CN115975823B - Phospholipase D gene knockout Schizochytrium genetic engineering strain and its construction method and application - Google Patents

Abstract

The present invention discloses a phospholipase D gene-knocked-out schizochytrium genetic engineering strain, a construction method and an application thereof. The present invention uses schizochytrium limacinum SR21 as an original strain, constructs a knockout vector in Escherichia coli by genetic engineering means, uses the upstream and downstream sequences of the PLD gene as homology arms, replaces the PLD gene with the bleomycin gene and serves as a screening resistance gene, and obtains a high-yield DHA genetic engineering strain, which provides a new idea for genetic engineering regulation of high-yield DHA in schizochytrium.

Description

Genetically engineered Schizochytrium strain with knockout phospholipase D gene and its construction method and application

Technical Field

The invention belongs to the technical field of bioengineering, and in particular relates to a schizochytrium genetic engineering strain with a phospholipase D gene knocked out, a construction method and an application thereof.

Background technique

As a high-quality producer of polyunsaturated fatty acids (PUFAs), Schizochytrium is a representative strain for the industrial production of PUFAs and DHA due to its fast growth rate, high oil content and high DHA ratio. Scientists at home and abroad have conducted extensive research on the synthesis mechanism of PUFAs in Schizochytrium and found that the pathways of PUFAs synthesis in Schizochytrium include the fatty acid synthase (FAS) pathway and the polyketide synthase (PKS) pathway, among which the synthesis of DHA in Schizochytrium is considered to be mainly related to the PKS pathway. Recent studies have found that the production of DHA in Schizochytrium depends not only on the synthesis process of DHA, but also on the assembly form of migration, accumulation and storage after DHA synthesis. The storage form of DHA in Schizochytrium is mainly triglycerides, and some exist in the form of phospholipids and sterol esters. The mutual conversion of glycerides, phospholipids and sterol esters is also accompanied by the migration of fatty acids, and the process is closely related to phospholipid metabolism. Therefore, optimizing the phospholipid metabolism process of Schizochytrium is of great significance for the synthesis of DHA in Schizochytrium.

Phospholipase D specifically hydrolyzes the phosphodiester bonds in phospholipids and mainly catalyzes two types of reactions: (1) hydrolysis reaction; (2) transphosphatidyl transfer reaction. Phospholipase D can regulate the distribution of TAG and phospholipids through hydrolysis, and can also convert different types of phospholipids through transphosphatidyl transfer. Regulating the expression of phospholipase D will affect the phospholipid metabolism of Schizochytrium, and then affect the lipid and DHA synthesis of Schizochytrium. However, to date, there has been no report on regulating phospholipase D in Schizochytrium to affect the lipid synthesis and lipid storage form of Schizochytrium.

Summary of the invention

The purpose of the present invention is to solve the shortcomings of the prior art to a certain extent, and provide a genetically engineered strain of Schizochytrium limacinum with a phospholipase D gene knocked out, a construction method and an application thereof. The present invention uses Schizochytrium limacinum SR21 as the original strain, and regulates the lipid storage form of Schizochytrium limacinum by knocking out the PLD gene, thereby enhancing the synthesis of DHA.

One of the technical solutions adopted by the present invention to solve the technical problem is:

A schizochytrium genetically engineered strain with a knocked-out phospholipase D (PLD) gene is disclosed. The genetically engineered strain is constructed using Schizochytrium limacinum SR21 as an original strain. The PLD gene in the genome of the genetically engineered strain is knocked out, thereby reducing the PLD expression level in the genetically engineered strain.

The second technical solution adopted by the present invention to solve its technical problem is:

A method for constructing a genetically engineered strain of Schizochytrium with a PLD gene knocked out, comprising:

(1) The upstream and downstream homologous arms of the PLD gene from the genome of the wild-type strain Schizochytrium limacinum SR21 were cloned and inserted into the homologous recombination region of the pBlue-zeo plasmid to construct the PLD gene knockout vector pBlue-zeo-PLD with bleomycin resistance;

(2) After linearization of the homologous recombination region of the PLD gene knockout vector pBlue-zeo-PLD, the vector was electroporated and introduced into Schizochytrium limacinum SR21 competent cells to obtain a Schizochytrium genetic engineering strain with the phospholipase D gene PLD knocked out.

