CN105567715A - Schizochytrium sp alpha-tubulin related sequence and application thereof - Google Patents

Abstract

The invention relates to a schizochytrium sp alpha-tubulin related sequence and application of the schizochytrium sp alpha-tubulin related sequence, in particular to a schizochytrium sp alpha-tubulin gene sequence as shown in SEQ ID No.1, a schizochytrium sp alpha-tubulin sequence as shown in SEQ ID No: 2 and a schizochytrium sp alpha-tubulin gene 3'end noncoding region sequence as shown in SEQ ID No: 3. The invention further relates to fragments of the gene sequences, recombinant nucleic acid molecules containing the gene sequences or fragments of the gene sequences, application of the recombinant nucleic acid molecules to homologous recombination, and a method for gene function analysis by using the recombinant nucleic acid molecules.

Description

Schizochytrium limacinum alpha-tubulin correlated series and application thereof

Technical field

The invention belongs to genetically engineered field, be specifically related to schizochytrium limacinum alpha-tubulin correlated series and application thereof.

Background technology

Rapidly, biomass can reach 200g/L, and DHA productive rate can reach 0.69g/L.h (CN1416320A) in schizochytrium limacinum (Schizochytriumsp) growth.If it can produce zymoprotein, keeping again so high growth performance, is obviously splendid engineering bacteria group.Can high density fermentation, growth fast, extracellular protein is little, schizochytrium limacinum has the potentiality becoming exogenous gene expression host.

Disclosing of kettle algae expression alien gene is split in domestic and international utilization, as people's extracellular expression restructuring hemagglutinin (Hemagglutinin) [BayneAC such as Bayne, BoltzD, OwenC etc., Vaccinationagainstinfluenzawithrecombinanthemagglutinine xpressedbySchizochytriumsp.confersprotectiveimmunity, PLOS, 8 (4)]; The secreting, expressing of SexI secretion signal mediation disclosed in CN102648207A; CN102220369 Agrobacterium-mediated Transformation gus gene, the expression of EGFP gene in schizochytrium limacinum TI01101; US7759097 discloses and uses elongation factor (Elongationfactor1 α), Actin muscle (actin), the terminator of glyceraldehyde 3-phosphate dehydro-genase (glyceraldehyde-3-phosphatedehydrogenase) gene and the Homologous integration strategy based on 18SrDNA nucleotide sequence.Split in kettle algae express lipase there is no report.

Current, only disclose the expression system of tubulin promoter, Labyrinth μ lomycota both at home and abroad, use elongation factor (Elongationfactor1 α), Actin muscle (actin), the terminator of glyceraldehyde 3-phosphate dehydro-genase (glyceraldehyde-3-phosphatedehydrogenase) gene and the Homologous integration strategy based on 18SrDNA nucleotide sequence.Exogenous nucleic acid carrier is introduced in genome by Homologous integration mode, is certain to the sequence and the structure that change integration site place, causes gene inactivation or expression level to change.As, with promotor (being generally a section of promoter region downstream) for Homologous integration site, obviously this gene coding region will be made away from promotor original position, thus away from the possible expression regulation element in the upstream, that section of promoter region for recombinating, it is almost affirmative that Growth of Cells is affected; Using encoding gene as homologous site, this gene can inactivation.In addition, also have using rDNA as integration site, but rDNA transcription regulation mechanism is very complicated, using 18S as Homologous integration site, may cell growth impact.In most microorganism, this species diversity is perhaps not too important.But split kettle algae and can accumulate DHA, Biomass yield is extremely important to DHA productive rate, thus while expression alien gene, should try one's best and not suppress the growth of thalline.The growth change of kettle algae is split in existing invention, technology after openly but not referring to restructuring.

Eukaryote take genome as template, the mRNA transcribed out comprises 5 ' cap usually, encoding part, 3 ' UTR, AAUAAA site, the polyA site of 10-30bp and poly (A) tail end after AAUAAA (Wu Naihu. Principles of Gene Engineering, Beijing: Science Press, 2001 second editions), wherein AAUAAA is that mRNA precursor dissociates from transcription complex and Polyadenylation (poly (A)) modifies the recognition site needed, and this site has well-conserved (BenjaminLevin.GENES VIII, UpperSaddleRiver:PearsonPrenticeHall, 2004, Li Minggang, senior molecular genetics, Beijing: Science Press, 2004 first versions).Obviously, genome in correspondence, gene end AATAAA site be the required sequence of gene normal expression.Using the sequence between gene 3 ' end polyA recognition site and terminator codon as the site of homologous recombination, the expression of this gene can be had influence on most probably, thus change the growth characteristics of host cell.But using the sequence after polyA site as Homologous integration site, or from terminator codon to the full sequence in polyA site as Homologous integration site, can not impact host cell in theory.The present invention obtains tubulin 3 ' and holds into 1600bp, does not find to there is AATAAA conserved sequence.

For the microorganism that a genome does not carry out checking order, want to obtain its functional genomic fragment, as promotor, secreting signal peptide, terminator etc., need to use " catching " technology (trap).Namely use reporter gene to form cis element with unknown genomic fragment, whether the genomic fragment utilizing the activity of reporter gene to carry out inspection institute's insertion possesses functional.Then, inserted sequence is obtained by the method for pcr amplification, order-checking.This work is for easier the microorganism possessing free plasmid, but for pretty troublesome the microorganism not possessing free plasmid, because the carrier for trap must be integrated into as in genome, this requires the fragment that carrier must possess in host genome; Thus after trap carrier enters cell, integrate at the homologous site of fragment to be screened, very large puzzlement will be brought to follow-up acquisition sequence operative, because sequence to be obtained only has the sequence of this side of reporter gene to be clearly, investigator does not know the sequence of the testing gene the other end, the strategy can only attended a day school by genome goes little by little amplification, and the large workload of difficulty is complicated; And how long the fragment possessing function specifically should also cannot confirm, needs a large amount of inspection work.

Therefore, still need a kind of homologous recombination instrument of improvement, use this instrument, technician while carrying out Homologous integration, can not affect the growth of host, and can carry out catching of promotor, terminator or secreting signal peptide.

Summary of the invention

The present invention, according to known part tubulin gene promoter sequence, obtains tubulin full genome and gene 3 ' end non-coding region by degenerated primer, chromosome walking technology.Alpha-tubulin gene of the present invention has 1362bp, and its entirety or a part can as the fragments of Homologous integration; Alpha-tubulin 3 ' holds non-coding region to have 1597bp, and its entirety or a part also can enter genomic site as foreign gene Homologous integration.

The present invention holds one section of sequence as the site of Homologous integration using microtubule protein gene 3 ', finds the growth effect of host cell very little.The biomass that kettle algae is split in gained restructuring of the present invention is respectively the 96.5%-97.1% of wild type strain.Using tubulin promoter sequence disclosed in CN02812059 as the promotor of foreign gene and unique Homologous integration site, cultivate in the same way, the biomass that kettle algae is split in gained restructuring is the 78.2%-86.5% of wild type strain.Region disclosed in this invention does not affect host germ grew, can infer, the nucleic acid including Homologous integration region used, for homologous recombination (two ends extend sequence separately or all), all can not affect the growth of host.

Specifically, the invention provides a kind of nucleic acid molecule of separation, described nucleic acid molecule is selected from:

(1) fragment of SEQIDNO:1 or 3, or SEQIDNO:1 or 3, or the nucleotide sequence comprising SEQIDNO:1 or 3 or its fragment;

(2) nucleotide sequence of the nucleotide sequence complementary and described in (1); With

(3) under stringent condition with the nucleic acid molecule of (1) or (2) described nucleotide sequence hybridization.

In one embodiment, described fragment grows to few 200 continuous print Nucleotide, at least 300 continuous print Nucleotide, at least 400 continuous print Nucleotide, at least 500 continuous print Nucleotide, at least 600 continuous print Nucleotide, at least 700 continuous print Nucleotide, at least 800 continuous print Nucleotide, at least 900 continuous print Nucleotide or at least 1000 continuous print Nucleotide.

In a specific embodiment, described fragment is at least containing the 1-756 position Nucleotide of SEQIDNO:1.

In a specific embodiment, described fragment is at least containing the 1-562 position Nucleotide of SEQIDNO:3.

In a specific embodiment, described fragment is at least containing the 1-797 position Nucleotide of SEQIDNO:3.

The invention provides a kind of recombinant nucleic acid molecules, this recombinant nucleic acid molecules comprises the nucleotide sequence shown in SEQIDNO:1 or 3 or its fragment.

Recombinant nucleic acid molecules of the present invention can be a kind of carrier, for providing SEQIDNO:1 or 3 or its fragment.

Recombinant nucleic acid molecules of the present invention can also be a kind of expression vector, for the tubulin coded by recombinant expressed SEQIDNO:1.

Recombinant nucleic acid molecules of the present invention can contain nucleic acid molecule of the present invention and interested foreign gene.

Recombinant nucleic acid molecules of the present invention can also be a kind of targeting vector, for by interested homologous recombination to (such as, insertional vector) in host genome, or make goal gene lose function (such as, replaceability carrier).

In a specific embodiment, interested gene includes but not limited to lipase gene, proteinase gene, esterase, Phospholipid hydrolase and cellulase.

Recombinant nucleic acid molecules of the present invention can also be a kind of capturing carrier, for screening in host, obtaining and/or identify interested functioning gene pack section, as promotor, secreting signal peptide and terminator etc.

In a specific embodiment, described capturing carrier contains the first reporter gene, the second reporter gene, the microtubule protein gene of constitutive expression of host and testing gene sequence, wherein, the microtubule protein gene amalgamation and expression of the constitutive expression of the first reporter gene and host, the second reporter gene is the reporter gene of testing gene sequence; Wherein, testing gene sequence is inserted, in order to verify whether this gene order has promoter function at the second report upstream region of gene; Or insert testing gene sequence, in order to verify whether this gene order has Transcription Termination function at the second report downstream of gene; Or introduce promotor in the upstream of the second reporter gene, and between this promotor and this second reporter gene, insert testing gene sequence, in order to verify whether this gene fragment has secreting signal peptide function.

