CN115975823B

CN115975823B - Schizochytrium limacinum gene engineering strain with phospholipase D gene knocked out, construction method and application thereof

Info

Publication number: CN115975823B
Application number: CN202210986944.5A
Authority: CN
Inventors: 凌雪萍; 李科燕; 卢英华; 崔潇文; 陈翠雪
Original assignee: Xiamen University
Current assignee: Xiamen University
Priority date: 2022-08-17
Filing date: 2022-08-17
Publication date: 2024-07-30
Anticipated expiration: 2042-08-17
Also published as: CN115975823A

Abstract

The invention discloses a schizochytrium limacinum gene engineering strain for knocking out a phospholipase D gene, a construction method and application thereof. The invention adopts schizochytrium Schizochytrium limacinum SR as an original strain, constructs a knockout vector in escherichia coli by a genetic engineering means, takes the upstream and downstream sequences of PLD genes as homology arms, replaces PLD genes with bleomycin genes and screens resistance genes to obtain a genetic engineering strain with high DHA yield, and provides a new idea for genetic engineering regulation of the high DHA yield of the schizochytrium.

Description

Schizochytrium limacinum gene engineering strain with phospholipase D gene knocked out, construction method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a schizochytrium limacinum gene engineering strain for knocking out a phospholipase D gene, and a construction method and application thereof.

Background

Schizochytrium (Schizochytrium) is a representative strain for industrial production of polyunsaturated fatty acids (PUFAs) due to its high growth rate, high oil content and high DHA content. Scientists at home and abroad have conducted extensive studies on the synthesis mechanism of PUFAs in schizochytrium, and found that the pathways of schizochytrium PUFAs synthesis include the Fatty Acid Synthase (FAS) pathway and the polyketide synthase (PKS) pathway, with schizochytrium DHA synthesis thought to be primarily involved in the PKS pathway. Recent studies have found that the production of DHA in schizochytrium is dependent not only on the process of DHA synthesis, but also on the assembled form of DHA that migrates, accumulates and stores after synthesis. The DHA in schizochytrium is mainly stored in triglyceride form, and also exists in phospholipid and sterol ester form, and the mutual conversion of glyceride, phospholipid and sterol ester is accompanied by the migration of fatty acid, and the process is closely related to phospholipid metabolism. Therefore, optimizing the phospholipid metabolic process of schizochytrium is of great significance for schizochytrium DHA synthesis.

Phospholipase D specifically hydrolyzes the phosphodiester bonds in phospholipids, mainly catalyzing two types of reactions: (1) hydrolysis reaction; (2) transphosphatidylation reaction. Phospholipase D is able to modulate TAG and phospholipid partitioning by hydrolysis and is also able to convert between different types of phospholipids by transphosphatidylation. Regulating the expression of phospholipase D can affect the phospholipid metabolism of schizochytrium, and can further affect the synthesis of grease and DHA of schizochytrium. However, there is no report to date that the regulation of phospholipase D in schizochytrium affects the synthesis of lipids and the storage of lipids in schizochytrium.

Disclosure of Invention

The invention aims to solve the defects of the prior art to a certain extent, and provides a schizochytrium limacinum gene engineering strain for knocking out a phospholipase D gene, and a construction method and application thereof. According to the invention, schizochytrium limacinum SR is taken as an original strain, and the schizochytrium limacinum lipid storage form is regulated and controlled by knocking out PLD genes, so that the synthesis of DHA is enhanced.

One of the technical schemes adopted for solving the technical problems is as follows:

A schizochytrium limacinum gene engineering strain for knocking out a phospholipase D (PLD) gene is constructed by taking Schizochytrium limacinum SR as an original strain, and the PLD gene in the genome of the gene engineering strain is knocked out, so that the PLD expression level in the gene engineering strain is reduced.

The second technical scheme adopted by the invention for solving the technical problems is as follows:

A construction method of schizochytrium limacinum genetic engineering strain for knocking out PLD gene comprises the following steps:

(1) Cloning an upstream and downstream homologous arm of PLD gene in genome of a wild strain Schizochytrium limacinum SR, inserting the homologous arm into a homologous recombination region of a pBlue-zeo plasmid, and constructing a PLD gene knockout vector pBlue-zeo-PLD taking bleomycin as resistance;

(2) And linearizing the homologous recombination region of the PLD gene knockout vector pBlue-zeo-PLD, and then electrically transforming and introducing the same into Schizochytrium limacinum SR competent cells to obtain the schizochytrium limacinum gene engineering strain for knocking out the phospholipase D gene PLD.

