CN106754818B - Heat-resistant esterase mutant and preparation method and application thereof - Google Patents
Heat-resistant esterase mutant and preparation method and application thereof Download PDFInfo
- Publication number
- CN106754818B CN106754818B CN201611100418.5A CN201611100418A CN106754818B CN 106754818 B CN106754818 B CN 106754818B CN 201611100418 A CN201611100418 A CN 201611100418A CN 106754818 B CN106754818 B CN 106754818B
- Authority
- CN
- China
- Prior art keywords
- ala
- val
- leu
- arg
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1031—Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6436—Fatty acid esters
- C12P7/6445—Glycerides
Abstract
The invention discloses a heat-resistant esterase mutant and a preparation method and application thereof, the mutant is obtained by mutating wild heat-resistant esterase, the amino acid sequence of the wild heat-resistant esterase is SEQ ID NO.2, and the site where mutation occurs comprises at least one mutation site as follows: the site where mutation occurs is that the 89 th amino acid is mutated into R from L, the 20 th amino acid is mutated into A from F, the 33 th amino acid is mutated into A from F, the 40 th amino acid is mutated into A from L, the 213 th amino acid is mutated into A from L, the 289 th amino acid is mutated into A from F, wherein the 89 th amino acid is an essential mutation site. The method utilizes esterase to catalyze glyceride to carry out epoxidation reaction, the epoxidation capability is obviously higher than that of a wild type, no side reaction occurs, the yield of the epoxidized fatty glyceride is high, the components are single, the separation and recovery are easy, the controllability of the production process is strong, and the method has economy and environmental protection.
Description
Technical Field
The invention belongs to the field of biotechnology and enzyme engineering, and relates to a preparation method and application of a heat-resistant esterase mutant.
Background
The addition of substances to polymer materials to enhance their plasticity, known as plasticizers, also known as plasticizers or plasticizers, is an essential processing aid in the processing of plastic articles. However, for a long time, international environmental protection departments have found that plasticizers based on phthalic acid products such as dioctyl phthalate (DOP) are likely to cause tissue canceration and disturb endocrine secretion, so that corresponding use-limiting measures are generally taken internationally.
At present, the non-toxic and environment-friendly non-o-benzene plasticizer produced in China is relatively deficient in variety and has fewer related applications. A great deal of research shows that the epoxidized oil and the derivative thereof can be used as a plasticizer to replace DOP. The traditional epoxide production is generally carried out by a chemical method, and the production of the epoxide by the chemical process consumes a large amount of energy and water resources and also causes the generation of a large amount of three wastes. There have been increasing research efforts to achieve epoxidation processes using biochemical techniques. Enzymatic catalytic epoxidation is of great interest because of its high selectivity, specificity, high yield, and the ability to minimize the occurrence of side reactions such as ring opening. In the existing enzyme catalysis method, the most used catalyst is lipase, and the solvent is organic solvent such as toluene, xylene and n-hexane. It is known that lipases can hydrolyze glycerides to free fatty acids, and thus when lipase is used to catalyze the epoxidation of lipids, side reactions occur which involve the hydrolysis of the lipid material itself and the product epoxidized glycerides by lipase to produce fatty acids. If an epoxide with low acid value is required to be obtained, the deacidification treatment is required to be carried out on the epoxidation reaction product, so that the process flow is prolonged, and the production cost is increased. Esterase as a special acyl hydrolase generally hydrolyzes short-chain acyl glyceride and is widely used in the fields of food processing, biological medicine, daily chemical industry, paper making and the like. In the presence of hydrogen peroxide or peroxy acid, esterase has good oxidase activity, so the characteristics of the esterase are utilized, and the esterase is applied to the production of epoxidized soybean oil, fatty acid methyl ester and unsaturated olefins by an enzyme method, so that the problem of side reaction of hydrolysis in the enzyme method can be solved, high-purity products can be obtained, and the quality of epoxide plasticizers can be improved.
Protein engineering is a method capable of improving protein properties, and the method is widely applied in the fields of biomedicine, biocatalysis and the like. The enzyme mutant with excellent performance can be obtained by performing directional mutation and rational modification on the protease molecule by utilizing methods of molecular biology and bioinformatics.