In a specific embodiment, the first reporter gene is and the zeocin antibiotics resistance gene of host gene amalgamation and expression to be analyzed (Streptoalloteichushindustanusbleomycingene is called for short ble gene).Described host gene is the gene of constitutive expression; Described amalgamation and expression is that the gene coding region 5 ' of constitutive expression holds peptide section and ble gene second amino acid to start amalgamation and expression.

Preferably, constitutive expression gene is microtubule protein gene.In a specific embodiment, the microtubule protein gene of described constitutive expression is as shown in SEQIDNO:1.

In a specific embodiment, second reporter gene is have to characterize active gene, include but not limited to that chemistry manifests (as tilactase, β-glucuronidase, Phosphoric acid esterase, Phospholipid hydrolase, proteolytic enzyme, lipase etc. can show the gene of color on screening flat board with specific substrates), chemoluminescence (as luciferase gene, horseradish peroxidase, alkaline phosphatase etc.), resistant gene (ammonia benzyl mycin class, kantlex, Totomycin, G418 etc.) etc.

The present invention relates to nucleic acid molecule of the present invention or recombinant nucleic acid molecules or carrier in homologous recombination and screen, obtain and/or identify purposes in interested functioning gene pack section etc. in host.

The invention provides a kind of host cell, it is characterized in that, described host cell contains recombinant nucleic acid molecules of the present invention.

In a specific embodiment, described host cell from schizochytrium limacinum, and expresses rhizomucor miehei lipase.

The present invention also provides a kind of method of analyzing gene function, it is characterized in that, described method comprises:

(1) with recombinant nucleic acid molecules transformed host cell of the present invention; With

(2) according to the expression of reporter gene, the function of analyzing gene.

In one embodiment, use following recombinant nucleic acid molecules transformed host cell: this recombinant nucleic acid molecules is a capturing carrier, the microtubule protein gene of the constitutive expression containing the first reporter gene, the second reporter gene, this host and testing gene sequence, wherein, the microtubule protein gene amalgamation and expression of the constitutive expression of the first reporter gene and host, the second reporter gene is the reporter gene of testing gene sequence; Wherein, testing gene fragment is inserted in the upstream of the second reporter gene; Wherein, when the second reporter gene expression, this testing gene sequence is indicated to have promoter function.

In a specific embodiment, use following recombinant nucleic acid molecules transformed host cell: this recombinant nucleic acid molecules is a capturing carrier, the microtubule protein gene of the constitutive expression containing the first reporter gene, the second reporter gene, host and testing gene sequence, wherein, the microtubule protein gene amalgamation and expression of the constitutive expression of the first reporter gene and host, the second reporter gene is the reporter gene of testing gene sequence; Wherein, insert testing gene sequence at the second report downstream of gene, when the second reporter gene has activity, show that inserted fragment can the transcribing of terminator, namely there is Transcription Termination function.

In a specific embodiment, use following recombinant nucleic acid molecules transformed host cell: this recombinant nucleic acid molecules is a capturing carrier, the microtubule protein gene of the constitutive expression containing the first reporter gene, the second reporter gene, host and testing gene sequence, wherein, the microtubule protein gene amalgamation and expression of the constitutive expression of the first reporter gene and host, the second reporter gene is the reporter gene of testing gene sequence; Wherein, promotor is introduced in the upstream of the second reporter gene, and testing gene sequence is inserted between this promotor and this second reporter gene, when the vigor of the second reporter gene being detected in extracellular, show that mixed testing gene sequence can instruct reporter gene to be secreted into outside born of the same parents, namely the peptide section of this gene sequences encode has the function of secreting signal peptide.

The present invention also provides a kind of method of homologous recombination, and described method uses alpha-tubulin gene or its fragment or alpha-tubulin 3 ' to hold non-coding region gene or its fragment as the fragment of Homologous integration.

In one embodiment, described alpha-tubulin gene is as shown in SEQIDNO:1.

In one embodiment, described fragment at least containing the 1-756 position Nucleotide of SEQIDNO:1, or at least contains the 1-562 position Nucleotide of SEQIDNO:3, or at least containing the 1-797 position Nucleotide of SEQIDNO:3.

The present invention also provides a kind of test kit for homologous recombination or the product for analyzing gene function, described test kit or product comprise recombinant nucleic acid molecules of the present invention, or comprise alpha-tubulin gene or its fragment or alpha-tubulin 3 ' holds non-coding region gene or its fragment; Preferably, described product is test kit.

In one embodiment, described alpha-tubulin gene is as shown in SEQIDNO:1.

In one embodiment, described fragment at least containing the 1-756 position Nucleotide of SEQIDNO:1, or at least contains the 1-562 position Nucleotide of SEQIDNO:3, or at least containing the 1-797 position Nucleotide of SEQIDNO:3.

Accompanying drawing explanation

Fig. 1: the PCR primer electrophorogram of amplification microtubule protein gene.Digital label is the title of downstream primer used, and arrow is the band of the PCR primer that Successful amplification goes out.Article six, in primer, only " 300 " are successfully completed amplification.

Fig. 2: split the grads PCR result figure that kettle algae RNA solution and RNA reverse transcription product are template.M is Takara company 1000bpDNALadder, A-H is the electrophoresis of six thermograde amplified productions.A, B, E, F tetra-products of tape label are used as subsequent experimental.

Fig. 3: gene walks read mode amplification tubulin sequence scheme schematic diagram.Primer represents four degenerated primers of AD1-4 mentioned above.

Fig. 4: gene is attended a day school third round product electrophorogram.In figure, the degenerated primer that AD1, AD2, AD3, AD4 design for the present invention; The degenerated primer that AP1, AP3, AP4 provide for Takara company GenomeWalking test kit.

Fig. 5: pick out for subsequent use, the homologous recombination plasmid enzyme restriction of tubulin 3 ' non-coding region mediation checks electrophorogram.

Fig. 6: after the dull and stereotyped zeocin resistant clones that obtains of screening is transferred to rhodamine flat board, cultivation results photo.4,6,38,39 is strain number.

Fig. 7: it is at tubulin 3 ' non-coding region the primer position view that kettle algae is split in qualification restructuring.

Fig. 8: check 39# restructuring to split kettle algae electrophorogram across integration site PCR.

Fig. 9: splitting kettle algae 39# genomic dna to recombinate is template, PCR assay figure.

Figure 10: split kettle algae fermented supernatant fluid (CS), serums liquid (CH), serums supernatant liquor (HS) rhodamine flat board colour developing result photo.39#, 38# are that kettle algae culture is split in two restructuring, and Wild is wild type strain (Wildtype) culture.

Kettle algae is split in Figure 11: RML restructuring and wild-type splits kettle frustule lysate supernatant electrophorogram.Marker is protein standard substance, for kettle algae albumen Ni purifying electrophorogram is split in restructuring on the left of Marker, for wild-type splits kettle algae albumen Ni purifying electrophorogram on the right side of Marker.In figure, WTLS is that wild-type splits kettle algae lysate supernatant, and RSLS is that kettle algae cracking supernatant is split in restructuring, and Penetrate is not by the albumen that Ni adsorbs, and Elute1 (2) is wash-out first time, secondary sample.Marker is ThermoScientific company PageR μ lerTM pre-dyed albumen Ladder (#26616).

Figure 12: tubulin transcription termination region, as Homologous integration site, introduces Mortierella alpina gene to the carrier schematic diagram split in kettle algae genome.

Figure 13: wild-type splits kettle algae lipid gas chromatogram.

Kettle algae lipid gas chromatogram is split in Figure 14: TTM restructuring.

Kettle algae lipid gas chromatogram is split in Figure 15: 8M restructuring.

The structure iron of Figure 16: tubzeo1301 plasmid.

Figure 17: catch (Trap) obtain there is the position of promoter active fragment on genome.Black is trap Product Sequence, and grey is the fragment gene encoding sequence that initiator codon starts.Blank is trap product and the space of gene in fact between codon.The numeral of top is in gene order-checking result, the position of rising on scaffold corresponding to end of amplifying nucleic acid of the present invention.

Embodiment

As shown in the Examples, the present invention obtains alpha-tubulin encoding sequence and 3 ' the non-coding region sequence of schizochytrium limacinum (Schizochytrium) by series of steps.Shown in the SEQIDNO:1 of this alpha-tubulin encoding sequence, the aminoacid sequence of its coding is as shown in SEQIDNO:2, and 3 ' non-coding area sequence is as shown in SEQIDNO:3.

The present invention utilizes alpha-tubulin gene and 3 ' end non-coding sequence or its fragment thereof to enter the genomic target area of schizochytrium limacinum as foreign vector Homologous integration.

" fragment " refers to a part of continuous print sequence of full length sequence.Usually, the length of the fragment of alpha-tubulin gene of the present invention or its 3 ' end non-coding sequence is at least 200 continuous print Nucleotide, at least 300 continuous print Nucleotide, at least 400 continuous print Nucleotide, at least 500 continuous print Nucleotide, at least 600 continuous print Nucleotide, at least 700 continuous print Nucleotide, at least 800 continuous print Nucleotide, at least 900 continuous print Nucleotide or at least 1000 continuous print Nucleotide.

In the specific embodiment of the application, described fragment is the 1-756 position Nucleotide of SEQIDNO:1, the 1-797 position Nucleotide of SEQIDNO:3 or 1-562 position Nucleotide.But should be understood that with regard to the object realizing homologous recombination, the length of fragment can proper extension, and also can suitably shorten, this is that those skilled in the art just can easily determine according to practical situation.

The present invention also comprises and SEQIDNO:1,3 or the nucleotide sequence of its fragment complementation, and under hybridization conditions with SEQIDNO:1,3 or its fragment sequence of hybridizing.Hybridization conditions described in contriver, as described in CN1556850A, comprises Standard hybridization conditions, medium strict hybridization conditions and highly strict hybridization conditions, it is included in by reference in full herein herein.

The full length sequence of nucleic acid molecule of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.

Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.

In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.

At present, nucleic acid molecule of the present invention can be obtained by chemosynthesis completely.Then this DNA sequence dna can be introduced in various existing DNA molecular (or as carrier) as known in the art and cell.

The method of application round pcr DNA amplification is optimized for and obtains gene of the present invention.When being particularly difficult to obtain the cDNA of total length from library, preferably can use RACE method (RACE-cDNA end rapid amplification), primer for PCR suitably can be selected according to sequence information of the present invention disclosed herein, and using conventional procedures synthesis.Using conventional procedures is as the DNA fragmentation increased by gel electrophoresis abstraction and purification.