Further, in the step (1), the construction method of PLD gene knockout vector pBlue-zeo-PLD comprises: designing primers shown as SEQ ID No. 3-SE 1 ID No.6 according to sequence information of PLD genes of schizochytrium Schizochytrium limacinum SR, and obtaining an upstream homologous arm of the PLD genes and a downstream homologous arm of the PLD genes through PCR amplification; and (3) sequentially carrying out enzyme digestion and connection on the obtained PLD gene upstream homology arm and PLD gene downstream homology arm and a plasmid pBlue-zeo, and then converting the obtained plasmid pBlue-zeo into E.coli DH5 alpha competent cells to obtain the knockout vector pBlue-zeo-PLD.

Further, in the step (2), the construction method of the schizochytrium limacinum genetic engineering strain with the phospholipase D gene PLD knocked out comprises the following steps: extracting pBlue-zeo-PLD knockout vector plasmid, conducting double-enzyme tangential digestion, conducting electric shock transformation, introducing into schizochytrium competence for homologous recombination, screening by a bleomycin resistance flat plate to obtain a positive transformant, and verifying by using PCR to finally obtain the schizochytrium gene engineering strain with PLD gene knocked out.

Wherein:

SEQ ID No.1: upstream homology arm sequence of PLD gene in SR21 genome

acgcacgtgatgaattccaagcctagctatgtgaacgttccaatctgggaagactgaccttacaaaccaaatctcacggtgaaatgaagatatattgcatcagaacggtttttatcttggctagaaataagatttgagcgctcggccaatctggaggctctgcgtttgggttgctaagttttcattactgttgtgaggaagggcggagaaagttaaagtggctcacttcaatggttttctcaactccttcatttcaactacaagaatgatgtttaaggcttgtaattgtgaattttgtttattcatctttgagattgagatcaagtatacttcgttctgcaagcctcaatcatggtattctaaaactctattctcaaggctcttacatattttatgagatataaatgcatgaaccctttctgcagaacaacatagggttgcggcagcgtatggtgccaacaaaatagacacaattgtgggagaactcaaggcaatgctcaacagcaactaatataaaataagagtatgtggccattcagacaggcaggggtatagcaacctttgaatgtgctgcgatggataatgagtggaagcagaaca

SEQ ID No.2: downstream homology arm sequence of PLD gene in SR21 genome

ttgcgtctcccatgctagcatagctttgcatgtattcatatctctgattccatatgtttacgatattgaaatcagagaacgttgttaatttcattcataaaaatcgagtatttctgcgaagtctgaagtagccagtgttttgtggtagttgatgtcgttcagcttcccgttactttgactcaacagcaaagagaatatatagtttattgtttgttcgttttcaaacaaaacacacacgcccgaaaaacattaaagaaacatgtagttctagtaacaaatttaaatgtcttacagagcctaatcttatgttatgtaaaggcccaagtatgttgagcccagtaaattgtaaatgaaatatgcctcgcataccacatgccctcttcagcgttttggccttagtcaactcttctattcaaggaagaaaatctaacaaagtaaatctatagctacacaacaaatatagaagttacgctcaatccaaataccttacatgttattcagttgtacacggagcgaatcacgttcttcgatgaactcgtaaggggttccatagtacatcggatcaaggttttcgtttccttcgtaagcctcggcagcagc

The third technical scheme adopted by the invention for solving the technical problems is as follows:

Application of the schizochytrium limacinum gene engineering strain with the phospholipase D gene knocked out in DHA synthesis.

The fourth technical scheme adopted for solving the technical problems is as follows:

The method for producing DHA by using the constructed schizochytrium limacinum genetic engineering strain with the PLD gene knocked out comprises the steps of inoculating the schizochytrium limacinum genetic engineering strain with the PLD gene knocked out into a seed culture medium for activation to obtain a strain for fermentation; inoculating the strain for fermentation into a fermentation culture medium for fermentation culture; and collecting thalli for identification and analysis of grease components to obtain DHA.