Disclosure of Invention
Aiming at the defects of more side reactions, high acid value and low epoxy yield of the existing epoxidation process. The invention aims to provide a PestE esterase mutant with high activity of over oxidase, which can be used for preparing high-performance epoxide. Through analysis of a protein structure (PDB:3ZWQ) of Pyrobaculum caliodifontis esterase (PestE), mutation sites are rationally selected according to a PestE esterase gene sequence (genbank accession number AB078331.1), a PestE esterase wild type DNA sequence is shown as SEQ ID NO.1 after codon optimization, and a site-directed mutation method is applied to obtain the high-activity mutant. The method of 'original amino acid-position-substituted amino acid' is adopted to indicate the position of the occurrence of the amino acid in the esterase mutant, and the mutant is as follows: contains the L89R mutation site and at least one mutation site selected from the group consisting of L40A, F20A, F33A, L213A and F289A.
The technical scheme of the invention is as follows:
the mutant is obtained by mutating wild heat-resistant esterase derived from Pyrobaculum caliidifontis, the amino acid sequence of the wild heat-resistant esterase is SEQ ID NO.2, and the site where mutation occurs comprises at least one mutation site as follows: the site where mutation occurs is that the 89 th amino acid is mutated into R from L, the 20 th amino acid is mutated into A from F, the 33 th amino acid is mutated into A from F, the 40 th amino acid is mutated into A from L, the 213 th amino acid is mutated into A from L, the 289 th amino acid is mutated into A from F, wherein the 89 th amino acid is an essential mutation site.
The mutant is L89R, and the amino acid sequence of the mutant is SEQ ID NO. 3; or a double mutant consisting of L89R and L40A, the amino acid sequence of the double mutant is SEQ ID NO.4, L89R, L213A and F20A form a triple mutant, the amino acid sequence of the triple mutant is SEQ ID NO.5, L89R, F20A and F33A form a triple mutant, the amino acid sequence of the triple mutant is SEQ ID NO.6, L89R, L40A and F289A form a triple mutant, and the amino acid sequence of the triple mutant is SEQ ID NO. 7.
SEQ ID NO.2
MPLSPILRQILQQLAAQLQFRPDMDVKTVREQFEKSSLILVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVLGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADLMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNFYPILEEGREAVSQIAASIKSMAVA
SEQ ID NO.3
MPLSPILRQILQQLAAQLQFRPDMDVKTVREQFEKSSLILVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVRGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADLMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNFYPILEEGREAVSQIAASIKSMAVA
SEQ ID NO.4
MPLSPILRQILQQLAAQLQFRPDMDVKTVREQFEKSSLIAVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVRGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADLMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNFYPILEEGREAVSQIAASIKSMAVA
SEQ ID NO.5
MPLSPILRQILQQLAAQLQARPDMDVKTVREQFEKSSLILVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVRGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADAMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNFYPILEEGREAVSQIAASIKSMAVA
SEQ ID NO.6
MPLSPILRQILQQLAAQLQARPDMDVKTVREQAEKSSLILVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVRGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADLMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNFYPILEEGREAVSQIAASIKSMAVA
SEQ ID NO.7
MPLSPILRQILQQLAAQLQFRPDMDVKTVREQFEKSSLIAVKMANEPIHRVEDITIPGRGGPIRARVYRPRDGERLPAVVYYHGGGFVRGSVETHDHVCRRLANLSGAVVVSVDYRLAPEHKFPAAVEDAYDAAKWVADNYDKLGVDNGKIAVAGDSAGGNLAAVTAIMARDRGESFVKYQVLIYPAVNLTGSPTVSRVEYSGPEYVILTADLMAWFGRQYFSKPQDALSPYASPIFADLSNLPPALVITAEYDPLRDEGELYAHLLKTRGVRAVAVRYNGVIHGFVNAYPILEEGREAVSQIAASIKSMAVA
The preparation method of the mutant comprises the following steps:
(1) the plasmid is synthesized by expression vector pET-23a and PestE esterase wild type gene sequence;
(2) then, a primer is designed by utilizing a site-directed mutagenesis method, and a target amino acid mutation site is introduced by utilizing a PCR method so as to obtain a corresponding mutant.