Furthermore, in the step (1), the construction method of the PLD gene knockout vector pBlue-zeo-PLD comprises: designing primers as shown in SEQ ID No.3 to SE1 ID No.6 according to the sequence information of the PLD gene of Schizochytrium limacinum SR21, and obtaining the upstream homologous arm of the PLD gene and the downstream homologous arm of the PLD gene by PCR amplification; and sequentially digesting and ligating the obtained upstream homologous arm of the PLD gene and the downstream homologous arm of the PLD gene with the plasmid pBlue-zeo, and then transforming them into Escherichia coli DH5α competent cells to obtain the knockout vector pBlue-zeo-PLD.

Furthermore, in the step (2), the method for constructing a Schizochytrium genetically engineered strain with the phospholipase D gene PLD knocked out includes: extracting the pBlue-zeo-PLD knockout vector plasmid, linearizing it with double enzyme digestion, and then electroporating it into a Schizochytrium competent cell for homologous recombination, screening positive transformants on a bleomycin resistance plate, and verifying them using PCR, thereby finally obtaining a Schizochytrium genetically engineered strain with the PLD gene knocked out.

in:

SEQ ID No.1: Upstream homology arm sequence of PLD gene in SR21 genome

acgcacgtgatgaattgaattccaagcctagctatgtgaacgttccaatctgggaagactgaccttacaaaccaaatctcacggtgaaatgaagatatattgcatcagaacggtgaaagatatattgcatcagaacggttttatcttggctagaaataagatttgagcgctcggccaatctggaggctctgcgtttgggttgctaagttttcattactgttgtgaggaag ggcggagaaagttaaagtggctcacttcaatggttttctcaactccttcatttcaactacaagaatgatgtttaaggcttgtaattgtgaattttgttt attcatctttgagattgagatcaagtatacttcgttctgcaagcctcaatcatggtattctaaaactctattctcaaggctcttacatattttatgagatataaatgcatgaacccttctgcagaacaacatagggttgcggcagcgtatggtgccaacaaaatagacacaattgtgggagaactcaaggcaatgctcaacagcaactaatata aaataagagtatgtggccattcagacaggcaggggtatagcaacctttgaatgtgctgcgatggataatgagtggaagcagaaca

SEQ ID No.2: Downstream homology arm sequence of PLD gene in SR21 genome

ttgcgtctcccatgctagcatagctttgcatgtattcatatctctgattccatatgtttacgatattgaaatcagagaacgttgttaatttcattcataaaaatcgagtatttctgcgaagtctgaagtagccagtgttttgtggtagttgatgtcgttcagcttcccgttactttgactcaacagcaaagagaatatatagt ttattgtttgttcgttttcaaacaaaacacacacgcccgaaaaacattaaagaaacatgtagttctagtaacaaatttaaatgtcttacagagccta atcttatgttatgtaaaggcccaagtatgttgagcccagtaaattgtaaatgaaatatgcctcgcataccacatgccctcttcagcgttttggccttagtcaactcttctattcaaggaagaaaatctaacaaagtaaatctatagctacacaacaaatatagaagttacgctcaatccaaataccttacatgttattcagttgtac acggagcgaatcacgttcttcgatgaactcgtaaggggttccatagtacatcggatcaaggttttcgtttccttcgtaagcctcggcagcagc

The third technical solution adopted by the present invention to solve its technical problem is:

A use of the above-mentioned Schizochytrium genetic engineering strain with phospholipase D gene knocked out in synthesizing DHA.

The fourth technical solution adopted by the present invention to solve the technical problem is:

A method for producing DHA using the above-constructed PLD gene-knocked Schizochytrium genetically engineered strain, which comprises inoculating the PLD gene-knocked Schizochytrium genetically engineered strain into a seed culture medium for activation to obtain a fermentation strain; inoculating the fermentation strain into a fermentation culture medium for fermentation culture; and collecting the bacterial cells for lipid component identification and analysis to obtain DHA.

Furthermore, the method for obtaining the fermentation strain is as follows: first, a genetically engineered strain of Schizochytrium with a PLD gene knocked out is inoculated on a solid seed culture medium, and statically cultured at 27 to 29° C. for activation; then, a single colony with a full morphology is picked and inoculated into a liquid seed culture medium, and cultured at 27 to 29° C. and 150 to 250 rpm to obtain a primary seed; finally, the primary seed is inoculated into a new liquid seed culture medium at an inoculation amount of 2% to 10%, and cultured at 27 to 29° C. and 150 to 250 rpm to obtain a secondary seed as the fermentation strain; the secondary seed is inoculated into a fermentation culture medium at an inoculation amount of 2% to 10%, and cultured at 27 to 29° C. and 150 to 250 rpm, and samples are taken during the culture process for oil component identification and analysis to obtain DHA.