Further, the method for obtaining the strain for fermentation is as follows: firstly, inoculating schizochytrium limacinum genetic engineering strain with PLD gene knocked out on a solid seed culture medium, standing and culturing at the temperature of 27-29 ℃ for activation; then picking a single colony with full shape, inoculating the single colony to a liquid seed culture medium, and culturing the single colony at the temperature of 27-29 ℃ and at the speed of 150-250 rpm to obtain first-stage seeds; finally, inoculating the primary seeds to a new liquid seed culture medium in an inoculum size of 2% -10%, and culturing at a temperature of 27-29 ℃ and a speed of 150-250 rpm to obtain secondary seeds serving as strains for fermentation; inoculating the second-level seeds into a fermentation culture medium according to the inoculum size of 2% -10%, culturing at the temperature of 27-29 ℃ and the speed of 150-250 rpm, and sampling in the culturing process to perform oil component identification analysis to obtain DHA.

Further, the solid seed culture medium comprises the following formula: 29 to 31g/L of glucose, 9 to 11g/L of yeast powder, 48 to 52mL of 20X inorganic salt component A, 1.5 to 2.5mL of 500X CaCl ₂, 15 to 20g/L of agar and regulating the pH to 6.4 to 6.6.

Further, the liquid seed culture medium formula is as follows: 29 to 31g/L of glucose, 9 to 11g/L of yeast powder, 48 to 52mL of 20X inorganic salt component A, 1.5 to 2.5mL of 500X CaCl ₂ and pH value of the mixture is adjusted to 6.4 to 6.6.

Further, the fermentation medium formula is as follows: 88-92 g/L glucose, 4-6 g/L corn steep liquor powder, 4-6 g/L tryptone, 48-52 mL of 20X inorganic salt component A, 1.5-2.5 mL of 500X CaCl ₂ and regulating pH to 6.4-6.6.

Wherein the 20 x inorganic salt component a comprises ：NaSO₄ 238～242g/L,MgSO₄ 38～42g/L,(NH₄)₂SO₄19～21g/L,KH₂PO₄ 19～21g/L,K₂SO₄ 12～14g/L,KCl 9～11g/L, solvent deionized water.

Wherein the 500×cacl ₂ comprises: caCl ₂·2H₂ O83-87 g/L or anhydrous CaCl ₂ -67 g/L, and deionized water as solvent.

The equipment, reagents, processes, parameters, etc. according to the present invention are conventional equipment, reagents, processes, parameters, etc. unless otherwise specified, and are not exemplified.

All ranges recited herein are inclusive of all point values within the range.

In the present invention, the "room temperature" is a conventional ambient temperature, and may be 10 to 30 ℃.

Compared with the background technology, the technical proposal has the following advantages:

According to the invention, schizochytrium limacinum SR is taken as a wild strain, a PLD gene knockout carrier pBlue-zeo-PLD taking PLD gene two-end sequences as homology arms and bleomycin as screening marks is constructed in escherichia coli, and a functional fragment is introduced into schizochytrium genome through electric conversion for homologous recombination, so that a schizochytrium engineering strain for knocking out PLD genes is obtained, DHA yield is improved, and a new idea is provided for regulating and controlling schizochytrium high-yield DHA in genetic engineering.

Drawings

FIG. 1 is a schematic diagram of a gene knockout vector pBlue-zeo.

FIG. 2 is a schematic diagram of PLD gene knockout vector pBlue-zeo-PLD.

FIG. 3 is an agarose gel electrophoresis diagram of the identification of the genetically engineered strain. Wherein PC is positive control, NC is negative control, M is marker, PT is knockout strain.

FIG. 4 is a diagram showing analysis of the results of PLD gene RT-qPCR of Schizochytrium limacinum SR wild-type strain and genetically engineered strain.

FIG. 5 is a graph showing DHA production comparison between Schizochytrium limacinum SR wild type strain and genetically engineered strain.

Detailed Description

The invention is further described below with reference to the drawings and examples.

The culture medium adopted by the embodiment of the invention is as follows:

Solid seed medium: 29 to 31g/L of glucose, 9 to 11g/L of yeast powder, 48 to 52mL of 20X inorganic salt component A, 1.5 to 2.5mL of 500X CaCl ₂, 15 to 20g/L of agar and pH of a culture medium is regulated to 6.5.

Liquid seed medium: 29-31 g/L glucose, 9-11 g/L yeast powder, 48-52 mL of 20 Xinorganic salt component A, 1.5-2.5 mL of 500 XCaCl ₂ and regulating the pH of a culture medium to 6.5.

Fermentation medium: 88-92 g/L glucose, 4-6 g/L tryptone, 4-6 g/L corn steep liquor powder, 48-52 mL of 20X inorganic salt component A, 1.5-2.5 mL of 500X CaCl ₂ and pH value regulated to 6.5.

Wherein: the 20 x inorganic salt component A：MgSO₄ 38～42g/L,(NH4)₂SO₄ 19～21g/L,Na₂SO₄ 238～242g/L,KH₂PO₄ 19～21g/L,KCl 9～11g/L,K₂SO₄ 12～14g/L, solvent is deionized water.

500 XCaCl ₂：CaCl₂·2H₂ O83-87 g/L or anhydrous CaCl ₂ -67 g/L, and deionized water as solvent.

The whole period of fermentation culture is 144 hours, and sampling detection is carried out every 24 hours.

TABLE 1 summary of primer sequences employed in the examples of the invention

EXAMPLE 1 PLD construction of the knockout vector pBlue-zeo-PLD

1. PLD Gene upstream and downstream homology arm amplification

According to the sequence information of the schizochytrium PLD gene, designing PLD gene upstream homology arm amplification primers PLD-U (shown as SEQ ID No.3 and SEQ ID No. 4) and PLD gene downstream homology arm amplification primers PLD-D (shown as SEQ ID No.5 and SEQ ID No. 6), inserting enzyme cutting sites XhoI and HindIII before and after the upstream homology arm sequence, inserting enzyme cutting sites BamHI and Xba I before and after the downstream homology arm sequence, using a wild strain genome as a template, and obtaining the PLD gene upstream homology arm and the PLD gene downstream homology arm by using PRIMERSTAR high-fidelity polymerase and the primers in a PCR mode.

The PCR procedure was: 94℃for 5min, (94℃for 1min,60℃for 1min,72℃for 1 min). Times.35 cycles, 72℃for 10min, 4℃for forever.

2. Construction of PLD Gene knockout vector pBlue-zeo-PLD

(1) The knockout vector pBlue-zeo (FIG. 1) and the PLD gene upstream homology arm PCR purified product fragment were double digested with restriction enzymes XhoI and HindIII, digested at 37℃for 2h. The double enzyme digestion system is as follows: 4. Mu.g of DNA template, 5. Mu.L of 10X QuickCut Buffer, 1.5. Mu.L each of the two fast-cutting enzymes, and the system was filled to 50. Mu.L by adding an appropriate amount of pre-chilled sterile water.

(2) The upstream homology arm fragment of PLD gene and the vector pBlue-zeo fragment were ligated by T4 ligase and reacted at 16℃for 12 hours. The connection system is as follows: 10 xT ₄ DNA Ligase Buffer 1μL,T₄ DNA LIGASE. Mu.L, vector fragment 1.5. Mu.L, target gene fragment 6.5. Mu.L.

(3) The ligation product transformed E.coli DH 5. Alpha. Competent cells by the following method:

i. 100. Mu.L of E.coli DH 5. Alpha. Competent cells were thawed on ice for 10min, 10. Mu.L of the pre-chilled ligation product was added, and the mixture was allowed to stand on ice for 30min.

Placing the competent cells containing the ligation product in a water bath at 42 ℃ for 45s and then immediately placing the competent cells on ice for 2-3 min.

Adding 900 mu L of LB culture medium into competent cells containing the ligation product, and shaking at 37 ℃ and 200rpm for 1h.

And iv, taking 150 mu L of bacterial liquid from the cultured liquid culture medium, coating the bacterial liquid on an LB plate containing antibiotics, and culturing at 37 ℃ for 12-16 h.

And (3) selecting a positive transformant, extracting plasmids, repeating the above operation on the pBlue-zeo vector inserted with the homologous arm at the upstream of the PLD gene after successful PCR verification, inserting the homologous arm at the downstream of the PLD gene, and finally obtaining the PLD gene knockout vector pBlue-zeo-PLD after successful PCR verification and sequencing verification (figure 2).

EXAMPLE 2 construction of PLD Gene knockout schizochytrium genetically engineered Strain

Extracting pBlue-zeo-PLD knockout vector plasmid, carrying out tangential restriction on the vector plasmid by using restriction enzymes Apa I and Not I, then conducting electric shock transformation, introducing into schizochytrium competence for homologous recombination, screening by using a bleomycin resistance flat plate to obtain a positive transformant, and verifying by using PCR (figure 3), thus finally obtaining the schizochytrium genetically engineered strain for knocking out PLD genes. The specific process is as follows:

1. Preparation of schizochytrium competent cells:

(1) The activated schizochytrium single colony is picked up to 10mL of liquid seed culture medium, and cultured for 24 hours in a shaking table at 28 ℃ and 200 rpm.

(2) Transfer 2mL of primary seed solution to 50mL of liquid seed medium, and culture in a shaker at 28℃and 200rpm for 6-10 h until OD ₆₀₀ is about 1.5-3.

(3) 10ML of the cultured bacterial liquid is taken into a sterilized 50mL centrifuge tube, and the bacterial liquid is centrifuged at 4,500rpm for 2min at room temperature, and the supernatant is discarded.

(4) 20ML of precooled sterile water was added to wash the cells, and the cells were centrifuged at 4℃and 4,500rpm for 2min, and the supernatant was discarded.

(5) The cells were resuspended in 25mL of DTT-PBS buffer and incubated at 28℃for 30min in a 200rpm shaker. The mixture was then centrifuged at 4,500rpm for 2min at room temperature, and the supernatant was discarded.

(6) 20ML of pre-chilled sterile water was added to resuspend the cells, and the cells were centrifuged at 4℃and 4,500rpm for 2min, and the supernatant was discarded.

(7) 20ML of the sterile pre-chilled sorbitol solution was added to resuspend the cells, and the cells were centrifuged at 4℃and 4,500rpm for 4min, and the supernatant was discarded. And repeating the operation once.

(8) A small amount of sterile precooled sorbitol solution is added into a centrifuge tube, and after being blown and evenly mixed, the mixture is split into sterile centrifuge tubes with the volume of 100 mu L per tube, and the sterile centrifuge tubes with the volume of 1.5mL are placed on ice for standby.

2. Electrical conversion of schizochytrium:

(1) Adding 10-20 mu L of functional gene fragment (about 2-3 mu g) into schizochytrium competent cells, blowing and mixing uniformly, transferring into a electric shock cup, and carrying out ice bath for 30min.

(2) The electric shock cup is wiped and then is arranged at the corresponding position of the electric rotating instrument. The electric shock procedure is as follows: 2KV,6ms, one pulse.

(3) 1ML of precooled liquid seed culture medium (containing 1M sorbitol) is taken into an electric rotating cup, is blown and evenly mixed, is transferred into a 1.5mL sterile centrifuge tube, and is cultured for 2-3 h in a shaking table at 28 ℃ and 200 rpm.

(4) After slightly centrifuging, part of the supernatant was discarded, 150. Mu.L of a bacterial liquid rich in bacterial cells was spread on a solid seed medium containing antibiotics, and cultured in a constant temperature incubator at 28℃until colonies with full morphology appeared on the plates.

3. Identification of schizochytrium limacinum genetically engineered strain with PLD gene knocked out

(1) The plate colony is picked and inoculated into a liquid seed culture medium containing 30-50 mg/L bleomycin, and the culture is carried out for 24 hours at 28 ℃ and 200 rpm.

(2) And (5) shaking the bottle for 5-7 times according to the operation, and ensuring stable inheritance of the knockout carrier.

(3) The genome of the positive strain with stable inheritance is extracted, primers (SEQ ID No.7 and SEQ ID No. 8) specifically combined with the bleomycin resistance gene are designed for PCR verification, the agarose gel electrophoresis diagram of the genetic engineering strain identification is shown in figure 3, and the result shows that PLD gene has been knocked out successfully.

(4) The successfully constructed schizochytrium limacinum gene engineering strain with the PLD gene knocked out is preserved at the temperature of minus 80 ℃.

EXAMPLE 3 determination of the transcription level of PLD Gene in Positive transformants

Primers shown as SEQ ID No.9 to SEQ ID No.12 are designed according to PLD gene sequences and internal reference Actin sequences, and then transcription level determination is carried out by RT-q-PCR, and the specific experimental steps are as follows:

1. Sample pretreatment:

1mL of the fermentation broth after the homogenization was taken out and centrifuged at 10,000rpm for 2min at room temperature in a 1.5mL centrifuge tube to collect the cells. The cells were washed with physiological saline, collected by centrifugation in the same manner, and repeated twice. Quenching with liquid nitrogen after washing, and storing in a refrigerator at-80deg.C.

2. RNA extraction

(1) The pretreated thalli are placed in a mortar, ground for 5to 6 times by liquid nitrogen, 600 mu L Buffer RL solution is added after the thalli are in powder form, and the thalli are repeatedly blown into the mortar until no obvious precipitate exists, and then transferred into a 1.5mL sterilizing centrifuge tube.

(2) The lysate was centrifuged at 12,000rpm for 5min at 4℃and the supernatant carefully aspirated into the fresh 1.5mL RNase Free Tube.

(3) The supernatant was transferred to GDNA ERASER SPIN Column mounted in a Collection Tube and centrifuged at 12,000rpm for 1min.

(4) And (3) discarding GDNA ERASER SPIN columns, adding 1/2 volume of absolute ethyl alcohol into a Collection Tube, blowing and uniformly mixing, and immediately transferring the mixed solution into RNA Spin columns (containing the Collection Tube). (if the mixture is more than 600. Mu.L, the addition is done in portions.) 12,000rpm is centrifuged for 1min and the filtrate is discarded.

(5) Mu.L of Buffer RWA was added to RNA Spin Column, centrifuged at 12,000rpm for 30s, and the filtrate was discarded.

(6) 600. Mu.L of Buffer RWB was added to RNA Spin Column around the tube wall, centrifuged at 12,000rpm for 30s, and the filtrate was discarded. The operation is repeated once.

(7) Spin at 12000rpm for 2 minutes.

(8) RNA Spin Column was mounted on 1.5mL RNASE FREE Collection Tube, 50. Mu.L RNASE FREE DH ₂ O was added at the center of the membrane, and after 5min at room temperature, RNA was eluted by centrifugation at 12,000rpm for 2 min.

3. RNA reverse transcription

(1) Various reagents required for the reaction were added to the PCR tube according to Table 2.

(2) Incubation was carried out for 5 minutes at 50℃after mixing.

(3) Heating at 85deg.C for 5 secondsUni RT/RI and gDNA Removal inactivation.

TABLE 2 RNA reverse transcription System

4. Real-time fluorescent quantitative PCR

(1) The reagents were added as in table 3. This reaction was carried out by a PCR instrument, and the reaction procedure is shown in Table 4.

TABLE 3 RT-qPCR reaction System

TABLE 4 RT-qPCR reaction procedure

The results show that the schizochytrium limacinum gene engineering strain with the PLD gene knocked out obtained by the method of the embodiment of the invention shows lower transcription level in the middle and late stages of fermentation than the PLD gene of the wild strain.

EXAMPLE 4 determination of DHA content of schizochytrium limacinum genetically engineered Strain with PLD Gene knocked out

1. Cultivation of schizochytrium

(1) Activating strains: culturing schizochytrium limacinum seed at-80deg.C on solid seed culture medium by streaking, and culturing at 28deg.C for 36 hr.

(2) First-stage seed: selecting single thallus with full shape on the cultured solid seed culture medium, placing the single thallus in 50mL of seed culture medium, and culturing for 24h at 28 ℃ and 200 rpm.