The PCR primer sequences are as follows:
L89R-F:5'-TGGAGGTGGATTCGTACGTGGTTCTGTGGAAACTC-3'(SEQ ID NO.8)
L89R-R:5'-GAGTTTCCACAGAACCACGTACGAATCCACCTCCA-3'(SEQ ID NO.9)
L40A-F:5'-GAAGTCAAGTCTTATCGCGGTGAAGATGGCAAACG-3'(SEQ ID NO.10)
L40A-R:5'-CGTTTGCCATCTTCACCGCGATAAGACTTGACTTC-3'(SEQ ID NO.11)
F20A-F:5'GCTGCACAATTGCAGGCTAGACCAGATATGG3'(SEQ ID NO.12)
F20A-R:5'CCATATCTGGTCTAGCCTGCAATTGTGCAGC3'(SEQ ID NO.13)
F33A-F:5'GGTGAGAGAGCAGGCCGAGAAGTCAAGTC3'(SEQ ID NO.14)
F33A-R:5'GACTTGACTTCTCGGCCTGCTCTCTCACC3'(SEQ ID NO.15)
L213A-F:5'GTTATTCTTACTGCCGATGCAATGGCCTGGTTTGGTAG3'(SEQ ID NO.16)
L213A-R:5'CTACCAAACCAGGCCATTGCATCGGCAGTAAGAATAAC3'(SEQ ID NO.17)
F289A-F:5'GTCATTCATGGCTTTGTCAATGCCTATCCAATATTAGAGGAAGG3'(SEQ IDNO.18)
F289A-R:
5'CCTTCCTCTAATATTGGATAGGCATTGACAAAGCCATGAATGAC3'(SEQ ID NO.19)
the recombinant plasmid prepared by the mutant is transferred into a host cell to prepare a recombinant strain. The host cell is Escherichia coli BL 21.
The application of the heat-resistant esterase mutant in preparing epoxidized glyceride.
Compared with the prior art, the invention has the beneficial effects that:
(1) the mutant obtained by the invention has better high temperature resistance and stability, can obviously improve the activity of peroxidase, and obviously improves the tolerance of mutant hydrogen peroxide.
(2) The method utilizes esterase to catalyze glyceride to carry out epoxidation reaction, the epoxidation capability is obviously higher than that of a wild type, no side reaction occurs, the yield of the epoxidized fatty glyceride is high, the components are single, the separation and recovery are easy, the controllability of the production process is strong, and the method has economy and environmental protection.
Drawings
FIG. 1 shows the electrophoretic protein purification of esterase PestE and its mutants, in lane 1, a Marker for the molecular weight of the standard protein, in lane 2, purified PestE-WT, and in lane 3, purified mutant PestE-L89R.
Detailed Description
The practice of the present invention is described in more detail below by way of examples. In the examples, reference is made to conventional techniques for process parameters not specifically noted. The protein sequence number of the esterase used in the invention is published by a protein database (http:// www.rcsb.org/pdb/home. do): esterase from Pyrobaculum Calidiformis (PestE, PDB ID:3 ZWQ).
Example 1
1.1 construction of esterase PestE wild type and its mutants: according to the gene sequence of Genbank esterase PestE accession number AB078331.1 and an expression vector pET-23a, the Genbank esterase PestE accession number is consigned to Shanghai biological engineering Co., Ltd to synthesize the pET-23a-PestE plasmid. After gene synthesis, primers L89R-F:5'-TGGAGGTGGATTCGTACGTGGTTCTGTGGAAACTC-3' and L89R-R:5'-GAGTTTCCACAGAACCACGTACGAATCCACCTCCA-3' are used for amplification to obtain a mutant, and after gene sequencing is correct, the mutant is subjected to next step mutation. For example, primers F20A-F:5'GCTGCACAATTGCAGGCTAGACCAGATATGG3', F20A-R:5'CCATATCTGGTCTAGCCTGCAATTGTGCAGC3' are used as mutants introduced in the next step, another mutant is obtained by amplification on the basis of obtaining the mutant L89R, and the result is identified as a double-mutant plasmid through gene sequencing. A large number of mutants are designed near the catalytic activity center by the method, a large number of sequences are carried out, and the mutants which may influence the catalytic efficiency are subjected to next cloning and expression after the sequences are sequenced.
