pre-denaturation at 94 ℃ for 5 min; 10 cycles of touchdown PCR: reducing the temperature of the mixture to 40s at 95 ℃ and 50s at 60 ℃ for 1 ℃ and 40s at 72 ℃ per cycle; 30 cycles of PCR: 95 ℃ for 40s, 52 ℃ for 50s and 72 ℃ for 40 s; extension at 72 ℃ for 10 min. The PCR product was separated by 1% agarose gel electrophoresis, and the band of about 800bp was cleaved and recovered using an Omega gel recovery kit. The recovered nucleic acid is the nucleic acid with 1-797bp in SEQ ID NO. 3, and is connected with a pMD18-T vector by using Fermentas T4DNA ligase, and the connecting body is: 16.2. mu.l of water, 0.5. mu.l of pMD18-T, T4DNA ligase buffer2 mul of flushing liquid, 0.3 mul of T4DNA ligase and 1 mul of PCR product; the connection condition is 16 ℃ water bath for 2 h. The ligation product was gently mixed with 200. mu.l of Escherichia coli DH 5. alpha. prepared by CaCl2 method, heat-shocked in 42 ℃ water bath for 90 seconds after ice-bath for 30 minutes, immediately transferred to ice-bath for 3 minutes, added with 800. mu.l of LB medium, shake-cultured for 1 hour at 37 ℃ with 200rpm in a shaker, spread on LB plate containing 50. mu.g/ml ampicillin, and cultured overnight at 37 ℃ in an incubator. Ampicillin resistant colonies were obtained by TTE 5' and M13-48: gagcggataacaatttcacacagg (SEQ ID NO: 21) primers, and colony PCR screening was performed using Takara rTaq DNA polymerase, specifically: about 1mm of colony culture³Mixing in 10 μ l sterile water, adding 2 μ l dNTPs with concentration of 2.5mM each, 2.5 μ l 10 XPCR buffer solution, 1 μ l each primer, 0.4 μ l rTaq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 33 cycles of 95 ℃ 50s, 52 ℃ 50s, 72 ℃ 1 min; 10min at 72 ℃. The PCR products were separated by 1% agarose gel electrophoresis, and colonies with bands of about 900bp were obtained as colonies that were successfully cloned. The colony was inoculated to 5ml LB medium containing 50. mu.g/ml ampicillin, cultured overnight at 37 ℃ with a shaker at 200rpm, and the plasmid was extracted using a small plasmid extraction kit from Axygen, and named TF-18T.

The TF-18T plasmid was digested with BamHI restriction enzyme: 23 μ l of water, 5 μ l of K buffer, 20 μ l of plasmid and 2 μ l of endonuclease; the enzyme digestion condition is 30 ℃ water bath for 2 h. The pGAPZ alpha ARML vector is cut by using a BamH I restriction enzyme, wherein the cutting system is as follows: 23 μ l of water, 5 μ l of K buffer, 20 μ l of plasmid and 2 μ l of endonuclease; the digestion conditions were 37 ℃ water bath for 2 h. After the cleavage products were separated by 1% agarose gel electrophoresis, the plasmid enzyme single-cleaved fragments were recovered using an Omega gel recovery kit. The purified enzyme digestion products are connected by using Fermentas T4DNA ligase, and the connecting system is as follows: 13.7 mul of water, 2 mul of each enzyme digestion substance, 2 mul of buffer solution of T4DNA ligase and 0.3 mul of T4DNA ligase; the connection condition is 16 ℃ water bath for 2 h. Ligation product with 200. mu.l CaCl₂The Escherichia coli DH5 alpha prepared by the method is mixed gently and evenly, is thermally shocked in water bath at 42 ℃ for 90 seconds after being ice-bathed for 30 minutes, then is immediately transferred into ice for ice-bathing for 3 minutes, is added with 800 mul LB culture solution, is placed in a shaker at 37 ℃ and is shaken at 200rpm for 1 hour, and is coated on a medium containing 50 mug/ml penicillium ampicillinThe cells were incubated overnight at 37 ℃ in an LB plate containing 50. mu.g/ml zeocin antibiotic. The inoculated colonies were cultured overnight at 37 ℃ on a shaker at 200rpm in 5ml of LB medium containing 50. mu.g/ml ampicillin and 50. mu.g/ml zeocin antibiotic, and plasmids were extracted using a small plasmid extraction kit from Axygen. The resulting plasmid was digested with KpnI restriction enzymes under the following conditions: 12 ul of water, 2ul of L buffer, 5ul of plasmid and 1ul of endonuclease; the digestion conditions were 37 ℃ water bath for 1 h. The cleavage products were detected by 1% agarose gel electrophoresis, and the results of the electrophoresis are shown in FIG. 5. The plasmid was cleaved with KpnI and two patterns of results were obtained for pGAPZ. alpha.A-RML cleavage ligated in different orientations. Plasmid 407 was selected for use in subsequent studies.