Furthermore, the solid seed culture medium has a formula of: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500×CaCl ₂ 1.5-2.5 mL, agar 15-20 g/L, and the pH is adjusted to 6.4-6.6.

Furthermore, the liquid seed culture medium is formulated as follows: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, and the pH is adjusted to 6.4-6.6.

Furthermore, the fermentation medium formula is: glucose 88-92 g/L, corn steep liquor 4-6 g/L, tryptone 4-6 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, and the pH is adjusted to 6.4-6.6.

The 20× inorganic salt component A includes: NaSO ₄ 238-242 g/L, MgSO ₄ 38-42 g/L, (NH ₄ ) ₂ SO ₄ 19-21 g/L, KH ₂ PO ₄ 19-21 g/L, K ₂ SO ₄ 12-14 g/L, KCl 9-11 g/L, and the solvent is deionized water.

Wherein, the 500×CaCl ₂ comprises: CaCl ₂ ·2H ₂ O 83-87 g/L or anhydrous CaCl ₂ 63-67 g/L, and the solvent is deionized water.

Unless otherwise specified, the equipment, reagents, processes, parameters, etc. involved in the present invention are conventional equipment, reagents, processes, parameters, etc. and are not given as embodiments.

All ranges recited herein include all point values within the range.

In the present invention, the "room temperature" refers to the normal ambient temperature, which may be 10 to 30°C.

Compared with the background technology, this technical solution has the following advantages:

The invention uses Schizochytrium limacinum SR21 as a wild-type strain, constructs a PLD gene knockout vector pBlue-zeo-PLD in Escherichia coli with sequences at both ends of a PLD gene as homology arms and bleomycin as a screening marker, and introduces a functional fragment into a Schizochytrium genome through electroporation for homologous recombination, thereby obtaining a Schizochytrium engineered strain with a PLD gene knocked out, thereby increasing the yield of DHA, and providing a new idea for genetic engineering regulation of Schizochytrium to produce high DHA.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 is a schematic diagram of the gene knockout vector pBlue-zeo.

FIG2 is a schematic diagram of the PLD gene knockout vector pBlue-zeo-PLD.

Figure 3 is an agarose gel electrophoresis diagram of genetic engineering strain identification, where PC is a positive control, NC is a negative control, M is a marker, and PT is a knockout strain.

FIG. 4 is a graph showing the results of RT-qPCR analysis of the PLD gene of the Schizochytrium limacinum SR21 wild-type strain and the genetically engineered strain.

FIG. 5 is a comparison of DHA production between the wild-type strain and the genetically engineered strain of Schizochytrium limacinum SR21.

Detailed ways

The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

The culture medium used in the embodiment of the present invention is as follows:

Solid seed culture medium: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, agar 15-20 g/L, and the culture medium pH is adjusted to 6.5.

Liquid seed culture medium: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, the culture medium pH is adjusted to 6.5.

Fermentation medium: glucose 88-92 g/L, tryptone 4-6 g/L, corn steep liquor 4-6 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, pH adjusted to 6.5.

Wherein: 20×inorganic salt component A: MgSO ₄ 38～42g/L, (NH4) ₂ SO ₄ 19～21g/L, Na ₂ SO ₄ 238～242g/L, KH ₂ PO ₄ 19～21g/L, KCl 9～11g/L, K ₂ SO ₄ 12～14g/L, and the solvent is deionized water.

500×CaCl ₂ : CaCl ₂ ·2H ₂ O 83-87 g/L or anhydrous CaCl ₂ 63-67 g/L, the solvent is deionized water.

The entire fermentation culture cycle is 144 hours, and samples are taken and tested every 24 hours.

Table 1 Summary of primer sequences used in the embodiments of the present invention

Example 1 Construction of PLD gene knockout vector pBlue-zeo-PLD

1. Amplification of upstream and downstream homology arms of PLD gene

According to the sequence information of the PLD gene of Schizochytrium, primers PLD-U (as shown in SEQ ID No.3 and SEQ ID No.4) for amplifying the upstream homologous arm of the PLD gene and primers PLD-D (as shown in SEQ ID No.5 and SEQ ID No.6) for amplifying the downstream homologous arm of the PLD gene were designed, and restriction sites Xho I and Hind III were inserted before and after the upstream homologous arm sequence, and restriction sites BamH I and Xba I were inserted before and after the downstream homologous arm sequence through primer design. Then, the genome of the wild-type strain was used as a template, and PrimerStar high-fidelity polymerase and the above primers were used to obtain the upstream homologous arm of the PLD gene and the downstream homologous arm of the PLD gene by PCR.