1.2 esterase PestE wild type and mutant expression and recombinant protein purification: the heat-resistant esterase PestE wild type and the mutant thereof are self-induced and expressed in host escherichia coli BL21, and the self-induction experiment process is as follows:
(1) the clone-positive plasmid was added to E.coli BL21 competence and mixed with it, and placed on an ice bath.
(2) The mixture was placed in an ice bath for 30min, and then heated at 42 ℃ for 90s and placed in an ice bath for 5 min.
(3) Adding LB culture medium with ampicillin, culturing at 37 deg.C and 200rpm for a certain time, inoculating the culture into self-induction culture medium, culturing at 37 deg.C until OD600 reaches logarithmic phase, and culturing for 12h to collect the strain.
(4) Preparing the collected thallus into a suspension by using PBS buffer solution, breaking the wall by using an ultrasonic instrument, centrifuging the well-broken suspension at 12000rpm for 15min, and collecting the supernatant.
(5) The purification process was as follows: the Ni column was equilibrated with 3 volumes of PBS buffer, the crude enzyme solution was loaded, the purification system was equilibrated with PBS buffer, and after equilibration, the impure proteins were eluted with 20mM imidazole in PBS buffer. Then eluting with an eluent buffer (500mM imidazole and 500mM NaCl pH7.4 phosphate buffer), and collecting the elution peak, namely the purified enzyme.
(6) And (3) detecting the purity of the recombinant protein by SDS-PAGE electrophoresis, wherein the purity of the purified enzyme protein is more than 90%. (see FIG. 1)
1.3 enzyme activity mechanical detection of the PestE enzyme mutant: in order to screen out the high-enzyme-activity mutant, enzyme activity dynamics detection is carried out by adopting a method for detecting the peroxidase activity of the mutant by an enzyme-labeling instrument, and the specific process is as follows:
(1) 0.1M valeric acid was adjusted to different pH values (3.5,4.0,4.5,5.0,5.5,6.0,6.5) with NaOH. To the above 10ml of valeric acid was added 100. mu.L of 100X 0.18mM ethylchloro-5, 5-diethyl-1, 3-cyclohexanedione, and 90mM NaBr.
(2) Enzyme activity measurement system: adding 100 μ L acid solution and 10 μ L LH in sequence into 96-well plate2O2(30% w/w) and 10. mu.L of the enzyme solution, and the OD290nm absorbance was measured.
(3) According to the Mie constant analysis, the catalytic constants of the mutants obtained by respectively taking valeric acid and hydrogen peroxide as double substrates are respectively 23.08s-1And 29.01s-16 times and 3 times respectively compared with the wild type. Comparison of catalytic constants for wild-type PestE enzyme and mutant is shown in table 1.
TABLE 1 comparison of catalytic constants of wild-type PestE and mutants
Example 2
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of esterase of which the mutant is L89R and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24h in a constant-temperature magnetic stirrer at 50 ℃ at the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase to obtain the epoxidized soybean oil. The acid value was found to be 0.15mgKOH/g, and the epoxy value was found to be 6.1. The content of the epoxidized fatty acid triglyceride in the product was 80.6% and the content of the epoxidized fatty acid diglyceride and monoester was 1.5% by liquid chromatography-mass spectrometry.
Example 3
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of esterase with a mutant of L89R/L40A (consisting of double mutation sites) and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24 hours in a constant-temperature magnetic stirrer at the temperature of 50 ℃ and at the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase to obtain the epoxidized soybean oil. The acid value was found to be 0.15mgKOH/g, and the epoxy value was found to be 7.2. The content of the epoxy fatty acid triglyceride in the product is 95% and the content of the epoxy fatty acid diglyceride and monoester in the product is 1.0% by liquid chromatography-mass spectrometry.
Example 4
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of esterase with a mutant of L89R/L40A/L213A (consisting of three mutation sites) and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24 hours in a constant-temperature magnetic stirrer at the temperature of 50 ℃ and the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase to obtain the epoxidized soybean oil. The acid value was found to be 0.15mgKOH/g, and the epoxy value was found to be 5.5. The content of the epoxidized fatty acid triglyceride in the product was 70.3% and the content of the epoxidized fatty acid diglyceride and monoester was 1.7% by liquid chromatography-mass spectrometry.