For realizing homologous recombination object, usually nucleic acid molecule of the present invention is built into the form of carrier.Carrier can contain nucleic acid molecule of the present invention, interested foreign gene, marker gene, and realizes other element of homologous recombination function.For different homologous recombination objects, carrier also can contain corresponding element, the such as promotor of interested foreign gene, enhanser etc.

" foreign gene " described in the application refers to the gene introduced from host outside, no matter and whether this host itself has existed this gene.

Therefore, carrier of the present invention can be, such as targeting vector, for by interested homologous recombination in host genome (such as, or insertional vector), or make interested goal gene lose function (such as, replaceability carrier); Also can be capturing carrier, for screening in host, obtaining and/or identify interested functioning gene pack section, as promotor, secreting signal peptide and terminator etc.

As one of the example of carrier of the present invention, the present invention uses based on Invitrogen company pGAPZ α-A vector construction carrier of the present invention.The endonuclease that building process uses this area investigator to be familiar with, nucleic acid ligase, nucleic acid dephosphorylation enzyme, PCR enzyme etc., and operate according to the operation instruction of producer.This carrier contains rhizomucor miehei lipase (RML) gene (GenBank:A02536.1); Use the expression of yeast transcriptional elongation factor promotor (pTEF) initial RML, described pTEF element is from carrier pGAPZ α A; Described expression uses yeast alcohol oxidase gene terminator sequence (3 ' AOX) to stop the expression of RML, and described 3 ' AOX is from Yeast expression carrier pGAPZ α A; Described expression uses schizochytrium limacinum microtubule protein gene terminator as Homologous integration site.

On this carrier, RML gene end amalgamation and expression has the 6 × HIS label on pGAPZ α-A carrier, and the product of therefore external source RML genetic expression carries out purifying by nickel (NI) to the specific adsorption of HIS.The present invention uses covalent cross-linking to have albumen in gel (be called for short NI pearl) the purification of Recombinant schizochytrium limacinum enchylema of NI, adsorbs albumen in wild type strain enchylema as contrast simultaneously.Be adsorbed with the NI pearl of albumen after fully washing, the protein adsorbed under using elution, and by SDS-PAGE electrophoresis detection.Described absorption, washing, elution action carry out according to the NI pearl description of product, and described SDS-PAGE electrophoresis is the experimental implementation that this area investigator knows.The present invention finds, the albumen of restructuring expressed by schizochytrium limacinum, and be difficult in its natural state adsorb with NI, therefore purifying of the present invention and elution action all carry out under denatured condition, thus cannot detect the vigor of absorption band.Whether the substrate that the present invention uses the p-NP cetylate (PNPP) known by lipase investigator to detect as lipase activity, detecting external source RML has expression.Described Enzyme activity assay method be operating as known by the investigator of this area.

The out of Memory of carrier can with reference to CN1556850A, is included in by reference herein by full content disclosed in it herein.

Utilize nucleic acid molecule of the present invention or carrier, gene knockout and gene replacement etc. can be realized.

Interested gene comprises various functional gene, such as lipase gene, proteinase gene, esterase, Phospholipid hydrolase, cellulase etc.

Nucleic acid molecule of the present invention or carrier also can be utilized in host, to screen, obtain and/or identify interested functioning gene pack section, as promotor, secreting signal peptide and terminator.

In a specific embodiment, the invention provides a new catching method, the method uses following capturing carrier: this carrier contains two reporter genes, and one of them gene is zeocin, and amalgamation and expression is held in 5 ' of the microtubule protein gene coding region of itself and constitutive expression.Only have the promotor that could utilize tubulin when this capturing carrier to be integrated into the genome of host in tubulin coding region, start the expression of tubulin-zeocin gene, thus reconstitution cell could be allowed to possess zeocin resistance.This carrier is also containing second reporter gene (such as Totomycin), as the reporter gene of target acquisition promotor, only have when at the genomic fragment of the front insertion of second reporter gene (such as hygromycin gene), there is promoter function, second reporter gene just can be expressed in reconstitution cell, thus make this reconstitution cell show corresponding biologic activity, such as possess hygromycin resistance.

When reconstitution cell possess simultaneously zeocin, Totomycin Double time, show in this reconstitution cell, foreign vector site-directed integration is in tubulin position, and the fragment inserted before Totomycin has promoter function.Feature of the present invention is, the part fragment inserted before Totomycin is provided with activity certainly, and this border, fragment both sides is very clear, is all the element on carrier, and therefore pcr amplification obtains that the fragment workload inserted is little, query is few.Query how long of should increasing can not be there is.The present invention uses splits the site of a kettle algae constitutive gene tubulin coding region 5 ' end part as Homologous integration, and advantage is that constitutive expression can not cause silence because of the change of environment, brings the false negative of catching; Two is existence that tubulin generally has several copy, and the insertion of Single locus can not cause necrocytosis.Zeocin is the one of bleomycin or bleomycin (bleomycin/phleomycin) family, is activated after zeocin enters cell, then ties together-cutting genome with genome, causes necrocytosis.This microbiotic all has toxicity to bacterium, fungi, plant and animal cell, and use range is extensive.The albumen of the antibiotic resistant gene coding of Zeocin is reversibly combined with zeocin thus stops it to the cutting action of DNA.

The present invention uses zeocin as reporter gene, advantage be this gene resistance embody be reversibly be combined with microbiotic, instead of the modification of other resistant genes, cutting microbiotic, thus when amalgamation and expression, its resistance activity be not vulnerable to merge impact.

Another kind of reporter gene can not be Totomycin, but other possess the gene of reporter gene activity, as fluorescence, chemoluminescence, can show the enzyme of vigor on flat board.

Similarly, in carrier, if fragment to be analyzed is connected into the downstream of reporter gene, the genomic fragment possessing Transcription Termination function can be screened; If introduce the promotor determined in the upstream of second reporter gene, then in the middle of promotor and this second reporter gene, insert genomic fragment to be analyzed, the genomic fragment with secreting signal peptide function can be screened.

The present invention also comprises the host having transformed carrier of the present invention, has especially transformed carrier of the present invention and has expressed the host of lipase.

Hereafter the mode with specific embodiment is produced the present invention.Should be understood that the present invention is not limited to following specific embodiment.In embodiment, unless otherwise stated, the method for the method provided by manufacturers or routine is implemented.

Embodiment one

According to published schizochytrium limacinum α tubulin promoter sequence, design upstream primer:

TubU：5’ACAAGGTCGATAAACTAAGCTCCTCAC(SEQIDNO:4)；

Several downstream primers are designed according to tubulin conservative property:

31:TGATGCGCTCGAGCTGGAGGT(SEQIDNO:5)；

206:TAGTGGCCCTTGGCCCAGTTGTTGC(SEQIDNO:6)；

300:GTGGGTGATCTGGAAGCCCTGGAGGCAG(SEQIDNO:7)；

547:GGGTGGTGAGCTTGAGGGTGCGGAAG(SEQIDNO:8)；

796:CGGCGCACATCATGTTCTTGGCAT(SEQIDNO:9)；

With YPDS substratum (10g/L yeast powder, peptone 10g/L, glucose 10g/L, sea salt 18g/L, pH6.8), cultivate schizochytrium limacinum (ATCC20888) 3 days in 28 DEG C of 200rpm shaking tables, the centrifugal 10min of 6000rpm to collect after thalline grinds in liquid nitrogen immediately, and uses Takara company 9770QDNAiso reagent to extract genomic dna.Using schizochytrium limacinum genomic dna as template, Takara company Ex-taq enzyme is used to increase.All PCR upstream primers are TubU, and downstream primer is different separately; After often group system component adds, softly mix, 25 μ l/ pipes are dispensed in 8 reaction tubess, carry out the PCR reaction of 8 differing tempss.PCR carries out at BIO-RADMyCycler grads PCR instrument, and grads PCR temperature is set to 64-55 DEG C, 8 gradients.Use Takara company Ex-TaqDNA polymeric enzymatic amplification, PCR system is as follows: water 15 μ l; 10 × PCR damping fluid 2.5 μ l, concentration is respectively the dNTPs2 μ l of 2.5mM, 20uM primer each 2 μ l, Ex-taq0.1 μ l, 100ng/ μ l genomic dna 0.5 μ l.PCR programming is 95 DEG C of 4min; 33 circulations: 94 DEG C of 30s, gradient 50s, 72 DEG C of 90s; 72 DEG C of 10min.PCR primer carries out 1% agarose electrophoretic analysis, and result is (each combination of primers has 8 temperature condition, and light a cigarette 8 holes) as shown in Figure 1.Use 300 obtains specific PCR primer band (Fig. 1, shown in arrow) as the combination of downstream primer.