The 407 plasmid was transferred into schizochytrium using a gene gun. The method comprises the following specific steps: the schizochytrium limacinum ATCC20888 is cultured by using a YPD culture medium, and the formula of the culture medium is as follows: 10g/L yeast powder, 20g/L peptone, 20g/L glucose, 18g/L artificial sea salt, adding deionized water to 1L, pH6.5, and autoclaving at 121 deg.C for 20 min. The culture medium is filled in a 250ml wide-mouth glass triangular flask with a baffle, the liquid filling amount is 50ml, and the seeds are glycerol storage tubes of strains. After culturing the culture at 28 ℃ for 48h with shaking at 200rpm in a shaker, the culture was transferred to a new 50ml of culture solution at a volume ratio of 1%, and cultured at 28 ℃ for 24h with shaking at 200rpm in a shaker. Transferring the culture to a 50ml sterile plastic centrifuge tube, centrifuging at 4000rpm for 5 minutes at room temperature to collect the cells, suspending the cell pellet with 5ml sterile physiological saline, and spreading 50. mu.l of the suspension onto YPD plates: the YPD culture solution formula is supplemented with 1.8g/L agar powder. The plate was incubated in an incubator at 28 ℃ for 1 hour to dry the surface. Preparing gold powder solution in advance: weighing 30mg of 0.6um gold powder microcarrier into a 1.5ml Eppendorf centrifuge tube, adding 1ml of 70% ethanol solution (prepared by using ultrapure water for HPLC-grade absolute ethanol), and fully oscillating for 4 minutes; ② standing for 15 minutes; thirdly, centrifuging for 5 seconds (Eppendorf small-sized desktop centrifuge 'Short' mode) for a Short time, and abandoning the supernatant; adding 1ml of deionized water into the precipitate, fully oscillating for 1 minute, standing for 1 minute, centrifuging for a short time, and removing the supernatant; repeating the step 4 for 2 times; sixthly, adding 500 mu l of sterile 50 percent glycerol into the precipitate for suspension. Before gene gun transformation, the gold liquid is put into an ultrasonic washer for ultrasonic treatment for 3 minutes, and then embedding is prepared according to the following system: 10 mu l of gold liquid, 1 mu g of plasmid solution, 10 mu l of 2.5M CaCl2 solution and 4 mu l of 1M spermidine solution are mixed uniformly, fully shaken for 3 minutes, then kept stand for 1 minute, and centrifuged for a short time to remove the supernatant; adding 140 μ l 70% ethanol solution (prepared with ultrapure water for HPLC grade anhydrous ethanol) into the precipitate, mixing, and centrifuging to remove supernatant; adding 140 μ l of anhydrous ethanol (HPLC grade) into the precipitate, mixing, and centrifuging for a short time to remove supernatant; to the precipitate, 10. mu.l of absolute ethanol was added, and the tube wall was tapped to suspend the precipitate. Carefully coating the gold liquid on the center of a carrier membrane special for the gene gun on a clean bench, standing and drying, and then carrying out gene gun transformation. The transformation procedure was performed according to the Bio-Rad particle gun transformation System instructions using a burst membrane of 1100Psi, a transformation chamber vacuum of 25 "Hg, and a burst disk 7cm from the target plate. After the transformed plate was cultured at 28 ℃ for 6 hours, the cells were washed with sterile deionized water, centrifuged at 4000rpm, resuspended in 100. mu.l, 50. mu.l was spread on a YPD plate containing 50. mu.g/ml zeocin antibiotic, and cultured in a 28 ℃ incubator for 3 days. The obtained resistant bacterial colony is transferred to a rhodamine B plate, and the formula of the plate is as follows: 12% olive oil emulsion is supplemented in the YPD medium formula (2% polyvinyl alcohol water solution is mixed with 1/3 volume olive oil when hot, a high speed dispersion machine emulsifies for 3 minutes at 10000rpm, and emulsifies for 3 minutes after 5 minutes of intermittence), rhodamine B is supplemented to 10 mug/ml before the plate is poured, and zeocin antibiotic is supplemented to 50 mug/ml). The transferred plates were incubated in an incubator at 28 ℃ for 48 hours, and observed and photographed on a gel tapping machine, and the photograph is shown in FIG. 6.

Since the recombinant vector contains only the tubulin 3' non-coding region as the homologous integration site, the colony still having zeocin resistance after the second transfer is theoretically the transformed strain subjected to genetic recombination. Four colonies, No. 4, 6, 38 and 39, were selected for colony PCR in the present invention. The primers used and their position on the genome are shown in FIG. 7. Resistant colonies obtained from the coated plates after the biolistic transformation are called first-generation resistant colonies, the interior of which does not exclude the presence of plasmids which are driven into the cells and exist intact, and therefore PCR identification must use primer pairs which span the integration region. The object of the test of the invention is the transferred second generation resistant bacterial colony, theoretically, a recombinant vector wrapped by gold powder does not exist, but the test is still carried out by using a primer pair crossing an integration site firstly due to rigor. Because homologous recombination may generate partial deletion near the homologous region, the identification primer is designed for multiple times, and the existence of primers with different annealing temperatures is ensured, so that the occurrence of false negative is reduced.