Example 5
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of esterase with a mutant of L89R/F20A/F33A (consisting of three mutation sites) and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24h in a constant-temperature magnetic stirrer at the temperature of 50 ℃ and the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase to obtain the epoxidized soybean oil. The acid value was found to be 0.15mgKOH/g, and the epoxy value was found to be 6.5. The content of the epoxidized fatty acid triglyceride in the product was 83.6% and the content of the epoxidized fatty acid diglyceride and monoester in the product was 1.6% by liquid chromatography-mass spectrometry.
Example 6
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of esterase with a mutant of L89R/L40A/F289A (consisting of three mutation sites) and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24h in a constant-temperature magnetic stirrer at the temperature of 50 ℃ and the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase to obtain the epoxidized soybean oil. The acid value was found to be 0.15mgKOH/g, and the epoxy value was found to be 5.8. The content of the epoxidized fatty acid triglyceride in the product was 74.7% and the content of the epoxidized fatty acid diglyceride and monoester was 1.0% by liquid chromatography-mass spectrometry.
Comparative example 1
100g of soybean oil, 40g of hydrogen peroxide (containing 30 percent of hydrogen peroxide), 1g of wild-type PestE esterase and 10g of ethyl acetate are added into a reaction vessel, and epoxidation reaction is carried out for 24h in a constant-temperature magnetic stirrer at 50 ℃ at the stirring speed of 600 rpm. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase, thereby obtaining the epoxy fatty acid methyl ester. The acid value was found to be 0.32mgKOH/g, and the epoxy value was found to be 5.2. The liquid chromatography analysis of the product shows that the epoxy fatty acid glyceride composition is 66.2% of epoxy fatty acid triglyceride, the content of epoxy fatty acid diglyceride is 1.2%, and the content of epoxy fatty acid monoester is 0.2%.
Comparative example 2
100g of methyl soyate, 40g of hydrogen peroxide (containing 30% hydrogen peroxide), 1g of Lipase CALB (available from Novixin), and 10g of ethyl acetate were charged into a reaction vessel, and epoxidation was carried out in a 50 ℃ constant temperature magnetic stirrer at a stirring speed of 600rpm for 24 hours. After the reaction, the reaction mixture was allowed to stand for 5min for layering, and the upper organic phase was recovered. And distilling under reduced pressure to recover ethyl acetate in the organic phase, thereby obtaining the epoxy fatty acid methyl ester. The acid value was found to be 8.98mgKOH/g, and the epoxy value was found to be 7.1. The liquid chromatography analysis of the product shows that the epoxy fatty acid glyceride composition contains 60.4% of epoxy fatty acid triglyceride, 20.4% of epoxy fatty acid diglyceride and 12.3% of epoxy fatty acid monoester.
Due to the degeneracy of amino acids, the nucleotide sequence capable of encoding the mutant is within the protection scope of the present invention. It is understood by those skilled in the art that, on the basis of the six mutation sites, it is within the scope of the present invention to obtain mutants by mutation at other sites without affecting the function of the mutants.