(3) Secondary seed: from the primary seed medium, a certain amount of the seed culture solution was transferred to 50mL of the seed medium at an inoculum size of 4%, and cultured at 28℃and 200rpm for 24 hours.

(4) Shaking and fermenting: from the secondary seed medium, a certain amount of seed culture solution was transferred to 50mL of fermentation medium at an inoculum size of 4%, and cultured at 28℃and 200rpm for 144 hours.

2. Determination of total fat content

(1) Taking 5mL of fermentation liquor into a 50mL centrifuge tube, adding 5mL of concentrated hydrochloric acid into the centrifuge tube, adding a magnetic rotor, and heating the magnetic stirrer at a constant temperature of 65 ℃ for 50min until the thalli are completely digested.

(2) Taking out the centrifuge tube, cooling to room temperature, adding 5mL of n-hexane for extraction, reversing, uniformly mixing, standing for 5min, centrifuging at 6,000rpm for 1min, taking the upper organic phase into the weighed 50mL centrifuge tube, and repeating the operation twice until the upper organic phase is colorless.

(3) The normal hexane in the centrifuge tube was dried with nitrogen and placed in an oven at 60 ℃ for 2 hours to evaporate the normal hexane completely.

(4) And taking out the centrifuge tube, cooling to room temperature, and weighing, wherein the weight of the empty centrifuge tube is subtracted from the weight of the centrifuge tube to obtain the total grease yield.

3. Determination of fatty acid content

(1) 5ML of 0.5M KOH-CH ₃ OH solution is added into a 50mL centrifuge tube filled with grease, and the centrifuge tube is placed in a constant temperature water bath kettle at 65 ℃ and heated for 10min until the grease is completely dissolved.

(2) After the centrifuge tube was taken out and cooled to room temperature, 5mL of 30% boron trifluoride diethyl etherate was added to the centrifuge tube, and the centrifuge tube was heated in a 65℃thermostat water bath for 30min.

(3) Taking out the centrifuge tube, cooling to room temperature, adding 5mL of normal hexane and 50 mu L of 40g/L of methyl eicosanoate, shaking, mixing uniformly, adding 1mL of saturated sodium chloride solution to prevent emulsification, standing for 5min, and layering.

(4) The upper organic phase was pipetted into a 5mL centrifuge tube containing an appropriate amount of anhydrous sodium sulfate for dehydration.

(5) The solution in the 5mL centrifuge tube was filtered through a 0.22 μm organic filter and filled into a gas bottle for gas chromatography. The gas chromatography detection conditions were as follows:

Instrument: AGILENTGC7890A gas chromatography; chromatographic column: supelco-2560 (100 m 0.25mm ID,0.20 μmfilm); sample injection setting: the sample injection amount is 1 mu L, the sample injection temperature is 260 ℃, and the split ratio is 50:1; carrier gas: nitrogen, 20cm/s; detector temperature: 260 ℃; column temperature control: the initial temperature is 140 ℃, and the temperature is maintained for 5min; then the temperature was raised to 260℃at a rate of 3℃per minute and maintained for 10 minutes.

The DHA yield of the modified strain and the wild strain is shown in figure 5, and the result shows that the DHA yield of the schizochytrium limacinum genetic engineering strain with the PLD gene knocked out is obviously improved by 12.3 percent (P < 0.01) when the schizochytrium limacinum genetic engineering strain is 120 hours compared with the wild strain, which is mainly due to the influence of PLD knockout on the DHA ratio (table 5), and the DHA ratio is improved by 13.3 percent (P < 0.01) when the PLD knockout is 120 hours. The result shows that the yield of schizochytrium DHA can be obviously improved by knocking out PLD genes.

TABLE 5 fatty acid Components of wild type strains and genetically engineered strains in the late fermentation stage

Note that: the significance difference was compared by one-way analysis of variance, and was insignificant when P > 0.05, significant when 0.01 < P < 0.05, indicated by x, and very significant when P < 0.01, indicated by x.

The foregoing description is only illustrative of the preferred embodiments of the present invention, and therefore should not be taken as limiting the scope of the invention, for all changes and modifications that come within the meaning and range of equivalency of the claims and specification are therefore intended to be embraced therein.