The insertion site verification was performed by PCR:

insert position downstream colony PCR validation three of the primer 1 series were used:

(1)-cagtcacgacgttgtaaaacgacggccagt(SEQ ID NO:22)；

(1’)-cgattaagttgggtaacgccag(SEQ ID NO:23)；

(1”)-gaaagggggatgtgctgcaaggcga(SEQ ID NO:24)，

the colony PCR was verified by combining 3 combinations with primers 2-atgaacagacgacatgcccccaag (SEQ ID NO:25), respectively.

Upstream direction with three of primer 3 series:

(3)-gcccgtgaggatcttgccgctctc(SEQ ID NO:26)；

(3’)-gtatggaggagggtgagttctccgag(SEQ ID NO:27)；

(3”)-gcactggtacgtcggtgagggtatggag(SEQ ID NO:28)；

3 combined amplifications with primers 7-gcccttagattagattgctatgctttct (SEQ ID NO:29), respectively. The system used was 50u, verified using LA-taqDNA polymerase from GCset of Takara, and the specific PCR components were as follows: 14.5. mu.l of water, 25. mu.l of 2 XGC I buffer, 6. mu.l of dNTPs, 2. mu.l of each primer, and 0.5. mu.l of LA-Tag. Selecting about 1mm into the prepared reaction solution³The thalli are evenly mixed and then put into a PCR instrument for amplification. The PCR amplification procedure was: denaturation at 98 ℃ for 5 min; 10 cycles of touchdown PCR, 95 ℃ 30 seconds, 63 ℃ 30 seconds and 1 ℃ 72 ℃ 90 seconds per cycle; 30 cycles of PCR, 95 ℃ for 30 seconds, 50 ℃ for 30 seconds, 72 ℃ for 90 seconds; 10 minutes at 72 ℃. The PCR product was verified by electrophoresis on 1% agarose gel, and FIG. 8 is the electrophoresis chart of the colony PCR result of the 39# bacterium. PCR bands were obtained at the expected size positions both upstream and downstream. 3. 3', 3 "differ by about 10 bases in order and therefore cannot be sized on the gel. Similarly, 1 'and 1' are different from each other by about10 bases, no difference could be shown on the gel.

Inoculating 39# bacteria to 50ml YPD liquid medium, culturing for 48h, centrifuging to collect the bacteria, washing for 2 times with deionized water, grinding the bacteria in liquid nitrogen, extracting Genomic DNA by using a MiniBEST Universal Genomic DNA extraction kit of Takara corporation, and carrying out PCR verification by using the DNA as a template and 3 series primers and primers f (TTBa) -aatctagacgtgtcgctgctccagacaag (SEQ ID NO:30) and 1 series primers and primers f. The PCR system was 50. mu.l, consisting of 13.5. mu.l of water, 25. mu.l of 2 XGC I buffer, 6. mu.l of dNTPs, 2. mu.l of each primer, 0.5. mu.l of LA-Tag, and 1. mu.l of template. The PCR amplification procedure was: denaturation at 98 ℃ for 5 min; 12 cycles of thermal asymmetric PCR: 30 seconds at 95 ℃, 30 seconds at 63 ℃, 1min at 72 ℃, 30 seconds at 95 ℃, 30 seconds at 44 ℃ and 1min at 72 ℃; 10 minutes at 72 ℃. The PCR products were checked by 1% agarose gel electrophoresis, and the results are shown in FIG. 9.

As is apparent from FIG. 9, both the 3 series primer and f and the 1 series primer and f gave bands of the expected sizes. The constructed vector is inserted into the schizochytrium limacinum genome at the position of the tubulin termination region.

Inoculating two recombinant strains of No. 38 and No. 39 and wild type schizochytrium limacinum to YPD culture solution (containing 50 microgram/ml zeocin antibiotic in a triangular flask in which the recombinant strain is located), carrying out shake cultivation at 28 ℃ and 200rpm for 72h, centrifuging, collecting the strain, washing with deionized water, weighing, quickly freezing with liquid nitrogen, transferring to a mortar, and grinding under the liquid nitrogen. Adding an extract twice the weight of wet thallus (such as 2ml extract for 1g wet thallus), mixing with thallus powder, and grinding when the liquid begins to melt until the thallus becomes clear. The extraction buffer contained: Tris-HCl buffer, 50mM pH8.0; triton X-1000.1%; NaCl 150 mM. An appropriate amount of PMSF was then added to a final concentration of 1 mM. The cell lysate was centrifuged at 13000rpm for 15 minutes at 4 ℃ and the lysate supernatant was collected. Filtering with 0.22uM sterile filter membrane to obtain crude enzyme solution, and storing at 4 deg.C. And inoculating three strains of No. 38, No. 39 and wild strains, culturing in YPD culture solution for 72h, centrifuging, collecting the strains, washing with deionized water, suspending the cells with absolute ethyl alcohol, completely transferring to a glass culture dish, drying at 60 ℃ to constant weight, and calculating the weight of the dry strains. The biomass of the 38# and 39# recombinant bacteria is 96.5% and 97.1% of the wild type strain respectively. The tubulin promoter sequence disclosed in CN02812059 is used as the promoter and the only homologous integration site of the RML gene, and the recombinant schizochytrium limacinum is cultured by the same method, and the biomass of the obtained recombinant schizochytrium limacinum is 78.2-86.5 percent of that of the wild strain.