SEQUENCE LISTING
<110> university of southern China's science
<120> heat-resistant esterase mutant and preparation method and application thereof
<130>1
<160>19
<170>PatentIn version 3.5
<210>1
<211>939
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>1
atgcctctgt caccaatcct gagacaaatc ctgcaacaac tggctgcaca attgcagttt 60
agaccagata tggatgtaaa gacggtgaga gagcagttcg agaagtcaag tcttatcctg 120
gtgaagatgg caaacgagcc tatccataga gtggaagaca tcacaattcc aggaagaggt 180
ggacctatta gagcaagagt gtacagacca agagacggag aaagattgcc tgcagttgta 240
tactaccatg gaggtggatt cgtacttggt tctgtggaaa ctcatgacca cgtttgtaga 300
cgacttgcta acttgtccgg agctgttgtt gtatctgttg actacaggct agcaccagaa 360
cacaaattcc cagctgctgt tgaagatgca tacgatgctg ccaaatgggt agctgataat 420
tacgacaaat tgggtgttga caacggtaaa attgccgtcg caggtgactc agcaggtggt 480
aacttagcag ctgttacagc tattatggct cgtgatcgtg gagaatcatt tgtcaagtac 540
caggtgctaa tatatcccgc tgttaacttg accggttctc caactgtttc ccgtgttgaa 600
tattccggac ctgaatacgt tattcttact gccgatctaa tggcctggtt tggtaggcag 660
tatttctcca aacctcaaga tgctttgtct ccctatgcca gtcctatatt tgctgacttg 720
tctaatcttc cccctgcctt ggtcattacc gctgagtatg atccattaag ggatgagggc 780
gagttatatg cccacttgtt aaagactagg ggcgttcgag ctgtcgctgt tcgttataat 840
ggggtcattc atggctttgt caatttctat ccaatattag aggaagggcg agaagccgtc 900
agtcaaattg ctgctagtat taagtctatg gccgtcgcc 939
<210>2
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>2
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Phe Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Phe Glu Lys Ser Ser Leu Ile Leu Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 75 80
Tyr Tyr His Gly Gly Gly Phe Val Leu Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
Asn Leu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Leu Met Ala Trp Phe Gly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235 240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Phe Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>3
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>3
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Phe Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Phe Glu Lys Ser Ser Leu Ile Leu Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 75 80
Tyr Tyr His Gly Gly Gly Phe Val Arg Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
Asn Leu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Leu Met Ala Trp Phe Gly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235 240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Phe Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>4
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>4
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Phe Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Phe Glu Lys Ser Ser Leu Ile Ala Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 7580
Tyr Tyr His Gly Gly Gly Phe Val Arg Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
Asn Leu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Leu Met Ala Trp Phe Gly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Phe Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>5
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>5
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Ala Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Phe Glu Lys Ser Ser Leu Ile Leu Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 75 80
Tyr Tyr His Gly Gly Gly Phe Val Arg Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
Asn Leu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Ala Met Ala Trp PheGly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235 240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Phe Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>6
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>6
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Ala Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Ala Glu Lys Ser Ser Leu Ile Leu Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 75 80
Tyr Tyr His Gly Gly Gly Phe Val Arg Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
Asn Leu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Leu Met Ala Trp Phe Gly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235 240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Phe Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>7
<211>313
<212>PRT
<213>Artificial Sequence
<220>