The PCR program was: 94°C for 5 min, (94°C for 1 min, 60°C for 1 min, 72°C for 1 min) × 35 cycles, 72°C for 10 min, 4°C forever.

2. Construction of PLD gene knockout vector pBlue-zeo-PLD

(1) The knockout vector pBlue-zeo (Figure 1) and the PCR purified product fragment of the upstream homology arm of the PLD gene were double-digested with restriction endonucleases Xho I and Hind III at 37°C for 2 h. The double-digestion system was: 4 μg DNA template, 5 μL 10× QuickCut Buffer, 1.5 μL of each of the two quick-cut enzymes, and an appropriate amount of pre-cooled sterile water was added to make up the system to 50 μL.

(2) Use T4 ligase to connect the upstream homology arm fragment of the PLD gene and the vector pBlue-zeo fragment, and react at 16°C for 12 hours. Ligation system: 10×T ₄ DNA Ligase Buffer 1μL, T ₄ DNA Ligase 1μL, vector fragment 1.5μL, target gene fragment 6.5μL.

(3) The ligation product was transformed into E. coli DH5α competent cells. The transformation method was as follows:

i. Take 100 μL of E. coli DH5α competent cells and place them on ice to thaw for 10 min. Then add 10 μL of pre-cooled ligation product and place them on ice for 30 min.

ii. Place the competent cells containing the ligation product in a 42°C water bath for 45 seconds and then immediately place on ice for 2 to 3 minutes.

iii. Add 900 μL LB medium to the competent cells containing the ligation product and culture at 37°C, 200 rpm, on a shaking platform for 1 h.

iv. Take 150 μL of the culture medium and spread it on an LB plate containing antibiotics, and culture it at 37°C for 12 to 16 hours.

Positive transformants were picked, plasmids were extracted, and after PCR verification of successful connection, the above operation was repeated for the pBlue-zeo vector with the upstream homologous arm of the PLD gene inserted, and the downstream homologous arm of the PLD gene was inserted. After successful PCR verification and sequencing verification, the PLD gene knockout vector pBlue-zeo-PLD was finally obtained (Figure 2).

Example 2 Construction of a genetically engineered strain of Schizochytrium with PLD gene knocked out

The pBlue-zeo-PLD knockout vector plasmid was extracted, linearized with restriction endonucleases Apa I and Not I, and then electroporated into Schizochytrium competent cells for homologous recombination. Positive transformants were screened on bleomycin resistance plates and verified by PCR (Figure 3), and finally a Schizochytrium genetic engineering strain with the PLD gene knocked out was obtained. The specific process is as follows:

1. Preparation of Schizochytrium competent cells:

(1) Pick a single colony of activated Schizochytrium to 10 mL of liquid seed culture medium and culture it in a shaker at 28°C and 200 rpm for 24 h.

(2) Transfer 2 mL of the primary seed solution to 50 mL of liquid seed culture medium and culture in a shaking incubator at 28°C and 200 rpm for 6 to 10 h until the _OD600 is approximately 1.5 to 3.

(3) Transfer 10 mL of the cultured bacterial suspension to a sterilized 50 mL centrifuge tube and centrifuge at 4,500 rpm for 2 min at room temperature. Discard the supernatant.

(4) Add 20 mL of pre-cooled sterile water to wash the cells, centrifuge at 4,500 rpm for 2 min at 4°C, and discard the supernatant.

(5) Add 25 mL of DTT-PBS buffer to resuspend the cells and incubate in a shaker at 28°C and 200 rpm for 30 min. Centrifuge at 4,500 rpm for 2 min at room temperature and discard the supernatant.

(6) Add 20 mL of pre-cooled sterile water to resuspend the cells. Centrifuge at 4,500 rpm for 2 min at 4°C and discard the supernatant.

(7) Add 20 mL of sterile pre-cooled sorbitol solution to resuspend the cells, centrifuge at 4,500 rpm for 4 min at 4°C, discard the supernatant, and repeat this operation once.