Claims

1. A schizochytrium limacinum gene engineering strain for knocking out phospholipase D genes is characterized in that: the genetic engineering strain is constructed by taking Schizochytrium limacinum SR as an original strain, and a phospholipase D gene in a genome of the genetic engineering strain is knocked out; the construction method of the schizochytrium limacinum gene engineering strain for knocking out the phospholipase D gene comprises the following steps:

1) Designing primers shown as SEQ ID No. 3-SEQ ID No.6 by taking Schizochytrium limacinum SR genome as a template;

2) Cloning an upstream and downstream sequence of a PLD gene derived from Schizochytrium limacinum SR genome by using the primer in the step 1) as a homology arm, and inserting the obtained upstream homology arm and downstream homology arm of the PLD gene into a homologous recombination region of a pBlue-zeo knockout vector to construct a PLD gene knockout vector pBlue-zeo-PLD;

3) Linearizing the homologous recombination region of the constructed PLD gene knockout vector pBlue-zeo-PLD, and electrically converting to

Schizochytrium limacinum

Homologous recombination is carried out in the genome of SR21, thus obtaining the schizochytrium limacinum gene engineering strain with the PLD gene knocked out.

2. Use of a schizochytrium limacinum genetically engineered strain from which a phospholipase D gene is knocked out according to claim 1 for the synthesis of DHA.

3. A method for producing DHA using the schizochytrium limacinum genetically engineered strain from which the phospholipase D gene is knocked out of claim 1, comprising: inoculating the schizochytrium limacinum gene engineering strain with the phospholipase D gene knocked out into a seed culture medium for activation to obtain a strain for fermentation; inoculating the strain for fermentation to a fermentation culture medium for culture; and collecting thalli to obtain the grease component DHA.

4. A method according to claim 3, characterized in that: inoculating the schizochytrium limacinum genetic engineering strain with the PLD gene knocked out on a solid seed culture medium, and performing stationary culture at the temperature of 27-29 ℃ for activation; inoculating the activated seeds to a liquid seed culture medium, and culturing at the temperature of 27-29 ℃ and the speed of 150-250 rpm to obtain first-stage seeds; inoculating the primary seeds to a liquid seed culture medium in an inoculum size of 2% -10%, and culturing at the temperature of 27-29 ℃ and at the speed of 150-250 rpm to obtain secondary seeds; and (3) taking the secondary seeds as the strains for fermentation, inoculating the strains for fermentation to a fermentation culture medium in an inoculum size of 2% -10%, and culturing at the temperature of 27-29 ℃ and the speed of 150-250 rpm to obtain the grease component DHA.

5. The method according to claim 4, wherein: the formula of the solid seed culture medium is as follows: 29-31 g/L of glucose, 9-11 g/L of yeast powder, 48-52 mL of 20 Xinorganic salt component A, 1.5-2.5 mL of 500 XCaCl ₂, 15-20 g/L of agar and adjusting the pH to 6.4-6.6.

6. The method according to claim 4, wherein: the formula of the liquid seed culture medium is as follows: 29-31 g/L of glucose, 9-11 g/L of yeast powder, 48-52 mL of 20 Xinorganic salt component A, 1.5-2.5 mL of 500 XCaCl ₂ and adjusting the pH to 6.4-6.6.

7. A method according to claim 3, characterized in that: the formula of the fermentation medium is as follows: 88-92 g/L of glucose, 4-6 g/L of corn steep liquor powder, 4-6 g/L of tryptone, 48-52 mL of 20X inorganic salt component A, 1.5-2.5 mL of 500X CaCl ₂ and adjusting the pH to 6.4-6.6.

8. The method according to any one of claims 5 to 7, characterized in that: wherein the formula of the 20X inorganic salt component A is that ：NaSO₄ 238~242 g/L,MgSO₄ 38~42 g/L,(NH₄)₂SO₄ 19~21 g/L,KH₂PO₄ 19~21 g/L,K₂SO₄ 12~14 g/L,KCl 9~11 g/L.

9. The method according to any one of claims 5 to 7, characterized in that: the 500 XCaCl ₂ formula is as follows: 83-87 g/L CaCl ₂·2H₂ O or ₂ -67 g/L anhydrous CaCl.