<223>1
<400>7
Met Pro Leu Ser Pro Ile Leu Arg Gln Ile Leu Gln Gln Leu Ala Ala
1 5 10 15
Gln Leu Gln Phe Arg Pro Asp Met Asp Val Lys Thr Val Arg Glu Gln
20 25 30
Phe Glu Lys Ser Ser Leu Ile Ala Val Lys Met Ala Asn Glu Pro Ile
35 40 45
His Arg Val Glu Asp Ile Thr Ile Pro Gly Arg Gly Gly Pro Ile Arg
50 55 60
Ala Arg Val Tyr Arg Pro Arg Asp Gly Glu Arg Leu Pro Ala Val Val
65 70 75 80
Tyr Tyr His Gly Gly Gly Phe Val Arg Gly Ser Val Glu Thr His Asp
85 90 95
His Val Cys Arg Arg Leu Ala Asn Leu Ser Gly Ala Val Val Val Ser
100 105 110
Val Asp Tyr Arg Leu Ala Pro Glu His Lys Phe Pro Ala Ala Val Glu
115 120 125
Asp Ala Tyr Asp Ala Ala Lys Trp Val Ala Asp Asn Tyr Asp Lys Leu
130 135 140
Gly Val Asp Asn Gly Lys Ile Ala Val Ala Gly Asp Ser Ala Gly Gly
145 150 155 160
AsnLeu Ala Ala Val Thr Ala Ile Met Ala Arg Asp Arg Gly Glu Ser
165 170 175
Phe Val Lys Tyr Gln Val Leu Ile Tyr Pro Ala Val Asn Leu Thr Gly
180 185 190
Ser Pro Thr Val Ser Arg Val Glu Tyr Ser Gly Pro Glu Tyr Val Ile
195 200 205
Leu Thr Ala Asp Leu Met Ala Trp Phe Gly Arg Gln Tyr Phe Ser Lys
210 215 220
Pro Gln Asp Ala Leu Ser Pro Tyr Ala Ser Pro Ile Phe Ala Asp Leu
225 230 235 240
Ser Asn Leu Pro Pro Ala Leu Val Ile Thr Ala Glu Tyr Asp Pro Leu
245 250 255
Arg Asp Glu Gly Glu Leu Tyr Ala His Leu Leu Lys Thr Arg Gly Val
260 265 270
Arg Ala Val Ala Val Arg Tyr Asn Gly Val Ile His Gly Phe Val Asn
275 280 285
Ala Tyr Pro Ile Leu Glu Glu Gly Arg Glu Ala Val Ser Gln Ile Ala
290 295 300
Ala Ser Ile Lys Ser Met Ala Val Ala
305 310
<210>8
<211>35
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>8
tggaggtgga ttcgtacgtg gttctgtgga aactc 35
<210>9
<211>35
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>9
gagtttccac agaaccacgt acgaatccac ctcca 35
<210>10
<211>35
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>10
gaagtcaagt cttatcgcgg tgaagatggc aaacg 35
<210>11
<211>35
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>11
cgtttgccat cttcaccgcg ataagacttg acttc 35
<210>12
<211>31
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>12
gctgcacaat tgcaggctag accagatatg g 31
<210>13
<211>31
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>13
ccatatctgg tctagcctgc aattgtgcag c 31
<210>14
<211>29
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>14
ggtgagagag caggccgaga agtcaagtc 29
<210>15
<211>29
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>15
gacttgactt ctcggcctgc tctctcacc 29
<210>16
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>16
gttattctta ctgccgatgc aatggcctgg tttggtag 38
<210>17
<211>38
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>17
ctaccaaacc aggccattgc atcggcagta agaataac 38
<210>18
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>18
gtcattcatg gctttgtcaa tgcctatcca atattagagg aagg 44
<210>19
<211>44
<212>DNA
<213>Artificial Sequence
<220>
<223>1
<400>19
ccttcctcta atattggata ggcattgaca aagccatgaa tgac 44
Claims (7)
1. A heat-resistant esterase mutant is characterized in that the mutant is obtained by mutating a wild-type heat-resistant esterase from Pyrobaculylidifentasis, the amino acid sequence of the wild-type heat-resistant esterase is SEQ ID NO.2, and the amino acid sequence of the mutant is SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO. 7.
2. The method for preparing the mutant according to claim 1, comprising the steps of:
(1) the plasmid is synthesized by expression vector pET-23a and PestE esterase wild type gene sequence;
(2) then, a primer is designed by utilizing a site-directed mutagenesis method, and a target amino acid mutation site is introduced by utilizing a PCR method so as to obtain a corresponding mutant.
3. The method for preparing the mutant according to claim 2, wherein the PCR primer sequence is as follows:
L89R-F:5'-TGGAGGTGGATTCGTACGTGGTTCTGTGGAAACTC-3'
L89R-R:5'-GAGTTTCCACAGAACCACGTACGAATCCACCTCCA-3'
L40A-F:5'-GAAGTCAAGTCTTATCGCGGTGAAGATGGCAAACG-3'
L40A-R:5'-CGTTTGCCATCTTCACCGCGATAAGACTTGACTTC-3'
F20A-F:5'GCTGCACAATTGCAGGCTAGACCAGATATGG3'
F20A-R:5'CCATATCTGGTCTAGCCTGCAATTGTGCAGC3'
F33A-F:5'GGTGAGAGAGCAGGCCGAGAAGTCAAGTC3'
F33A-R:5'GACTTGACTTCTCGGCCTGCTCTCTCACC3'
L213A-F:5'GTTATTCTTACTGCCGATGCAATGGCCTGGTTTGGTAG3'
L213A-R:5'CTACCAAACCAGGCCATTGCATCGGCAGTAAGAATAAC3'
F289A-F:5'GTCATTCATGGCTTTGTCAATGCCTATCCAATATTAGAGGAAGG3'
F289A-R:5'CCTTCCTCTAATATTGGATAGGCATTGACAAAGCCATGAATGAC3'
4. a recombinant plasmid prepared using the mutant of claim 1.