(8) Add a small amount of sterile pre-cooled sorbitol solution to the centrifuge tube, pipette and mix thoroughly, and then dispense 100 μL per tube into 1.5 mL sterile centrifuge tubes and place on ice for later use.

2. Electrotransformation of Schizochytrium:

(1) Add 10-20 μL of the functional gene fragment (about 2-3 μg) to the Schizochytrium competent cells, pipette to mix, transfer to an electric shock cup, and place on ice for 30 min.

(2) After wiping the electric shock cup, install it in the corresponding position of the electroporator. The electric shock program is: 2KV, 6ms, one pulse.

(3) Take 1 mL of pre-cooled liquid seed culture medium (containing 1 M sorbitol) into an electric rotating cup, pipette to mix, and then transfer to a 1.5 mL sterile centrifuge tube and culture in a shaking incubator at 28°C and 200 rpm for 2 to 3 h.

(4) After slight centrifugation, discard part of the supernatant and spread 150 μL of the bacterial solution rich in bacteria on a solid seed culture medium containing antibiotics. Incubate the culture in a constant temperature incubator at 28°C until full-bodied colonies appear on the plate.

3. Identification of genetically engineered Schizochytrium strains with PLD gene knockout

(1) Select colonies from the plate and inoculate them into a liquid seed culture medium containing 30-50 mg/L bleomycin and culture at 28°C and 200 rpm for 24 h.

(2) Follow the above steps to subculture the cells 5 to 7 times to ensure stable inheritance of the knockout vector.

(3) The genome of the stable genetic positive strain was extracted, and primers (SEQ ID No. 7 and SEQ ID No. 8) that specifically bind to the bleomycin resistance gene were designed for PCR verification. The agarose gel electrophoresis diagram of the genetically engineered strain identification is shown in FIG3 , and the results show that the PLD gene has been successfully knocked out.

(4) The successfully constructed PLD gene knockout strain of Schizochytrium was stored at -80°C.

Example 3 Determination of PLD gene transcription level in positive transformants

Primers as shown in SEQ ID No. 9 to SEQ ID No. 12 were designed based on the PLD gene sequence and the internal reference Actin sequence, and then the transcription level was determined by RT-q-PCR. The specific experimental steps are as follows:

1. Sample pretreatment:

Take 1 mL of the mixed fermentation liquid in a 1.5 mL centrifuge tube and centrifuge at 10,000 rpm for 2 min at room temperature to collect the cells. Wash the cells with physiological saline and centrifuge to collect the cells twice. After washing, quench with liquid nitrogen and store in a -80°C refrigerator for later use.

2. RNA Extraction

(1) Place the pretreated bacteria in a mortar and grind them with liquid nitrogen for 5 to 6 times. When the bacteria become powder, add 600 μL of Buffer RL solution and repeatedly pipette until there is no obvious precipitation in the mortar. Then transfer the mixture to a 1.5 mL sterile centrifuge tube.

(2) Centrifuge the lysate at 12,000 rpm for 5 min at 4°C and carefully pipette the supernatant into a new 1.5 mL RNase Free Tube.

(3) Transfer the supernatant to the gDNA Eraser Spin Column installed in the Collection Tube and centrifuge at 12,000 rpm for 1 min.

(4) Discard the gDNA Eraser Spin Column, add 1/2 volume of anhydrous ethanol to the Collection Tube, pipette to mix, and immediately transfer the entire mixture to the RNA Spin Column (with Collection Tube). (If the mixture is more than 600 μL, add it in batches.) Centrifuge at 12,000 rpm for 1 min and discard the filtrate.

(5) Add 500 μL of Buffer RWA to the RNA Spin Column, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

(6) Add 600 μL of Buffer RWB to the RNA Spin Column along the sides of the tube, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate. Repeat the operation once.

(7) Centrifuge at 12000 rpm for 2 minutes.

(8) Place the RNA Spin Column on a 1.5 mL RNase free Collection Tube, add 50 μL of RNase Free dH ₂ O to the center of the membrane, let stand at room temperature for 5 min, and then centrifuge at 12,000 rpm for 2 min to elute the RNA.

3. RNA reverse transcription

(1) Add the reagents required for the reaction into the PCR tube according to Table 2.

(2) Mix well and incubate at 50°C for 5 minutes.

(3) Heat at 85°C for 5 seconds to Inactivation by Uni RT/RI and gDNA Removal.