Dropping 40 mul of fermentation supernatant (CS), lysis supernatant (HS) and lysate (CH) of 38#, 39# and wild strain cells into a rhodamine plate, wherein the rhodamine plate comprises the following components: 1.8 percent of agar, 12 percent of emulsified olive oil (2 percent of polyvinyl alcohol aqueous solution is mixed with 1/3 volumes of olive oil when the solution is hot, the mixture is emulsified for 3 minutes at 10000rpm by a high-speed dispersion machine, and is emulsified for 3 minutes after the interval of 5 minutes), and 10 mu g/ml of rhodamine B. The plate was placed in a 37 ℃ incubator overnight, irradiated with 406nm UV light, and photographed, the results are shown in FIG. 10. The wild-type thallus, 38# and 39# cell lysates all have lipase activity, but no lipase activity is seen in the supernatant of the three culture media, and the lipase activity in the supernatant of the cell lysate is 39# 38# wild-type.

Detecting the lipase activity in recombinant and wild schizochytrium limacinum cell crude enzyme liquid by using a p-nitrophenol palmitic acid (PNPP) method, wherein the detection system is as follows: 40. mu.l of a 1.5mM PNPP isopropanol solution, 360. mu.l of a 50mM Tris-HCl pH8.0 buffer, 100. mu.l of a crude enzyme solution; the reaction conditions were 40 ℃ water bath for 15 minutes. After completion of the reaction, 1.5ml of absolute ethanol was added to terminate the reaction, and the absorbance was measured at 405nm after centrifugation at 12000rpm for 2 minutes. The blank control is that after the same time of warm bath, the absolute ethyl alcohol is added firstly, and then the crude enzyme solution is added. Lipase activity was defined as the unit of enzyme required to release 1umol of p-nitrophenol from p-nitrophenol palmitate per minute at 40 ℃. The enzyme activity detection results are as follows: the lipase activity of the crude enzyme solution obtained by the wild type strain is as follows: 0.010 plus or minus 0.003U/ml; the lipase activity of the crude enzyme liquid of the recombinant schizochytrium limacinum is 0.072 +/-0.02U/ml.

The recombinant bacterium expressed lipase C-terminal with HIS label, can use Ni gel (Qiagen Gmbh company NI-NTA agrose) for adsorption purification. 5ml of the crude enzyme solution was concentrated to 1.5ml using a Millipore Amicon μm ltracel 10kDa ultrafiltration membrane and the extraction buffer was exchanged for HIS binding buffer (10mM Tris-HCl, 100mM NaH)₂PO₄8M urea, pH8.0), then 50. mu.l of 50% Ni beads were added and shaken at 37 ℃ for 2 h. The supernatant was centrifuged off, and a washing buffer (10mM Tris-HCl, 100mM NaH) was used₂PO₄8M urea, pH6.3) washing NI gel for 10 times, and using 1ml of the NI gel each time; finally, the adsorbed recombinant protein is washed down by using an elution buffer solution, wherein the formula of the buffer solution is 10mM Tris-HCl and 100mM NaH₂PO₄8M Urea, 200mM imidazole, pH4.5, 3 cycles of elution, using 500. mu.l of eluent per cycle.

The results of enzyme activity detection and protein electrophoresis (FIG. 11) show that the RML gene has been expressed in Schizochytrium limacinum.

Example four

A gene derived from Mortierella alpina (Mortierella) (GenBank: Y18553.1) was integrated into Skeletonema using the tubulin gene termination region as a homologous integration site. FIG. 12 is a schematic view of the structure of the carrier.

Primer TTE 5' was used: gcgagcacaactgcttggcttcagct (SEQ ID NO:31) and primer tubTT 3' Ba: aatctagaaccttgacaccgcaaagctttaca (SEQ ID NO:32), amplifying 1-562bp of tubulin transcription termination region (SEQ ID NO:3 sequence) as an integrated component. PCR was carried out using the TF-18T plasmid constructed in example three as a template, the PCR system was 18.1. mu.l of water, 2. mu.l of dNTPs (2.5 mM each), 2.5. mu.l of 10 XPCR buffer, 1. mu.l of 20uM primers each, and 0.4. mu.l of Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 52 ℃ 40s, 72 ℃ 30 s; 10min at 72 ℃. The PCR product was separated by 1% agarose gel electrophoresis, and a band of about 500bp was cleaved and recovered using an Omega gel recovery kit. The recovered nucleic acid was ligated to the pMD18-T vector using Fermentas T4DNA ligase as follows: 16.2ul of water, 0.5ul of pMD18-T, 2ul of T4DNA ligase buffer solution, 0.3ul of T4DNA ligase and 1ul of PCR product; the connection condition is 16 ℃ water bath for 2 h. Ligation product with 200ul CaCl₂The prepared Escherichia coli DH5 alpha is mixed gently, ice-bathed for 30min, heat-shocked in 42 deg.C water bath for 90s, immediately transferred into ice-water bath for 3min, added with 800ul LB culture solution, put into 37 deg.C shaking table with 200rpm shaking culture for 1h, spread on LB plate containing 50ug/ml ampicillin, and cultured in 37 deg.C incubator overnight. Ampicillin-resistant bacterial colony obtainedTTE 5' and M13-48: gagcggataacaatttcacacagg (SEQ ID NO:33) primers, and colony PCR screening was performed using Takara rTaq DNA polymerase, specifically: selecting colony culture about 1mM3 to 10ul sterile water, mixing well, adding 2ul dNTPs with concentration of 2.5mM each, 2.5ul 10 XPCR buffer solution, 1ul primer each, 0.4ul rTaq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 33 cycles of 95 ℃ 50s, 52 ℃ 50s, 72 ℃ 1 min; 10min at 72 ℃. The PCR products were separated by 1% agarose gel electrophoresis, and colonies with bands of about 700bp were obtained as colonies that were successfully cloned. The colony was inoculated into 5ml LB medium containing 50ug/ml ampicillin, cultured overnight at 37 ℃ with a shaker at 200rpm, and the plasmid was extracted using Axygen's mini plasmid extraction kit and designated TT' -18T.