This band is checked order, obtains the partial sequence of the albumen of microtubule:

ATGCGTGAGGTCATCTCCATCCACATCGGCCAGGCCGGTGTTCAGGTCGGTAACGCCTGCTGGGAGCTCTACTGCCTCGAGCATGGCATCCAGCCGGACGGCCAGATGCCCTCGGACAAGACCATTGGCGGCGGCGATGATGCCTTCAACACCTTCTTCTCCGAGACTGGCGCCGGCAAGCACGTGCCCCGCGCCGTGCTCGTCGATCTCGAGCCCACCGTCTGTGACGAGGTCCGCACCGGCACCTACCGCGCTCTTTACCACCCCGAGCAGATCATCACCGGCAAGGAGGACGCTGCCAACAACTACGCTCGTGGCCACTACACCATCGGCAAGGAGATCGTCGACCTCGTCCTCGACCGCATCCGCAAGCTCGCCGACAACTGCACTGGCCTCCAGGGCTTCCAGATCACCCAC

This sequence, from the initiator codon ATG of expection, has continuous print to encode, the aminoacid sequence inferred comparison on NCBI, finds there is the highest homology with alpha-tubulin sequence.Consider and can, at the 3 ' end modified interpolations polyA, therefore consider after RNA reverse transcription after rna transcription, oligodT be as downstream primer in use, and designs 2 upstream specific primer according to known array and carry out nested PCR amplification, to obtain tubulin sequence.Extracted the total serum IgE (shown in Fig. 2 left side) of schizochytrium limacinum by Takara company RNaisoPlus reagent, then use FermentasReverAidFirstStrandcDNASynthesisKit to carry out reverse transcription.Reverse transcription system reaction system and process as follows: 250ngRNA, 1 μ lOligodT (50uM), 1 μ ldNTP (each 2.5mM), moisturizing mixes to 10 μ l, 65 DEG C of heating in water bath ice bath immediately after 5 minutes; Then add 4 μ l5 × reverse transcription buffer, 0.5 μ lRNase inhibitor, 1 μ l ThermoScript II moisturizing are to 20 μ l.Reverse transcription program is: 42 DEG C of 60min; 70 DEG C of 15min.The product of reverse transcription is as the template of follow-up PCR, the system of first round PCR is as follows: water 34 μ l, 10 × damping fluid 5 μ l, concentration is respectively the dNTPS4 μ l of 2.5mM, 20uM primer TU0 (atgcgtgaggtcatctccatccacatc, SEQIDNO:48) 2 μ l, test kit carries 50uMOligodT primer 1 μ l, Ex-Taq0.3 μ l, reverse transcription product solution 2 μ l.The program of PCR reaction is: 94 DEG C of 5min; 16 circulations: 95 DEG C of 50s, gradient 50s, 72 DEG C of 2min, 95 DEG C of 50s, 44 DEG C of 50s, 72 DEG C of 2min; 72 DEG C of 10min.Gradient is set to 64-50 DEG C, 8 temperature step (A-H).Grads PCR product checks (Fig. 2) on 1% agarose gel electrophoresis.

Doubtful band blob of viscose will be cut out, use Omega company gel to reclaim test kit and reclaim.The fragment reclaimed is connected into pMD18-T carrier, and linked system is: water 15.5 μ l, 10 × T4DNA ligase enzyme damping fluid 2 μ l, PCR primer 2 μ l, pMD18-T0.5 μ l.Condition of contact be 22 DEG C 30 minutes.Connector adopts heat shock method transformation of E. coli DH5 α mentioned above, selects mono-clonal, extracts plasmid and electroresis appraisal.Send plasmid order-checking, after the sequence obtained and existing sequence assembly, obtain following sequence:

ATGCGTGAGGTCATCTCCATCCACATCGGCCAGGCCGGTGTTCAGGTCGGTAACGCCTGCTGGGAGCTCTACTGCCTCGAGCATGGCATCCAGCCGGACGGCCAGATGCCCTCGGACAAGACCATTGGCGGCGGCGATGATGCCTTCAACACCTTCTTCTCCGAGACTGGCGCCGGCAAGCACGTGCCCCGCGCCGTGCTCGTCGATCTCGAGCCCACCGTCTGTGACGAGGTCCGCACCGGCACCTACCGCGCTCTTTACCACCCCGAGCAGATCATCACCGGCAAGGAGGACGCTGCCAACAACTACGCTCGTGGCCACTACACCATCGGCAAGGAGATCGTCGACCTCGTCCTCGACCGCATCCGCAAGCTCGCCGACAACTGCACTGGTCTCCAGGGCTTCCTCTGCTTCAACGCCGTCGGCGGTGGTACCGGCTCCGGTCTCGGTTCGCTCCTCCTCGAGCGTCTGAGCGTCGACTACGGCCGCAAGTCCAAGCTCGGCTTCTGCGTCTACCCCTCGCCCCAGGTGTCGACCGCTGTCGTCGAGCCCTACAACTGCGTGCTCTCGACGCACTCGCTCCTCGAGCACACCGATGTCGCCGTCATGCTCGACAACGAGGCCATCTACGACATCTGCCGTCGTTCGCTCGACATTGAGCGCCCGACCTACACCAACCTGAACCGCCTGGTCGCTCAGGTCATCTCGTCGCTGACCGCCTCGCTTCGCTTCGATGGTGCTCTCAACGTCGATATCACCGAGTTCCAGACCAACCTGGTCCCGTACCCGCGCGGATGTGGATGGAGATGACCTCACGCAT

This sequence, from expection initiator codon ATG, has continuous print to encode, the aminoacid sequence inferred comparison on NCBI, finds there is the highest homology with alpha-tubulin.Because current gained sequence also has not enough compared with the length of 1300 polybase bases of usual alpha-tubulin, therefore consider that the mode using gene to attend a day school obtains longer sequence.

Design 3 groups of target sequence Auele Specific Primers:

SP1:ATGCGTGAGGTCATCTCCATCCACATC(SEQIDNO:10)；

SP2:TCTTTACCACCCCGAGCAGATCATCAC(SEQIDNO:11)；

SP3:GACCGCTGTCGTCGAGCCCTACAACTG(SEQIDNO:12)

Design four degenerated primers:

AD1:SWGANAWGAA(SEQIDNO:13)；

AD2:GTNCGASWCANAWGTT(SEQIDNO:14)；

AD3:WGTGNAGWANCANAGA(SEQIDNO:15)；

AD4:NTCGASTWTSGWGTT(SEQIDNO:16)。

Wherein N (A/T/G/C), S (G/C), W (A/T).Gene attends a day school tactful schematic diagram as shown in Figure 3.Gene is attended a day school to be needed to carry out three-wheel PCR, and the system of first round PCR is: water 7.5 μ l, 2 × GC I damping fluid 25 μ l, concentration is respectively the dNTPs8 μ l of 2.5mM, primer SP120uM1 μ l, primer ADx20uM5 μ l, TakaraLA-taq0.5 μ l, 100ng/ μ lgDNA1 μ l.PCR program is: 94 DEG C of 1min; 98 DEG C of 1min; 5 circulations: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min; 94 DEG C of 30s, 25 DEG C of 3min, 72 DEG C of 2min; 16 circulations: 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 65 DEG C of 1min, 72 DEG C of 2min, 94 DEG C of 30s, 44 DEG C of 1min, 72 DEG C of 2min; 72 DEG C of 10min.PCR primer is analyzed on 1% sepharose, and doubtful band is cut out, checked order.PCR primer of attending a day school electrophoresis as shown in Figure 4.

Increase 7 kinds of random primers the band of the about 2K obtained, and cuts glue and reclaim, serve Hai Shenggong and check order with SP3 primer, and it is the gene order of 1362bp afterwards that sequencing result and known array splice, from initiator codon to terminator codon, as shown in SEQIDNO:1; Its aminoacid sequence is as shown in SEQIDNO:2.

In addition, order-checking obtains the partial sequence that alpha-tubulin encoding sequence 3 ' holds non-coding region, as shown in SEQIDNO:3.

Embodiment two

BlastN (nucleic acid sequence alignment) comparing result is as shown in Table 1:

Table one: the present invention obtain the result of tubulin nucleotide sequence comparison on GeneBank

The comparison on GENEBANK of terminator sequence, finds the homology having enough Blastn to go out to report without any sequence and this sequence.Obviously, this is two new sequences, and coding region amino acid identity highest goal is Phytophthorainfestans, belongs to Oomycete (stramenopiles) together with thraustochytriale section.The highest similarity of nucleic acid comparison is micro-Zymomonas mobilis (Micromonas).Not yet have split kettle Trentepohlia, thraustochytriale section, thraustochytriale have alpha-tubulin sequence open.

Embodiment three

Using 3 ' non-coding region of above-mentioned tubulin as the target area of Homologous integration, carry out fixed point restructuring.According to this thinking, build and split kettle algae restructuring carrier.

Use primer RmlMaU:aaaccatggGAAATCAACGAACTTAC (SEQIDNO:17) and RmlDSal:aaaGTCGACagtacacaaaccggtgttaat (SEQIDNO:18), with RML genophore for template, amplification RML lipase gene, makes it 5 ' and 3 ' and holds respectively with NcoI and SalI restriction enzyme site.PCR system is water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lrTaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 52 DEG C of 50s, 72 DEG C of 1min; 72 DEG C of 10min.PCR primer is after Omega company CyclePure kits, and use NcoI and SalI restriction enzymes double zyme cutting, enzyme tangent condition is carried out according to product description, and it is totally 50 μ l that enzyme is cut, PCR primer consumption 20 μ l.

Use BamHI, NcoI restriction enzyme (purchased from Takara company) enzyme to cut pGAPZ α A vector plasmid (purchased from general as spit of fland biotechnology (Beijing) company limited), digestion products isolates the pTEF element on plasmid through 1% agarose gel electrophoresis.BglII, SalI restriction enzyme (purchased from Takara company) enzyme is used to cut pGAPZ α A vector plasmid (purchased from general as spit of fland biotechnology (Beijing) company limited), digestion products isolates the remaining large fragment of plasmid pGAPZ α A through 1% agarose gel electrophoresis, the band of about 2350bp.Use Omega company gel to reclaim test kit and reclaim RML endonuclease bamhi, pTEF element fragment, pGAPZ α A carrier B glII, SalI fragment.The recovery product that RML, pTEF two glue reclaim uses Fermentas company's T 4DNA ligase enzyme to connect, and linked system is: water 15 μ l, T4DNA ligase enzyme damping fluid 2 μ l, T4DNA ligase enzyme 0.5 μ l, pGAPZ α A0.5 μ l, RML endonuclease bamhi 2 μ l, 16 DEG C of water bath heat preservation 2h; Then add pGAPZ α A carrier B glII, SalI fragment, and add ligase enzyme T4DNA ligase enzyme 0.5 μ l, 16 DEG C of water bath heat preservations spend the night.Connector and 200 μ lCaCl ₂the standby bacillus coli DH 5 alpha of legal system softly mixes, ice bath 42 DEG C of water-bath heat shocks 90 seconds after 30 minutes, then ice bath is proceeded in ice immediately 3 minutes, add 800 μ lLB nutrient solutions, put 37 DEG C of shaking table 200rpm shaking culture 1h, be coated on the LB flat board containing 50 μ g/mlzeocin, 37 DEG C of incubator overnight incubation.Gained zeocin resistant clones is by RmlMaU, RmlDSal primer, and utilize Takara company rTaqDNA polysaccharase to carry out bacterium colony PCR screening, specific practice is: choose bacterium colony culture and be about 1mm ³to in 10 μ l sterilized waters, mixing, adds 2 μ ldNTPs, 2.5 μ l10 × PCR damping fluids, each 1 μ l of primer, 0.4 μ lrTaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 33 circulations, 52 DEG C of 50s, 72 DEG C of 1min; 72 DEG C of 10min.PCR primer is separated through 1% agarose gel electrophoresis, obtains the bacterium colony of about 1kb band for the successful bacterium colony of clone.Inoculate this bacterium colony to the 5mlLB nutrient solution containing 50 μ g/mlzeocin, 37 DEG C of shaking table 200rpm overnight incubation, Axygen company mini-scale plasmid is used to extract test kit extraction plasmid for subsequent use, called after pGAPZ α A-RML, this carrier uses the initial RML genetic expression of pTEF promotor, and makes 6 HIS labels on RML gene end band.

Use primer TTE5 ': gcgagcacaactgcttggcttcagct (SEQIDNO:19) and primer tubTT3Ba:aatctagacgtgtcgctgctccagacaaag (SEQIDNO:20), to split kettle algae Genomic DNA solution for template, use the LA-TaqDNA polymeric enzymatic amplification tubulin terminator partial nucleic acid sequence of Takara company band GCset, amplification system is: 2 × GCI damping fluid 25 μ l, dNTPs6 μ l, the each 2 μ l of primer, gDNA2ng, LA-TaqDNA polysaccharase 0.5 μ l, mends aseptic deionized water to 50 μ l.PCR condition is: 94 DEG C of denaturations 5 minutes; The touchdown PCR of 10 circulations: 95 DEG C of 40s, 60 DEG C of 50s also often circulation reductions by 1 DEG C, 72 DEG C of 40s; PCR:95 DEG C of 40s of 30 circulations, 52 DEG C of 50s, 72 DEG C of 40s; 72 DEG C extend 10 minutes.PCR primer is separated through 1% agarose gel electrophoresis, cuts the band of about 800bp, uses Omega company gel to reclaim test kit and reclaims.The nucleic acid reclaimed is the nucleic acid of 1-797bp in SEQIDNO:3, it is connected with pMD18-T carrier, connects and uses FermentasT4DNA ligase enzyme, linked system is: water 16.2 μ l, pMD18-T0.5 μ l, T4DNA ligase enzyme damping fluid 2 μ l, T4DNA ligase enzyme 0.3 μ l, PCR primer 1 μ l; Condition of contact is 16 DEG C of water-bath 2h.Connect product and the standby bacillus coli DH 5 alpha of 200 μ lCaCl2 legal systems softly mixes, ice bath 42 DEG C of water-bath heat shocks 90 seconds after 30 minutes, then ice bath is proceeded in ice immediately 3 minutes, add 800 μ lLB nutrient solutions, put 37 DEG C of shaking table 200rpm shaking culture 1h, be coated on the LB flat board containing 50 μ g/ml penbritins, 37 DEG C of incubator overnight incubation.Gained Ampicillin resistant colonies passes through TTE5 ' and M13-48:gagcggataacaatttcacacagg (SEQIDNO:21) primer, utilize Takara company rTaqDNA polysaccharase to carry out bacterium colony PCR screening, specific practice is: choose bacterium colony culture and be about 1mm ³to in 10 μ l sterilized waters, mixing, adding 2 μ l concentration is respectively the dNTPs of 2.5mM, 2.5 μ l10 × PCR damping fluids, each 1 μ l of primer, 0.4 μ lrTaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 33 circulations, 52 DEG C of 50s, 72 DEG C of 1min; 72 DEG C of 10min.PCR primer is separated through 1% agarose gel electrophoresis, obtains the bacterium colony of about 900bp band for the successful bacterium colony of clone.Inoculate this bacterium colony to the 5mlLB nutrient solution containing 50 μ g/ml penbritins, 37 DEG C of shaking table 200rpm overnight incubation, use Axygen company mini-scale plasmid to extract test kit extraction plasmid for subsequent use, called after TF-18T.

Use BamHI digestion with restriction enzyme TF-18T plasmid, the enzyme system of cutting is: water 23 μ l, K damping fluid 5 μ l, plasmid 20 μ l, restriction endonuclease 2 μ l; Enzyme tangent condition is 30 DEG C of water-bath 2h.Use BamHI digestion with restriction enzyme pGAPZ α ARML carrier, the enzyme system of cutting is: water 23 μ l, K damping fluid 5 μ l, plasmid 20 μ l, restriction endonuclease 2 μ l; Enzyme tangent condition is 37 DEG C of water-bath 2h.After digestion products 1% agarose gel electrophoresis is separated, uses Omega company gel to reclaim test kit and reclaim plasmid enzyme list section section.Enzyme after purified is cut thing and is used FermentasT4DNA ligase enzyme to connect, and linked system is: water 13.7 μ l, and enzyme cuts each 2 μ l of thing, T4DNA ligase enzyme damping fluid 2 μ l, T4DNA ligase enzyme 0.3 μ l; Condition of contact is 16 DEG C of water-bath 2h.Connect product and 200 μ lCaCl ₂the standby bacillus coli DH 5 alpha of legal system softly mixes, ice bath 42 DEG C of water-bath heat shocks 90 seconds after 30 minutes, then ice bath is proceeded in ice immediately 3 minutes, add 800 μ lLB nutrient solutions, put 37 DEG C of shaking table 200rpm shaking culture 1h, be coated on containing on 50 μ g/ml penbritins and the antibiotic LB flat board of 50 μ g/mlzeocin, 37 DEG C of incubator overnight incubation.Inoculation bacterium colony is to containing in 50 μ g/ml penbritins and the antibiotic 5mlLB nutrient solution of 50 μ g/mlzeocin, and 37 DEG C of shaking table 200rpm overnight incubation, use Axygen company mini-scale plasmid to extract test kit extraction plasmid for subsequent use.Use KpnI digestion with restriction enzyme gained plasmid, enzyme tangent condition is: water 12 μ l, L damping fluid 2 μ l, plasmid 5 μ l, restriction endonuclease 1 μ l; Enzyme tangent condition is 37 DEG C of water-bath 1h.Enzyme is cut thing and is detected through 1% agarose gel electrophoresis, and electrophoresis result as shown in Figure 5.Plasmid has two kinds of resulting schemas after KpnI enzyme is cut, and cuts thing be connected into different directions for pGAPZ α A-RML enzyme.407 plasmids are selected to use as follow-up study.

Use particle gun to be proceeded to by 407 plasmids to split in kettle algae.Concrete steps are as follows: use YPD culture medium culturing schizochytrium ATCC20888, culture medium prescription is: yeast powder 10g/L, peptone 20g/L, glucose 20g/L, artificial sea salt 18g/L, mend deionized water to 1L, pH6.5,121 DEG C of autoclavings 20 minutes.Substratum is contained in 250ml wide mouth band baffle plate Erlenmeyer flask, and liquid amount 50ml, seed is the glycerol stocks pipe of bacterial classification.Culture is after 28 DEG C of shaking table 200rpm shaking culture 48h, and 1% ratio is transferred in new 50ml nutrient solution by volume, and 28 DEG C of shaking table 200rpm cultivate 24h.Transfer culture is in 50ml aseptic plastic centrifuge tube, 4000rpm room temperature collects thalline in centrifugal 5 minutes, use 5ml stroke-physiological saline solution suspension cell precipitation, get 50 μ l suspension on YPD flat board: fill a prescription as YPD nutrient solution formula adds 1.8g/L agar powder.Flat board is put 28 DEG C of incubators cultivation 1h and is made surface drying.Prepare bronze solution in advance: 1. take 30mg0.6um bronze microcarrier in 1.5mlEppendorf centrifuge tube, add 1ml70% ethanolic soln (HPLC level dehydrated alcohol ultrapure water configures), fully vibration 4 minutes; 2. 15 minutes are left standstill; 3. of short duration centrifugal 5 seconds (Eppendorf small desk whizzer " Short " pattern), supernatant is abandoned; 4. add 1ml deionized water in precipitation, fully vibration leaves standstill of short duration centrifugal after 1 minute after 1 minute, abandons supernatant; 5. 4 steps 2 time are repeated again; 6. 50% glycerine adding 500 μ l in precipitation aseptic suspends.Before via Particle Bombardment Transformation, golden liquid to be put in ultrasonic washer supersound process 3 minutes, then embedding is prepared according to following system: 10 μ l gold liquid, 1 μ g plasmid solution, 10 μ l2.5MCaCl2 solution, 4 μ l1M spermidine solution, mixing, abundant vibration left standstill 1 minute after 3 minutes, of short durationly centrifugally removed supernatant; Add 140 μ l70% ethanolic solns (HPLC level dehydrated alcohol ultrapure water is prepared) in precipitation, of short durationly after mixing centrifugally remove supernatant; Add 140 μ l dehydrated alcohols (HPLC level), mixing in precipitation, of short durationly centrifugally remove supernatant; Add 10 μ l dehydrated alcohols in precipitation, pat tube wall and hanged precipitation.On Bechtop, carefully golden liquid is applied to particle gun dedicated carrier film central authorities, after standing and drying, carries out via Particle Bombardment Transformation.Step of converting carries out according to Bio-Rad via Particle Bombardment Transformation system specification, and use bursting membrane is 1100Psi, conversion chamber vacuum tightness 25, and " Hg, bursting disk is apart from the dull and stereotyped 7cm of target.After flat board through transforming cultivating 6h at 28 DEG C, using aseptic deionized water to wash hypothallus, being resuspended to 100 μ l after 4000rpm is centrifugal, getting 50 μ l and be applied to containing on the antibiotic YPD flat board of 50 μ g/mlzeocin, cultivate 3 days with 28 DEG C of incubators.Gained resistant clones is transferred to rhodamine B flat board, dull and stereotyped formula is: add in YPD culture medium prescription 12% sweet oil emulsion (2% polyvinyl alcohol water solution mixes with the sweet oil of its 1/3 volume while hot, high speed dispersor was in 10000rpm emulsification 3 minutes, interval is after 5 minutes, reemulsification 3 minutes), add rhodamine B before being down flat plate to 10 μ g/ml, add zeocin microbiotic to 50 μ g/ml).The flat board of switching is put 28 DEG C of incubators and is cultivated 48h, and gel rubber tapping instrument carries out observing, taking pictures, and photo as shown in Figure 6.