Table 2 RNA reverse transcription system

4. Real-time fluorescence quantitative PCR

(1) Add reaction reagents according to Table 3. Perform the reaction using a PCR instrument. The reaction procedure is shown in Table 4.

Table 3 RT-qPCR reaction system

Table 4 RT-qPCR reaction procedure

The results showed that the PLD gene knocked out Schizochytrium genetically engineered strain obtained by the method of the embodiment of the present invention showed lower transcription levels of the PLD gene in both the middle and late fermentation stages than that of the wild-type strain.

Example 4 Determination of DHA content in the genetically engineered strain of Schizochytrium with PLD gene knocked out

1. Cultivation of Schizochytrium

(1) Activation of strains: Take Schizochytrium seeds stored at -80°C and streak culture on solid seed culture medium, and culture at 28°C for 36 h.

(2) Primary seeds: Select single bacteria with full morphology from the cultured solid seed medium, place them in 50 mL of seed medium, and culture them at 28°C and 200 rpm for 24 h.

(3) Secondary seeds: From the primary seed culture medium, transfer a certain amount of seed culture solution to 50 mL of seed culture medium according to the inoculum amount of 4%, and culture at 28°C and 200 rpm for 24 h.

(4) Shake flask fermentation: A certain amount of seed culture solution was transferred from the secondary seed culture medium to 50 mL of fermentation medium according to a 4% inoculum amount and cultured at 28° C. and 200 rpm for 144 h.

2. Determination of total oil content

(1) Take 5 mL of fermentation broth and transfer it to a 50 mL centrifuge tube. Then add 5 mL of concentrated hydrochloric acid to the centrifuge tube and add a magnetic rotor. Place the tube in a constant temperature heating magnetic stirrer at 65°C for 50 min until the bacteria are completely digested.

(2) Remove the centrifuge tube and wait for it to cool to room temperature. Add 5 mL of n-hexane for extraction, invert, mix, and let stand for 5 min. Centrifuge at 6,000 rpm for 1 min. Take the upper organic phase and transfer it to a weighed 50 mL centrifuge tube. Repeat this operation twice until the upper organic phase becomes colorless.

(3) Blow dry the n-hexane in the centrifuge tube with nitrogen and place it in an oven at 60°C for 2 h to completely evaporate the n-hexane.

(4) Take out the centrifuge tube, wait for it to cool to room temperature, and weigh it. Subtract the weight of the empty centrifuge tube from the obtained weight to obtain the total oil yield.

3. Determination of fatty acid content

(1) Add 5 mL of 0.5 M KOH-CH ₃ OH solution to a 50 mL centrifuge tube containing oil and fat, and heat the centrifuge tube in a 65°C constant temperature water bath for 10 min until the oil and fat are completely dissolved.

(2) After the centrifuge tube is taken out and cooled to room temperature, 5 mL of 30% boron trifluoride ether is added to the centrifuge tube, and the centrifuge tube is placed in a constant temperature water bath at 65° C. and heated for 30 min.

(3) After cooling to room temperature, add 5 mL of n-hexane and 50 μL of 40 g/L methyl eicosanoate, shake and mix, then add 1 mL of saturated sodium chloride solution to prevent emulsification and let stand for 5 min to separate the layers.

(4) Use a pipette to draw the upper organic phase and add it to a 5 mL centrifuge tube containing an appropriate amount of anhydrous sodium sulfate for dehydration.

(5) The solution in the 5 mL centrifuge tube was filtered through a 0.22 μm organic filter membrane and placed in a gas phase bottle for gas chromatography analysis. The gas chromatography detection conditions are as follows:

Instrument: Agilent GC7890A gas chromatography; chromatographic column: Supelco-2560 (100m×0.25mm ID, 0.20μm film); injection setting: injection volume 1μL, injection temperature 260℃, split ratio 50:1; carrier gas: nitrogen, 20cm/s; detector temperature: 260℃; column temperature control: initial temperature 140℃, maintain for 5min; then increase the temperature to 260℃ at a rate of 3℃/min and maintain for 10min.

The DHA production of the modified strain and the wild-type strain is shown in Figure 5. The results show that the DHA production of the genetically engineered strain of Schizochytrium with the PLD gene knocked out is significantly improved compared with the wild-type strain, which increased by 12.3% (P < 0.01) at 120h. This is mainly due to the effect of PLD knockout on the DHA proportion (Table 5), and the DHA proportion increased by 13.3% (P < 0.01) at 120h. The results show that the DHA production of Schizochytrium can be significantly improved by knocking out the PLD gene.

Table 5 Fatty acid composition of wild-type strain and genetically engineered strain in the late fermentation period

Note: The significant differences were compared by one-way analysis of variance. When P>0.05, the difference was not significant. When 0.01<P<0.05, the difference was significant, indicated by *. When P<0.01, the difference was extremely significant, indicated by **.

The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims (9)

1. A Schizochytrium genetically engineered strain with a knockout phospholipase D gene, characterized in that: the genetically engineered strain is constructed by selecting Schizochytrium limacinum SR21 as the original strain, and the phospholipase D gene in the genome of the genetically engineered strain is knocked out; the construction method of the Schizochytrium genetically engineered strain with a knockout phospholipase D gene comprises: 1) Using the genome of Schizochytrium limacinum SR21 as a template, primers as shown in SEQ ID No.3 to SEQ ID No.6 were designed; 2) Using the primers described in step 1), clone the upstream and downstream sequences of the PLD gene from the genome of Schizochytrium limacinum SR21 as homology arms, insert the obtained upstream homology arms of the PLD gene and the downstream homology arms of the PLD gene into the homologous recombination region of the pBlue-zeo knockout vector to construct the PLD gene knockout vector pBlue-zeo-PLD; 3) Linearize the homologous recombination region of the constructed PLD gene knockout vector pBlue-zeo-PLD and electroporate into Schizochytrium limacinum Homologous recombination was performed in the genome of SR21 to obtain a genetically engineered strain of Schizochytrium with the PLD gene knocked out. 2. Use of the Schizochytrium genetically engineered strain with phospholipase D gene knocked out according to claim 1 in synthesizing DHA. 3. A method for producing DHA using the Schizochytrium genetically engineered strain with a knockout phospholipase D gene according to claim 1, characterized in that: the Schizochytrium genetically engineered strain with a knockout phospholipase D gene is inoculated into a seed culture medium for activation to obtain a strain for fermentation; the strain for fermentation is inoculated into a fermentation medium for cultivation; and the bacterial cells are collected to obtain the lipid component DHA. 4. The method according to claim 3, characterized in that: the genetically engineered strain of Schizochytrium with the PLD gene knocked out is inoculated on a solid seed culture medium, and statically cultured at 27-29°C for activation; the activated seeds are inoculated into a liquid seed culture medium, and cultured at 27-29°C and 150-250 rpm to obtain primary seeds; the primary seeds are inoculated into a liquid seed culture medium at an inoculation rate of 2%-10%, and cultured at 27-29°C and 150-250 rpm to obtain secondary seeds; the secondary seeds are inoculated into a fermentation culture medium at an inoculation rate of 2%-10% as the fermentation strain, and cultured at 27-29°C and 150-250 rpm to obtain the oil component DHA. 5. The method according to claim 4, characterized in that: the solid seed culture medium formula is: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500×CaCl ₂ 1.5-2.5 mL, agar 15-20 g/L, and the pH is adjusted to 6.4-6.6. 6. The method according to claim 4, characterized in that: the liquid seed culture medium formula is: glucose 29-31 g/L, yeast powder 9-11 g/L, 20× inorganic salt component A 48-52 mL, 500×CaCl ₂ 1.5-2.5 mL, and the pH is adjusted to 6.4-6.6. 7. The method according to claim 3, characterized in that: the fermentation medium formula is: glucose 88-92 g/L, corn steep liquor 4-6 g/L, tryptone 4-6 g/L, 20× inorganic salt component A 48-52 mL, 500× CaCl ₂ 1.5-2.5 mL, and the pH is adjusted to 6.4-6.6. 8. The method according to any one of claims 5 to 7, characterized in that: wherein the formula of the 20× inorganic salt component A is: NaSO ₄ 238~242 g/L, MgSO ₄ 38~42 g/L, (NH ₄ ) ₂ SO ₄ 19~21 g/L, KH ₂ PO ₄ 19~21 g/L, K ₂ SO ₄ 12~14 g/L, KCl 9~11 g/L. 9. The method according to any one of claims 5 to 7, characterized in that: the formula of the 500× _CaCl2 is: _CaCl2 · _2H2O 83-87 g/L or anhydrous _CaCl2 63-67 g/L.