The TT' -18T plasmid is cut by using BamHI restriction enzyme, and the cutting system is as follows: 23ul of water, 5ul of K buffer solution from Takara, 20ul of plasmid, and 2ul of endonuclease; the enzyme digestion condition is 30 ℃ water bath for 2 h. After the cleavage products were separated by 1% agarose gel electrophoresis, the plasmid enzyme single-cleaved fragments were recovered using an Omega gel recovery kit.

Using primers 35 SU: aaaAGATCTaatggcgaatgctagagcagctt (SEQ ID NO:34), 35 SD: aaccatggtcaagagtcccccgtgttctctcc (SEQ ID NO:35), and the 35S promoter fragment was amplified using pCAMBIA1301 plasmid as a template. PCR system for water 18.1 μ l, dNTPs (2.5 mM each) 2 μ l, 10 XPCR buffer 2.5 μ l,20 uM primers each 1 μ l, 0.4 μ l Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 52 ℃ 40s, 72 ℃ 30 s; 10min at 72 ℃. After the PCR product was purified and recovered using the Omega Cycle Pure kit, it was digested with NcoI restriction enzyme from NEB in a single manner, in the following system: 23 μ l of water; 5 μ l of buffer No. 3; 20 μ l of PCR product; enzyme 2. mu.l. The enzyme was cleaved at 37 ℃ for 2 h. Then, the fragment digested by the 35S promoter was recovered and purified by using the Omega CyclePure kit.

Using primers Mu: aaaccatggATGGCAACTCCTCTTCCCCCCTCCTTT (SEQ ID NO:36), Md: aaatctagaCTATTCGGCCTTGACGTGGTCAGT (SEQ ID NO:37), and amplifying the gene for use by using the Mortierella alpina RNA reverse transcript as a template. The PCR system was 18.1. mu.l of water, 2. mu.l of dNTPs (2.5 mM each), 2.5. mu.l of 10 XPCR buffer, 1. mu.l of 20uM primers each, 0.4. mu.l of Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 50 ℃ 40s, 72 ℃ 90 s; 10min at 72 ℃. The PCR product was subjected to 1% agarose electrophoresis, and a band of about 1.5kb in size was recovered by cleavage using Gel Extract kit of Omega, and the recovered product was single-digested with NcoI restriction enzyme in the following system: 23 μ l of water; 5 μ l of buffer No. 3; 20 μ l of PCR product; enzyme 2. mu.l. The enzyme was cleaved at 37 ℃ for 2 h. Then using an Omega company CyclePure kit to recover and purify to obtain the mortierella alpina gene fragment enzyme cutting matter.

Connecting the enzyme-cut fragment of the 35S promoter with the enzyme-cut product of the mortierella alpina gene fragment, using Fermentas T4DNA ligase, wherein the connecting body is as follows: 13.7ul of water, 2ul of each enzyme digestion fragment, 2ul of T4DNA ligase buffer solution and 0.3ul of T4DNA ligase; the connection condition is 16 ℃ water bath for 2 h. Taking 0.5 mul of the ligation product as a PCR template, amplifying the ligated fragments by using 35SU and MD primers, wherein the PCR system comprises 18.1 mul of water, 2 mul of dNTPs (each 2.5mM), 2.5 mul of 10 XPCR buffer solution, 1 mul of 20uM primers and 0.4 mul of Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 50 ℃ 40s, 72 ℃ 2 min; 10min at 72 ℃. The PCR product was subjected to 1% agarose electrophoresis, and a band of about 2kb in size was recovered by cleavage using Gel Extract kit of Omega, and the recovered product was double-cleaved with XbaI and BglII restriction enzymes in the following system: 23 μ l of water; 5 μ l of buffer 2 #; 20 μ l of PCR product; enzyme 2. mu.l. The enzyme was cleaved at 37 ℃ for 2 h. Then, the fragment was recovered and purified using an Omega CyclePure kit to obtain a 35S-alpine enzyme-cleaved fragment.

The pGAPZaA vector recovered after double cutting of BglII and XbaI was ligated to the 35S-alpine enzyme fragment as described above. The Dh5 alpha competent cells were transformed with the linker, and the transformation method, culture method and screening method were the same as in example three. And selecting the PCR positive colony to extract the plasmid to obtain the GAP35SM plasmid.

The BamH I restriction enzyme cuts GAP35SM carrier, the cutting system is: 23ul of water, 5ul of K buffer solution from Takara, 20ul of plasmid, and 2ul of endonuclease; the digestion conditions were 37 ℃ water bath for 2 h. The purified enzyme cutting substance is connected with the recovery substance after being cut by Fermentas T4DNA ligase and TT' -18T BamHI enzyme, and the connector system is as follows: 13.7ul of water, 2ul of each enzyme digestion product, 2 of T4DNA ligase buffer solution and 0.3ul of T4DNA ligase; the connection condition is 16 ℃ water bath for 2 h. The ligation product was transformed into DH 5. alpha. competent cells, which were also cultured, screened, and colony PCR screened. Selecting positive colonies to extract plasmids to obtain the recombinant plasmid TTM.

Primers 8U were used: aaagatctatgcgcatgaagaacctcatggac (SEQ ID NO:38) and primer 8D: aaagatctgcatgacggccttgtcgctcg (SEQ ID NO:39), using schizochytrium limacinum genome DNA as a template, amplifying a 710bp fragment at the 5' end of a coding region predicted to be a phospholipase D gene of the schizochytrium limacinum, and enabling two ends of the fragment to have BglII enzyme cutting sites. PCR system and conditions, wherein the PCR system is water 18.1. mu.l, dNTPs (2.5 mM each) 2. mu.l, 10 XPCR buffer 2.5. mu.l, 20uM primers 1. mu.l each, 0.4. mu.l Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 50 ℃ 40s, 72 ℃ 90 s; 10min at 72 ℃. . The PCR product was recovered and purified by the method and procedure described above, and recovered and purified by BglII restriction. The resulting fragment was used to replace the tubulin noncoding region part of the GAP35SM plasmid. The specific method is to use BamHI restriction enzyme to cut GAP35SM, and the cutting system is as follows: 23ul of water, 5ul of K buffer solution from Takara, 20ul of plasmid, and 2ul of endonuclease; the digestion conditions were 37 ℃ water bath for 2 h. Separating by 1% agarose gel electrophoresis, recovering and purifying by a gel recovery kit, and connecting with the PLD8 fragment, wherein the connecting system is water 13.7ul, the enzyme digestion products are 2ul respectively, the T4DNA ligase buffer solution is 2ul, and the T4DNA ligase is 0.3 ul; the connection condition is 16 ℃ water bath for 2 h. The ligation product was transformed into DH 5. alpha. competent cells, which were also cultured, screened, and colony PCR screened. Selecting positive colonies to extract plasmids to obtain recombinant plasmids, and naming the recombinant plasmids as 8M. The plasmid is transformed into schizochytrium by using a particle gun method, and the method and the steps are the same as the third embodiment, so that TTM and 8M recombinant schizochytrium are obtained. Inoculating TTM, 8M and wild schizochytrium limacinum, culturing in a triangular flask for the same time, and measuring the biomass. The average biomass of the TTM recombinant strain is 84.5 percent of that of the wild strain, and the average biomass of the 8M recombinant strain is 53.2 percent of that of the wild strain. Oven drying thallus of recombinant and wild type strain, grinding into powder in mortar, adding 8ml 75% hydrochloric acid to suspend thallus, and heating in 70 deg.C water bath at 200rpm under vibration for 40 min. After cooling to room temperature, 20ml of n-hexane was added and the mixture was shaken for 30min to extract fats and oils. Drying to remove n-hexane, dissolving with 3ml n-hexane to remove oil, adding 4ml 0.5M potassium hydroxide methanol solution, and performing methyl esterification at 60 deg.C for 40 min. Centrifuging at 4000rpm for 3min, and collecting the upper n-hexane layer for gas chromatography. The column was VARIAN CP6173, 50m 250 μm 0.2 μ L. The temperature rising procedure is as follows: keeping at 80 deg.C for 2 min; heating to 120 deg.C at 10 deg.C/min, and maintaining for 0 min; raising the temperature to 180 ℃ at the temperature of 5 ℃/min, and keeping the temperature for 2 min; raising the temperature to 206 ℃ at the temperature of 2 ℃/min, and keeping the temperature for 0 min; raising the temperature to 230 ℃ at the temperature of 25 ℃/min, and keeping the temperature for 5 min. Sample inlet temperature: 250 ℃, detector temperature: 280 ℃, sample introduction: 1 μ L, split ratio 20: 1. Fig. 13 is a graph showing wild-type schizochytrium limacinum lipid FAC results, fig. 14 is a graph showing TTM recombinant schizochytrium limacinum lipid FAC results, and fig. 15 is a graph showing 8M recombinant schizochytrium limacinum lipid FAC results. The lipid composition of the 2 recombinant bacteria is changed, which indicates that the gene of the mortierella alpina is integrated into the schizochytrium limacinum genome and plays a role. However, the gene has an influence on the growth of schizochytrium, but the biomass is influenced to a low degree by using a tubulin non-coding region as an integration site, so that the advantages of the invention are obvious.

EXAMPLE five

This example uses the sequence of the protein-encoding portion of the tubulin gene as a site for homologous integration. Using primer TubU: aactgcagatgcgtgaggtcatctccatcc (SEQ ID NO:40) and TubD: aagatatcgacgttgagagcaccatcgaagc (SEQ ID NO: 41). Genomic DNA was extracted from wild type schizochytrium limacinum cells using a Takara genome extraction kit (No. 9765), and 756bp of a gene fragment from the start codon of the tubulin gene coding region was amplified in the TubU and TubD primer schizochytrium limacinum genome solution, and PstI and EcoRV restriction sites were attached to the ends thereof, respectively. After the PCR product is recovered and purified, PstI and EcoRV double enzyme digestion is carried out according to the instructions of NEB company, and the fragment for tubulin fusion expression is obtained after 2h enzyme digestion at 37 ℃. Primers zeoU were used: aacgatatcgccaagttgaccagtgcc (SEQ ID NO:42) and primer zeoD: aacatatgtcagtcctgctcctcggccacgaa (SEQ ID NO:43), using pGAPZaA plasmid as a template to amplify zeocin resistance gene fragment. After the PCR product was recovered and purified, the product was digested with EcoRV and NdeI in a double manner according to the instructions of NEB, and then digested at 37 ℃ for 2 hours, followed by recovery and purification. Connecting the microtubulin fusion expression fragment and the enzyme digestion product of zeocin resistance gene fragment, wherein the connecting body is as in example four, primers tubU and zeoD are used as templates, a PCR system is water 18.1 mu l, dNTPs (2.5 mM each) 2 mu l, 10 XPCR buffer solution 2.5 mu l,20 uM primers each 1 mu l, and 0.4 mu l Ex-Taq DNA polymerase; the PCR reaction conditions are as follows: 5 minutes at 95 ℃; 30 cycles of 95 ℃ 50s, 50 ℃ 40s, 72 ℃ 90 s; 10min at 72 ℃. The tubzeo fragment was obtained. The tubzeo fragment was double-digested with the NEB PstI, NdeI restriction enzymes, with the terminal NdeI, PstI cleavage sites being sticky ends. Using primers AOXU: aacatatggttttagccttagacatgactg (SEQ ID NO:44) and AOXD: aaggatcctctagagcacaaacgaaggt (SEQ ID NO:45), amplifying the AOX transcription termination region, using pGAPZaA plasmid as a template, and the PCR system is as follows: 36.5. mu.l of water, 5. mu.l of 10 XEx-taq buffer, 4. mu.l of dNTPs, 2. mu.l of each primer, and 0.5. mu.l of Ex-Tag. The PCR amplification procedure was: denaturation at 98 ℃ for 5 min; 30 cycles of PCR, 95 ℃ for 30 seconds, 50 ℃ for 30 seconds, 72 ℃ for 90 seconds; 10 minutes at 72 ℃. The PCR product was purified, digested with NdeI and BamHI restriction enzymes from NEB, and purified and recovered. The recovered fragment was ligated with a tubzeo fragment, and the ligation was amplified using tubU and AOXD primers to obtain a tubzeoaox fragment having PstI and BamHI restriction sites at its ends, respectively.

Using HyU: aaggatccatgaaaaagcctgaactcaccgcg (SEQ ID NO:46) and HyD: aactcgagttatttctttgccctcggacgagtgctg (SEQ ID NO:47) primers were used to amplify the hygromycin resistance gene fragment using pCAMBIA1301 plasmid from Cambia as a template, and the PCR system and conditions were as described above for the tubulin fragment amplified in example five. The PCR product was purified by gel recovery kit, digested with BamHI, purified, and ligated to the tubzeoaox fragment under the same ligation system and conditions as described in the above examples. The ligation product was used as a template and amplified using tubU and HyD primers to give a tubzeoaoxhy fragment with PstI and XhoI restriction sites at both ends. After the fragment and pCAMBIA1301 plasmid are respectively subjected to PstI and XhoI double enzyme digestion, purified and recovered, the residual skeleton parts of the tubzeoaoxydy fragment and pCAMBIA1301 with hygromycin resistance genes removed are connected, the connection system is the same as above, and the connection condition is 16 ℃ for 48 hours. The ligation products were transformed into DH5 α, screened against kanamycin-resistant plates, and clones were selected by colony PCR with primers tubU and HyD. The resulting tubzeo1301 plasmid, the structure of which is shown in FIG. 16, contains a hygromycin resistance gene fragment and a zeocin resistance fragment that function in Schizochytrium sp. However, the zeocin resistance gene is promoterless and zeocin activity must be obtained when the vector is integrated at the site of the tubulin coding region; the hygromycin resistance gene does not contain a promoter before it is active, and must be externally connected with a promoter. The tubzeo1301 plasmid was digested with BamHI restriction enzyme, linearized and dephosphorylated using Takara CIAP alkaline phosphatase according to the protocol, avoiding vector self-ligation.

Extracting DHA from schizochytrium limacinum genome, and performing enzyme digestion by using Sau3AI restriction enzyme of Takara company, wherein the enzyme digestion system is 59 mu l of water; 10. mu.l of Takara H buffer; 30 mul of genome solution; enzyme 1. mu.l. The digestion conditions were 37 ℃ water bath for 20 min. The gel blocks within the range of 200bp-1kb were excised by 0.5% agarose gel electrophoresis, purified and recovered by a gel recovery kit, and ligated with the linearized tubzeo1301 vector, ligation system Fermentas T4DNA ligase, consisting of 2. mu.l buffer, 4. mu.l vector, and 14. mu.l genomic enzyme cut. The ligation conditions were 20 ℃ for 20 h. The ligate was transformed into DH5 alpha cells, spread on Carna resistant LB plates, cultured overnight, all colonies were washed with physiological saline, centrifuged to collect the cells, and the plasmids were extracted to obtain a small library. The library was transformed into Agrobacterium EHA105 strain by heat shock method and spread on kanamycin-resistant plates. Washing all the thalli, diluting by 1000 times, inoculating into a liquid culture medium, then transforming into schizochytrium according to the method for transforming schizochytrium by agrobacterium, culturing under the double selection pressure of 50 mug/ml zeocin and 200 mug/ml hygromycin, and culturing for 4 days at 28 ℃ to obtain recombinant colonies. Because the agrobacterium transformation is generally single copy, only one recombinant vector is introduced into the double-anti-positive bacteria, the vector is integrated into the 5' 756bp of the tubulin coding region in the genome in a fixed point manner, only then the zeocin resistance gene can be expressed, and the strain has zeocin resistance; the random enzyme digestion fragment of the genome connected in front of the hygromycin resistance gene in the recombinant vector must have promoter activity to initiate the expression of the hygromycin resistance gene, so that the recombinant strain has hygromycin resistance.

Randomly selecting 2 resistant colonies, inoculating the colonies to a liquid culture medium for culturing for 60h, collecting thalli, extracting genome DNA as a template, amplifying by using hyD and AOXU as primers, and sending a band obtained by PCR (polymerase chain reaction) to a Shanghai worker for sequencing to obtain two segments of gene fragments 4# and 5#, wherein the two segments of sequences are positioned at the upstream positions of certain two gene initiation codons (see figure 17).

Claims (9)

1. A recombinant nucleic acid molecule, which is a capture vector, for use in screening, obtaining and/or identifying a test gene sequence of interest in a host, comprising: a test gene sequence of interest, a first reporter gene, a second reporter gene, and an isolated nucleic acid molecule selected from the group consisting of: (1) a constitutively expressed tubulin gene of the host represented by SEQ ID NO. 1 or a fragment thereof, wherein the fragment comprises at least nucleotides 1 to 756 of SEQ ID NO. 1; and (2) a nucleotide sequence complementary to the nucleotide sequence of the tubulin gene or fragment thereof of (1);

wherein, the gene sequence to be detected comprises a promoter, a gene sequence for coding a secretion signal peptide and a terminator;

wherein the first reporter gene is fused with a tubulin gene or a fragment thereof which is constitutively expressed by the host, and the second reporter gene is a reporter gene of an interested gene sequence to be detected; wherein, the gene sequence to be tested of interest is inserted into the upstream of the second reporter gene to verify whether the sequence has the function of a promoter; or inserting the gene sequence to be tested in the downstream of the second reporter gene to verify whether the sequence has the function of transcription termination; or introducing a promoter capable of working in a host into the upstream of a second reporter gene, and inserting an interested gene sequence to be tested between the promoter and the second reporter gene so as to verify whether a polypeptide coded by the gene sequence to be tested has the function of secreting a signal peptide;

wherein, the fusion expression is carried out on the 5' end of the tubulin gene or the fragment thereof expressed constitutively and the coding region beginning from the second amino acid coding gene of the ble gene;

wherein the host is Schizochytrium (A), (B) and (C)Schizochytrium sp)。

2. The recombinant nucleic acid molecule of claim 1, wherein said fragment is SEQ ID NO:1, nucleotides 1-756.

3. The recombinant nucleic acid molecule of claim 1, wherein said second reporter gene is a gene having a characterizable activity.

4. The recombinant nucleic acid molecule of claim 3, wherein said gene having characterizable activity is a chemo-developable gene, a chemiluminescent gene, and/or a resistance gene.

5. A host cell comprising the recombinant nucleic acid molecule of any one of claims 1-4; wherein the host cell is derived from Schizochytrium limacinum and expresses Rhizomucor miehei lipase.

6. Use of the recombinant nucleic acid molecule of any one of claims 1-4 or the host cell of claim 5 for homologous recombination.

7. A method of obtaining or analyzing the function of a test gene sequence of interest, the method comprising:

(1) transforming a host cell with the recombinant nucleic acid molecule of any one of claims 1-4; and

(2) determining the function of the gene sequence to be detected according to the expression condition of the reporter gene;

wherein the host cell is from Schizochytrium (A)Schizochytrium sp)；

The gene sequence to be detected comprises a promoter, a gene sequence for coding a secretion signal peptide and a terminator.

8. A product for homologous recombination or for analyzing gene function, comprising a recombinant nucleic acid molecule according to any one of claims 1-4.

9. The product of claim 8, wherein the product is a kit.

Images