Because of on recombinant vectors only containing tubulin 3 ' non-coding region as Homologous integration site, as long as namely the bacterium colony therefore still having a zeocin resistance after secondary switching is in theory the transformation bacterial strain having carried out genetic recombination.The present invention selects 4,6,38 and No. 39 four bacterium colonies to carry out bacterium colony PCR.The primer and the position on genome thereof are as shown in Figure 7.The resistant clones that after via Particle Bombardment Transformation, institute's spread plate obtains is called first-generation resistant clones, and its inside is not got rid of still to exist and is driven in cell and the plasmid of complete existence, and therefore PCR qualification must use the primer pair striding across and integrate region.The object of the present invention's inspection is the s-generation resistant clones of transferring, and the recombinant vectors of bronze parcel is not present in theory, but for rigorous, first the present invention still uses the primer pair across integration site to test.Because homologous recombination generating portion may lack near homology region, therefore qualification primer has carried out many round designs, ensures that the primer that there is different annealing temperature exists simultaneously, reduces false-negative appearance.

On position checking is carried out with PCR method:

On position downstream direction bacterium colony PCR verifies three that use in primer 1 series:

(1)-cagtcacgacgttgtaaaacgacggccagt(SEQIDNO:22)；

(1’)-cgattaagttgggtaacgccag(SEQIDNO:23)；

(1”)-gaaagggggatgtgctgcaaggcga(SEQIDNO:24)，

Form 3 with primer 2-atgaacagacgacatgcccccaag (SEQIDNO:25) respectively to combine, carry out bacterium colony PCR checking.

Updrift side is with three in primer 3 series:

(3)-gcccgtgaggatcttgccgctctc(SEQIDNO:26)；

(3’)-gtatggaggagggtgagttctccgag(SEQIDNO:27)；

(3”)-gcactggtacgtcggtgagggtatggag(SEQIDNO:28)；

Form 3 respectively to combine increase with primer 7-gcccttagattagattgctatgctttct (SEQIDNO:29).System used is 50u, and adopt the LA-taqDNA polysaccharase of Takara company GCset to verify, concrete PCR component is as follows: water 14.5 μ l, 2 × GCI damping fluid 25 μ l, dNTPs6 μ l, each 2 μ l of primer, LA-Tag0.5 μ l.Choose into about 1mm in the reaction solution prepared ³thalline, put into PCR instrument after mixing and increase.Pcr amplification program is: 98 DEG C of sex change 5 minutes; The touchdown PCRs of 10 circulations, 95 DEG C 30 seconds, 63 DEG C 30 seconds and often circulation reductions by 1 DEG C, 72 DEG C 90 seconds; 30 circulation PCR, 95 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 90 seconds; 72 DEG C 10 minutes.PCR primer is verified through 1% agarose gel electrophoresis, and Fig. 8 is 39# bacterium bacterium colony PCR result electrophorogram.Upstream and downstream all obtain PCR band in expection size position.3, differ about 10 bases 3 ', 3 " successively, therefore cannot distinguish size on gel.Equally, 1,1 ', 1 " differ about 10 bases successively between, difference can not be embodied on glue.

Inoculation 39# bacterium cultivates 48h in 50mlYPD liquid nutrient medium, collected by centrifugation thalline is also with after deionized water wash 2 times, then grind thalline in liquid nitrogen utilizes Takara company MiniBESTUniversalGenomicDNA to extract test kit extraction genomic dna, and with this DNA for template, 3 serial primers and primer f (TTBa)-aatctagacgtgtcgctgctccagacaag (SEQIDNO:30) and 1 serial primer and primer f carry out PCR checking.PCR system is 50 μ l, consists of water 13.5 μ l, 2 × GCI damping fluid 25 μ l, dNTPs6 μ l, each 2 μ l of primer, LA-Tag0.5 μ l, template 1 μ l.Pcr amplification program is: 98 DEG C of sex change 5 minutes; The hot asymmetric PCR of 12 circulations: 95 DEG C of 30 seconds, 63 DEG C 30,72 DEG C of 1min, 95 DEG C of 30 seconds, 63 DEG C 30,72 DEG C of 1min, 95 DEG C of 30 seconds, 44 DEG C 30,72 DEG C of 1min; 72 DEG C 10 minutes.PCR primer is checked through 1% agarose gel electrophoresis, the results are shown in Figure shown in 9.

As ise apparent from FIG. 9,3 serial primers and f and 1 serial primer and f can obtain expecting the band of size.Constructed carrier, in position, tubulin terminator, is inserted into and splits in kettle algae genome.

Inoculation restructuring 38#, 39# two strain and wild-type schizochytrium limacinum to (containing 50 μ g/mlzeocin microbiotic in the triangular flask of recombinant bacterium place) in YPD nutrient solution, after 72h cultivated by 28 DEG C of 200rpm shaking tables, weigh after collected by centrifugation thalline, deionized water wash, liquid nitrogen flash freezer, then proceeds to mortar and grinds under liquid nitrogen.Add the extracting solution of wet thallus weight two volumes (as 1g wet thallus uses 2ml extracting solution), mix with bacterium powder, when waiting liquid to start to melt, grinding is until bacterium liquid becomes limpid.Extraction buffer contains: Tris-HCl damping fluid, 50mMpH8.0; TritonX-1000.1%; NaCl150mM.Then adding appropriate PMSF to final concentration is 1mM.Centrifugal 15 minutes of cell pyrolysis liquid 13000rpm at 4 DEG C, collects cracking supernatant.After 0.22uM sterilised membrane filter filters, obtain crude enzyme liquid, 4 DEG C save backup.Same inoculation 38#, 39#, wild strain three strain bacterium, cultivate 72h, collected by centrifugation thalline in YPD nutrient solution, also transfers to completely in glass culture dish after deionized water wash with dehydrated alcohol suspension cell, dries to constant weight for 60 DEG C, calculate dry mycelium weight.The biomass of 38#, 39# two kinds of recombinant bacteriums is respectively 96.5% and 97.1% of wild type strain.Using tubulin promoter sequence disclosed in CN02812059 as the promotor of RML gene and unique Homologous integration site, cultivate in the same way, the biomass that kettle algae is split in gained restructuring is the 78.2%-86.5% of wild type strain.

38#, 39# and each 40 μ l of wild type strain cell fermentation supernatant (CS), cracking supernatant (HS) and lysate (CH) are clicked and entered rhodamine flat board, the dull and stereotyped component of rhodamine is: 1.8% agar, (2% polyvinyl alcohol water solution mixes with the sweet oil of 1/3 volume 12% emulsification sweet oil while hot, high speed dispersor was in 10000rpm emulsification 3 minutes, interval is after 5 minutes, reemulsification 3 minutes), 10 μ g/ml rhodamine Bs.Flat board is put in 37 DEG C of incubators to place and spend the night, 406nm ultra violet lamp, to take pictures, the results are shown in shown in Figure 10.All there is lipase activity in wild-type thalline, 38# and 39# cell lysate, but be showed no lipase activity in three's substratum supernatant, in cell lysate supernatant, lipase activity 39#>38#> wild-type.

The detection restructuring of use p-NP palmitinic acid (PNPP) method and wild-type split the lipase activity in kettle frustule crude enzyme liquid, and detection system is: 40 μ l1.5mMPNPP aqueous isopropanols, 360 μ l50mMTris-HClpH8.0 damping fluids, 100 μ l crude enzyme liquids; Reaction conditions is 40 DEG C of water-baths 15 minutes.Add 1.5ml dehydrated alcohol termination reaction after having reacted, 12000rpm detects absorbance value after centrifugal 2 minutes with under 405nm.Blank is after temperature bath same time, first adds dehydrated alcohol and adds crude enzyme liquid again.At lipase activity is defined as 40 DEG C, it is a unit that per minute discharges enzyme needed for 1umol p-NP from p-NP cetylate.Enzyme activity assay result is as follows: wild type strain obtains crude enzyme liquid lipase activity and is: 0.010 ± 0.003U/ml; Restructuring schizochytrium limacinum crude enzyme liquid lipase activity is 0.072 ± 0.02U/ml.

Lipase C-terminal expressed by recombinant bacterium, with HIS label, can utilize Ni gel (QiagenGmbh company NI-NTAagrose) to carry out adsorption and purification.Millipore company Amicon Μ ltracel10kDa ultra-filtration membrane is used 5ml crude enzyme liquid to be concentrated to 1.5ml and to replace Extraction buffer for HIS binding buffer liquid (10mMTris-HCl, 100mMNaH ₂pO ₄, 8M urea, pH8.0), then add 50 μ l50%Ni pearls, 37 DEG C of vibration 2h.Centrifugally remove supernatant, use lavation buffer solution (10mMTris-HCl, 100mMNaH ₂pO ₄, 8M urea, pH6.3) and wash NI gel 10 times, each consumption 1ml; Finally use elution buffer to wash the recombinant protein of lower absorption, buffer formulation is 10mMTris-HCl, 100mMNaH ₂pO ₄, 8M urea, 200mM imidazoles, pH4.5, wash-out 3 is taken turns, and often takes turns use 500 μ l elutriant.

Enzyme activity assay and protein electrophoresis result (Figure 11) show, RML gene is expressed in schizochytrium limacinum.

Embodiment four

Use microtubule protein gene terminator as Homologous integration site, the gene (GenBank:Y18553.1) being derived from Mortierella alpina (Mortierella) is integrated into and splits in kettle algae.Figure 12 is carrier structure schematic diagram.

Use primer TTE5 ': gcgagcacaactgcttggcttcagct (SEQIDNO:31) and primer tubTT3 ' Ba:aatctagaaccttgacaccgcaaagctttaca (SEQIDNO:32), in amplification tubulin transcription termination region (SEQIDNO:3 sequence), 1-562bp is as integral component.PCR uses TF-18T plasmid constructed by embodiment three to be template, PCR system to be PCR system be water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 52 DEG C of 40s, 72 DEG C of 30s; 72 DEG C of 10min.PCR primer is separated through 1% agarose gel electrophoresis, cuts the band of about 500bp, uses Omega company gel to reclaim test kit and reclaims.The nucleic acid reclaimed is connected with pMD18-T carrier, and connect and use FermentasT4DNA ligase enzyme, linked system is: water 16.2ul, pMD18-T0.5ul, T4DNA ligase enzyme damping fluid 2ul, T4DNA ligase enzyme 0.3ul, PCR primer 1ul; Condition of contact is 16 DEG C of water-bath 2h.Connect product and 200ulCaCl ₂the standby bacillus coli DH 5 alpha of legal system softly mixes, ice bath 42 DEG C of water-bath heat shocks 90 seconds after 30 minutes, then ice bath is proceeded in ice immediately 3 minutes, add 800ulLB nutrient solution, put 37 DEG C of shaking table 200rpm shaking culture 1h, be coated on the LB flat board containing 50ug/ml penbritin, 37 DEG C of incubator overnight incubation.Gained Ampicillin resistant colonies passes through TTE5 ' and M13-48:gagcggataacaatttcacacagg (SEQIDNO:33) primer, Takara company rTaqDNA polysaccharase is utilized to carry out bacterium colony PCR screening, specific practice is: choose bacterium colony culture and be about in 1mm3 to 10ul sterilized water, mixing, adding 2ul concentration is respectively the dNTPs of 2.5mM, 2.5ul10 × PCR damping fluid, each 1ul, the 0.4ulrTaqDNA polysaccharase of primer; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 33 circulations, 52 DEG C of 50s, 72 DEG C of 1min; 72 DEG C of 10min.PCR primer is separated through 1% agarose gel electrophoresis, obtains the bacterium colony of about 700bp band for the successful bacterium colony of clone.Inoculate this bacterium colony to the 5mlLB nutrient solution containing 50ug/ml penbritin, 37 DEG C of shaking table 200rpm overnight incubation, use Axygen company mini-scale plasmid to extract test kit extraction plasmid for subsequent use, called after TT '-18T.

Use BamHI digestion with restriction enzyme TT '-18T plasmid, the enzyme system of cutting is: water 23ul, Takara company K damping fluid 5ul, plasmid 20ul, restriction endonuclease 2ul; Enzyme tangent condition is 30 DEG C of water-bath 2h.After digestion products 1% agarose gel electrophoresis is separated, uses Omega company gel to reclaim test kit and reclaim plasmid enzyme list section section.

Use primer 35SU:aaaAGATCTaatggcgaatgctagagcagctt (SEQIDNO:34), 35SD:aaccatggtcaagagtcccccgtgttctctcc (SEQIDNO:35), with pCAMBIA1301 plasmid for template, amplification 35S promoter fragment.PCR system is PCR system to be PCR system be water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 52 DEG C of 40s, 72 DEG C of 30s; 72 DEG C of 10min.After PCR primer uses Omega company CyclePure kits to reclaim, use NEB company NcoI restriction enzyme list to cut, system is: water 23 μ l; 3# damping fluid 5 μ l; PCR primer 20 μ l; Enzyme 2 μ l.37 DEG C of enzymes cut 2h.Then use Omega company CyclePure test kit to reclaim purifying, obtain the fragment that 35S promoter enzyme is cut.

Use primer Mu:aaaccatggATGGCAACTCCTCTTCCCCCCTCCTTT (SEQIDNO:36), Md:aaatctagaCTATTCGGCCTTGACGTGGTCAGT (SEQIDNO:37), with Mortierella alpina RNA reverse transcription thing for template, increase gene for subsequent use.PCR system is water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 50 DEG C of 40s, 72 DEG C of 90s; 72 DEG C of 10min.PCR primer is through 1% agarose electrophoresis, and the band of about 1.5kb size is reclaimed in cutting, uses Omega company GelExtract test kit to reclaim, and regenerant uses NcoI restriction enzyme list to cut, and system is: water 23 μ l; 3# damping fluid 5 μ l; PCR primer 20 μ l; Enzyme 2 μ l.37 DEG C of enzymes cut 2h.Then use Omega company CyclePure test kit to reclaim purifying, obtain Mortierella alpina gene fragment enzyme and cut thing.

The fragment of cut 35S promoter enzyme and Mortierella alpina gene fragment enzyme are cut thing and are coupled together, and use FermentasT4DNA ligase enzyme, linked system is: water 13.7ul, endonuclease bamhi each 2ul, T4DNA ligase enzyme damping fluid 2ul, T4DNA ligase enzyme 0.3ul; Condition of contact is 16 DEG C of water-bath 2h.Connect product and get the template of 0.5 μ l as PCR, the fragment after using 35SU and MD two primer amplification to connect, PCR system is water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 50 DEG C of 40s, 72 DEG C of 2min; 72 DEG C of 10min.PCR primer is through 1% agarose electrophoresis, and the band of about 2kb size is reclaimed in cutting, uses Omega company GelExtract test kit to reclaim, and regenerant uses XbaI, BglII restriction enzyme pair to cut, and system is: water 23 μ l; 2# damping fluid 5 μ l; PCR primer 20 μ l; Enzyme 2 μ l.37 DEG C of enzymes cut 2h.Then use Omega company CyclePure test kit to reclaim purifying, obtain 35S-high mountain endonuclease bamhi.

Be connected same with above-mentioned 35S-high mountain endonuclease bamhi through BglII, XbaI pair of pGAPZaA carrier reclaimed after cutting, linked system is the same.Connector transforms Dh5 α competent cell, and method for transformation, cultural method, screening method are with embodiment three.Choose the bacterium colony upgrading grain of the PCR positive, obtain GAP35SM plasmid.

BamHI digestion with restriction enzyme GAP35SM carrier, the enzyme system of cutting is: water 23ul, Takara company K damping fluid 5ul, plasmid 20ul, restriction endonuclease 2ul; Enzyme tangent condition is 37 DEG C of water-bath 2h.Enzyme after purified is cut thing and is used FermentasT4DNA ligase enzyme to cut rear regenerant with TT '-18TBamHI enzyme to be connected, and linked system is: water 13.7ul, and enzyme cuts thing each 2ul, T4DNA ligase enzyme damping fluid 2, T4DNA ligase enzyme 0.3ul; Condition of contact is 16 DEG C of water-bath 2h.Connect product conversion DH5 α competent cell, and screen through cultivation, screening, bacterium colony PCR equally.Choose positive bacterium colony and extract plasmid, obtain recombinant plasmid TTM.

Use primer 8U:aaagatctatgcgcatgaagaacctcatggac (SEQIDNO:38) and primer 8D:aaagatctgcatgacggccttgtcgctcg (SEQIDNO:39), to split kettle algae genomic dna for template, 5 ' the end 710bp fragment that one, kettle algae is predicted as phospholipase D coding region is split in amplification, and makes fragment two ends with BglII restriction enzyme site.PCR system and condition: PCR system is water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 50 DEG C of 40s, 72 DEG C of 90s; 72 DEG C of 10min.。PCR primer is reclaimed purifying by method, step as described above, and cuts through BglII restriction enzyme digestion list, reclaim purifying.Gained fragment is for replacing the tublin non-coding region parts in GAP35SM plasmid.Specific practice uses BamHI digestion with restriction enzyme GAP35SM, and enzyme cuts system: water 23ul, Takara company K damping fluid 5ul, plasmid 20ul, restriction endonuclease 2ul; Enzyme tangent condition is 37 DEG C of water-bath 2h.Be separated through 1% agarose gel electrophoresis, after test kit recovery purifying received by glue, be connected with PLD8 fragment, linked system is water 13.7ul, and enzyme cuts thing each 2ul, T4DNA ligase enzyme damping fluid 2ul, T4DNA ligase enzyme 0.3ul; Condition of contact is 16 DEG C of water-bath 2h.Connect product conversion DH5 α competent cell, and screen through cultivation, screening, bacterium colony PCR equally.Choose positive bacterium colony and extract plasmid, obtain recombinant plasmid, called after 8M.Use this plasmid of Bombardment-Mediated Transformation to splitting in kettle algae, method, step, with embodiment three, obtain TTM and 8M restructuring and split kettle algae.Inoculation TTM, 8M and wildly split kettle algae, cultivates same time, metering biomass in triangular flask.The average biomass of TTM recombinant bacterium is the average biomass of 84.5%, 8M recombinant bacterium of wild mushroom is 53.2% of wild mushroom.Dry restructuring and wild type strain thalline after in mortar grinds, after adding 8ml75% hydrochloric acid suspension thalline, in 70 DEG C of water-baths 200rpm vibration heating 40min.After cool to room temperature, add 20ml normal hexane and the 30min lixiviate grease that vibrates.Dry after removing normal hexane, with 3ml normal hexane molten grease, add 4ml0.5M potassium hydroxide methanol solution, 60 DEG C of insulation 40min esterification.After the centrifugal 3min of 4000rpm, get upper strata normal hexane layer and carry out gas chromatographic analysis.Chromatographic column is VARIANCP6173,50m*250 μm of * 0.2 μ L.Heating schedule is: 80 DEG C keep 2min; 10 DEG C/min rises to 120 DEG C, keeps 0min; 5 DEG C/min rises to 180 DEG C, keeps 2min; 2 DEG C/min rises to 206 DEG C, keeps 0min; 25 DEG C/min rises to 230 DEG C, keeps 5min.Injector temperature: 250 DEG C, detector temperature: 280 DEG C, sample size: 1 μ L, splitting ratio 20:1.Figure 13 is that wild-type splits kettle algae lipid FAC result figure, Figure 14 is that kettle algae lipid FAC result is split in TTM restructuring, Figure 15 is the result that kettle algae lipid FAC is split in 8M restructuring.The iipidomic Chengdu of 2 recombinant bacteriums there occurs change, shows that the gene integration of Mortierella alpina enters and splits kettle algae genome and played effect.But the growth of this gene counterincision kettle algae has impact, but use tubulin non-coding region as integration site, the affected degree of biomass is low, obvious advantage of the present invention.

Embodiment five

The present embodiment using the sequence of microtubule protein gene protein coding portion as Homologous integration site.Use primer TubU:aactgcagatgcgtgaggtcatctccatcc (SEQIDNO:40) and TubD:aagatatcgacgttgagagcaccatcgaagc (SEQIDNO:41).Takara company genome is used to extract test kit (numbering 9765), split kettle phycomycete body from wild-type and extract genomic dna, split in kettle algae genome solution the gene fragment of the 756bp that the microtubule protein gene coding region initiator codon that increases starts with above-mentioned TubU and TubD primer, its end is respectively with PstI and EcoRV restriction enzyme site.PCR primer carries out PstI, EcoRV double digestion according to NEB company working instructions after reclaiming purifying, and 37 DEG C of enzymes reclaim after cutting 2h, purifying, obtain tubulin amalgamation and expression fragment.Use primer zeoU:aacgatatcgccaagttgaccagtgcc (SEQIDNO:42) and primer zeoD:aacatatgtcagtcctgctcctcggccacgaa (SEQIDNO:43), with pGAPZaA plasmid for template, amplification zeocin resistance gene fragment.PCR primer carries out EcoRV, NdeI double digestion according to NEB company working instructions after reclaiming purifying, after 37 DEG C of enzymes cut 2h, and recovery, purifying.The digestion products of tubulin amalgamation and expression fragment and zeocin resistance gene fragment is coupled together, linked system is as embodiment four, connection product is used to be template, primer tubU, zeoD increase, PCR system is water 18.1 μ l, dNTPs (each 2.5mM) 2 μ l, 10 × PCR damping fluid 2.5 μ l, the each 1 μ l of 20uM primer, 0.4 μ lEx-TaqDNA polysaccharase; PCR reaction conditions is: 95 DEG C 5 minutes; 95 DEG C of 50s of 30 circulations, 50 DEG C of 40s, 72 DEG C of 90s; 72 DEG C of 10min.Obtain tubzeo fragment.Use NEB company PstI, NdeI restriction enzymes double zyme cutting tubzeo fragment, make end NdeI, PstI restriction enzyme site become sticky end.Use primer AOXU:aacatatggttttagccttagacatgactg (SEQIDNO:44) and AOXD:aaggatcctctagagcacaaacgaaggt (SEQIDNO:45), amplification AOX transcription termination region, with pGAPZaA plasmid for template, PCR system is as follows: water 36.5 μ l, 10 × Ex-taq damping fluid 5 μ l, dNTPs4 μ l, each 2 μ l of primer, Ex-Tag0.5 μ l.Pcr amplification program is: 98 DEG C of sex change 5 minutes; 30 circulation PCR, 95 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 90 seconds; 72 DEG C 10 minutes.After PCR primer is purified, use NEB company NdeI and BamHI digestion with restriction enzyme and purifying reclaims.The fragment reclaimed is connected with tubzeo fragment, and connector tubU and AOXD primer increase, and obtain tubzeoaox fragment, and this fragment ends is respectively with PstI and BamHI restriction enzyme site.

Use HyU:aaggatccatgaaaaagcctgaactcaccgcg (SEQIDNO:46) and HyD:aactcgagttatttctttgccctcggacgagtgctg (SEQIDNO:47) primer, with the pCAMBIA1301 plasmid purchased from Cambia company for template, amplification hygromycin gene fragment, PCR system and condition increase with foregoing embodiments five description of tubulin fragment.PCR primer reclaims after kits through glue, uses that BamHI enzyme is cut, after purifying, couple together with tubzeoaox fragment, linked system and condition are as shown in above-described embodiment.To connect product as template, use tubU and HyD primer amplification, obtain tubzeoaoxhy fragment, these fragment two ends are with PstI and XhoI restriction enzyme site.This fragment and pCAMBIA1301 plasmid are carried out respectively PstI, XhoI double digestion and after separately purifying reclaims, connection tubzeoaoxhy fragment and pCAMBIA1301 remove the residue skeleton part after hygromycin gene, linked system is the same, and condition of contact is 16 DEG C of 48h.Connect product conversion DH5 α, block the screening of that resistant panel, tubU, HyD two bacterium colony PCR selected clone of primer.Finally obtain tubzeo1301 plasmid, this plasmid construct figure is shown in Figure 16, containing splitting the hygromycin gene fragment and zeocin resistance fragments that work in kettle algae.But zeocin resistant gene is without promotor, must work as this carrier when tubulin coding region site-directed integration, zeocin just has activity; Not containing promotor before hygromycin gene, external promotor just activity must be had.Use BamHI digestion with restriction enzyme tubzeo1301 plasmid, using Takara company CIAP alkaline phosphatase according to the method dephosphorylation of product description it linearizing, avoiding carrier from connecting.

Kettle algae genome DHA is split in extraction, and uses Takara company Sau3AI digestion with restriction enzyme, and the enzyme system of cutting is water 59 μ l; Takara company H damping fluid 10 μ l; Genome solution 30 μ l; Enzyme 1 μ l.Enzyme tangent condition is 37 DEG C of water-bath 20min.Be separated by 0.5% agarose gel electrophoresis, cut out the blob of viscose within the scope of 200bp-1kb, glue reclaims kits and reclaims, and be connected with linearizing tubzeo1301 carrier, linked system FermentasT4DNA ligase enzyme, consist of damping fluid 2 μ l, carrier 4 μ l, genome enzyme cuts thing 14 μ l.Condition of contact is 20 DEG C of 20h.Connector transforms DH5 α thalline, is applied on the LB flat board of that resistance of card, after incubated overnight, is all washed down with physiological saline by all bacterium colonies, collected by centrifugation thalline, upgrading grain, obtains a little library.This library is transformed in Agrobacterium EHA105 bacterial strain by heat shock method, is coated in that resistant panel of card.Whole thalline is washed down, diluting 1000 times is inoculated in liquid nutrient medium, and the method then splitting kettle algae according to Agrobacterium-mediated Transformation is transformed into be split in kettle algae, and cultivates under 50 μ g/mlzeocin, 200 μ g/ml Totomycin double selection pressure, cultivate after 4 days for 28 DEG C, obtain bacterium colony of recombinating.Because the conversion of Agrobacterium is generally single copy, therefore in these dual anti-positive thalline, only be imported into a recombinant vectors, in this carrier site-directed integration to genome, tubulin coding region 5 ' is held in 756bp, only in this way, zeocin resistant gene just can be expressed, and bacterial strain just has zeocin resistance; The random endonuclease bamhi of the genome be connected into before hygromycin gene in recombinant vectors must have promoter activity, the expression of the initial hygromycin gene of ability, thus makes recombinant bacterium have hygromycin resistance.

Random choose 2 resistant clones, be inoculated in liquid nutrient medium and cultivate 60h, collecting thalline and extracting genomic dna is template, hyD, AOXU are that primer increases, the band that PCR obtains is delivered the raw work in Shanghai and is checked order, obtain two fragment gene fragment 4# and 5#, these two sections of sequences are positioned at the upstream position (see Figure 17) of certain two gene start codon.

Claims (12)

1. the nucleic acid molecule be separated, is selected from:

(1) fragment of SEQIDNO:1 or 3, or SEQIDNO:1 or 3; With

(2) nucleotide sequence of the nucleotide sequence complementary and described in (1).

2. the nucleic acid molecule be separated as claimed in claim 1, it is characterized in that, described fragment is to the youthful and the elderly's 200 Nucleotide, preferably, described fragment is the 1-756 position Nucleotide of SEQIDNO:1, or the 1-797 position Nucleotide of SEQIDNO:3, or the 1-562 position Nucleotide of SEQIDNO:3.

3. a recombinant nucleic acid molecules, comprises nucleic acid molecule and the foreign gene of the separation described in claim 1 or 2.

4. recombinant nucleic acid molecules as claimed in claim 3, it is characterized in that, described recombinant nucleic acid molecules is targeting vector, for by described foreign gene homologous recombination in host genome, or make goal gene in host lose function.

5. recombinant nucleic acid molecules as claimed in claim 3, it is characterized in that, described recombinant nucleic acid molecules is capturing carrier, and for screening in host, obtaining and/or identify interested testing gene sequence, described testing gene sequence preference comprises promotor, secreting signal peptide and terminator.

6. recombinant nucleic acid molecules as claimed in claim 5, it is characterized in that, described capturing carrier contains the first reporter gene and the second reporter gene, wherein, the microtubule protein gene amalgamation and expression of the constitutive expression of the first reporter gene and host, the second reporter gene is the reporter gene of interested testing gene sequence;

Wherein, this interested sequence to be measured is inserted, in order to verify whether this sequence has promoter function at the second report upstream region of gene; Or insert this interested sequence to be measured, in order to verify whether this sequence has Transcription Termination function at the second report downstream of gene; Or introduce the promotor that can work in host in the upstream of the second reporter gene, and between this promotor and this second reporter gene, insert interested sequence to be measured, in order to verify whether this sequence has secreting signal peptide function;

Preferably, described amalgamation and expression is that the gene coding region 5 ' of constitutive expression holds peptide section and ble gene second amino acid to start amalgamation and expression;

Preferably, the microtubule protein gene of described constitutive expression is as shown in SEQIDNO:1;

Preferably, described second reporter gene is have to characterize active gene, described in have can characterize active gene preferably can chemistry manifest gene, can chemiluminescent gene and/or resistant gene.

7. a host cell, is characterized in that, described host cell contains the recombinant nucleic acid molecules according to any one of claim 3-6.

8. host cell as claimed in claim 7, it is characterized in that, described host cell from schizochytrium limacinum, and expresses rhizomucor miehei lipase.

9. the application in homologous recombination of the recombinant nucleic acid molecules according to any one of claim 3-6 or the host cell according to any one of claim 7-8.

10. a method for acquisition or analysis functionality nucleic acid, it is characterized in that, described method comprises:

(1) with the recombinant nucleic acid molecules transformed host cell described in claim 5 or 6; With

(2) according to the expression of reporter gene, the function of described nucleic acid fragment is determined.

The method of 11. 1 kinds of homologous recombination, is characterized in that, described method uses alpha-tubulin gene or its fragment or alpha-tubulin 3 ' to hold non-coding region gene or its fragment as the fragment of Homologous integration.

12. 1 kinds for homologous recombination or the product for analyzing gene function, it is characterized in that, described product comprises the recombinant nucleic acid molecules described in claim 5 or 6, or comprises alpha-tubulin gene or its fragment or alpha-tubulin 3 ' holds non-coding region gene or its fragment; Preferably, described product is test kit.