5. A recombinant strain obtained by transferring the plasmid prepared according to claim 4 into a host cell.
6. The recombinant strain of claim 5, wherein the host cell is Escherichia coli BL 21.
7. Use of a thermotolerant esterase mutant according to claim 1 for the preparation of a glycerol epoxide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611100418.5A CN106754818B (en) | 2016-12-02 | 2016-12-02 | Heat-resistant esterase mutant and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611100418.5A CN106754818B (en) | 2016-12-02 | 2016-12-02 | Heat-resistant esterase mutant and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754818A CN106754818A (en) | 2017-05-31 |
| CN106754818B true CN106754818B (en) | 2020-04-28 |
Family
ID=58884692
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611100418.5A Active CN106754818B (en) | 2016-12-02 | 2016-12-02 | Heat-resistant esterase mutant and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754818B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112020011881A2 (en) * | 2017-12-13 | 2020-11-24 | Glaxosmithkline Intellectual Property Development Limited | carboxyesterase biocatalysts |
| CN112662644B (en) * | 2021-01-19 | 2022-04-22 | 华南理工大学 | Diglycerol phosphate phosphodiesterase mutant and application thereof |
| CN112430585B (en) * | 2021-01-27 | 2021-04-27 | 凯莱英生命科学技术(天津)有限公司 | Esterase mutant and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567758A (en) * | 2016-01-12 | 2016-05-11 | 华南理工大学 | Method for preparing epoxy fatty acid methyl ester |
-
2016
- 2016-12-02 CN CN201611100418.5A patent/CN106754818B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567758A (en) * | 2016-01-12 | 2016-05-11 | 华南理工大学 | Method for preparing epoxy fatty acid methyl ester |
Non-Patent Citations (2)
| Title |
|---|
| PDB: 2YH2_A;无;《NCBI》;20110518;第1-3页 * |
| The crystal structure of an esterase from the hyperthermophilic microorganism Pyrobaculum calidifontis VA1 explains its enantioselectivity;Gottfried J et al.;《Appl Microbiol Biotechnol》;20111123;第91卷;第1061-1072页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754818A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108642026B (en) | Partial glyceride lipase mutant and application thereof | |
| CN109652392B (en) | Feruloyl esterase and preparation method and application thereof | |
| CN109402087B (en) | Novel feruloyl esterase and preparation method and application thereof | |
| CN106754818B (en) | Heat-resistant esterase mutant and preparation method and application thereof | |
| CN109576244B (en) | Novel lipase, preparation and application thereof | |
| CN109182298B (en) | Recombinant lipase mutant, engineering bacterium and application | |
| CN108285895B (en) | Esterase EstC11, and coding gene and application thereof | |
| CN113637654B (en) | Recombinant phospholipase D mutant and application thereof in synthesis of phosphatidylserine | |
| CN104293744B (en) | Talaromyces thermophilus derived lipase mutant and application thereof | |
| CN106244569B (en) | Esterase EstC10, and coding gene and application thereof | |
| CN105296513B (en) | A kind of ocean esterase and its encoding gene E22 and application | |
| CN112175919A (en) | Lactone hydrolase mutant and application thereof | |
| CN103805617B (en) | 1,3- specific lipases, its coding gene sequence and application thereof | |
| CN111139229A (en) | Novel GDSL family lipid hydrolase EII-2 and coding gene and application thereof | |
| CN108359655B (en) | Lipase mutant TDL-mut with high thermal stability and coding gene thereof | |
| CN110358751A (en) | A kind of recombinant lipase mutant, encoding gene, recombination engineering and application | |
| WO2012146937A1 (en) | Lipase variants of ustilaginaceae | |
| KR101460228B1 (en) | Mutant lipase with advanced activity and process for production bio-diesel using the same | |
| KR20200013439A (en) | A mutant lipase having enhanced transesterification activity and its application for biodiesel production | |
| CN110468117B (en) | Organic solvent tolerant lipase mutant and application thereof | |
| CN108330114B (en) | EPA-utilizing diacylglycerol acyltransferase and application thereof | |
| CN111019921B (en) | High-tolerance lipid hydrolase E93 and encoding gene and application thereof | |
| CN113736762A (en) | alpha-L-rhamnosidase mutant and application thereof in preparation of praonine | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN109402085B (en) | Recombinant strains, methods for synthesizing simvastatin, and related enzymes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |