CN105561301B

CN105561301B - Application of clonorchis sinensis secreted phospholipase A2 protein in preparing tumor treatment medicine

Info

Publication number: CN105561301B
Application number: CN201610039906.3A
Authority: CN
Inventors: 李学荣; 吴银娟; 余新炳
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2016-01-21
Filing date: 2016-01-21
Publication date: 2020-04-10
Anticipated expiration: 2036-01-21
Also published as: CN105561301A

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of clonorchis sinensis secreted phospholipase A2 protein in preparation of a tumor treatment drug. The invention, after extensive and intensive research, discovers the clonorchis sinensis secreted phospholipase A2 protein for the first timeCssPLA2 protein) has obvious inhibiting effect on the growth of human bile duct cancer FRH cells (hepatic portal cholangiocarcinoma), and the inhibiting rate is as high as over 86%. That is, the present invention has found for the first timeCsNew application of sPLA2 protein in preparation of medicine for treating bile duct cancer.

Description

Application of clonorchis sinensis secreted phospholipase A2 protein in preparing tumor treatment medicine

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of clonorchis sinensis secreted phospholipase A2 protein in preparation of a tumor treatment drug.

Background

The prior expression technology aiming at the clonorchis sinensis secreted phospholipase A2 protein (namely, CsPLA 2 protein, GenBank accession number: ABL07371.1) can only express the clonorchis sinensis secreted phospholipase A2 protein without biological activity in the form of inclusion body, and the expressed clonorchis sinensis secreted phospholipase A2 protein has no biological activity and can not be used for the function research of the protein. Even after complex protein renaturation technical treatment, the biological activity of the obtained protein is still rather low.

For example: in the prior document F.Hu et al/Molecular & Biochemical Parasitology 167(2009) 127-134, a plasmid with the CDS 4e05 sequence number of the clonorchis sinensis cDNA library is used as a template, and a designed specific primer is applied to perform PCR amplification on a target gene. The target gene and prokaryotic expression plasmid pET-28a are subjected to enzyme digestion, recovery, connection and transformation to construct recombinant plasmid pET-28 a-CsPLA 2. the constructed recombinant plasmid is transformed into BL21(DE3) competent cells, after the CsPLA 2 recombinant engineering bacteria liquid is subjected to mass culture and IPTG induction expression, the recombinant protein is expressed in the form of inclusion body, and 12% SDS-PAGE electrophoresis shows that an obvious band appears at the position with the molecular weight of about 34 kDa. Because the recombinant protein is expressed in the form of an inclusion body, the inclusion body obtained by bacteria breaking is subjected to 6M urea denaturation, dilution and dialysis renaturation, passes through a metal ion affinity chromatography column, is subjected to gradient rinsing on imidazole with different low concentrations, and is eluted by 200mmol/L imidazole, so that the single protein with the molecular weight of about 34kDa is obtained. MTT method and flow cytometry detect that CsPLA 2 protein stimulates proliferation of human hepatic stellate cell LX-2, and semi-quantitative RT-PCR detects that CsPLA 2 protein can promote the mRNA expression of human hepatic stellate cell LX-2 III type collagen to be up-regulated, thereby causing hepatic fibrosis.

To date, no report on the realization of the clonorchis sinensis secreted phospholipase A2 protein (CsPLA 2 protein) in the tumor treatment field is found in the prior art.

Disclosure of Invention

In order to overcome the problems in the prior art, the invention aims to provide the application of the clonorchis sinensis secreted phospholipase A2 protein (namely, CsPLA 2 protein) in preparing a tumor treatment drug.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

in a first aspect of the invention, the application of the CsPLA 2 protein in preparing a medicament for treating tumors is provided.

CssPLA2 protein, GenBank accession No.: ABL 07371.1.

Preferably, the CsPLA 2 protein is used as an effective component in the preparation of tumor treatment medicines.

Preferably, the tumor is selected from cholangiocarcinoma.

Further preferably, the tumor is selected from the group consisting of a carcinoma of the biliary tract of the hepatic region.

Preferably, the CssPLA2 protein is a recombinant CssPLA2 protein.

Further preferably, the recombinant CssPLA2 protein comprises a CssPLA2 protein and an MBP tag protein.

Preferably, the amino acid sequence of the CsPLA 2 protein is shown in SEQ ID NO.1, and specifically comprises the following steps:

KPRSISRDKPHAELEWSGKLSDNQTIHIWTVASKGLFGEISKPAWIQVDIRGSNSSQDAIRLIFDQEHRLRYCVFGTDTVETSVSLDDADLLTRNPIYLEHFFFTSANEFLRACKELRRASEEPAKLVRRPRTAYRANPMIMPGTLWCGKGNAATRERTFGDEIETDMCCRTHDRCFENIQSLTSKFGYYNPSPVTISNCECDDEFLSCLENAGTEAATRVGNLYFNVFKIPCFLRRTERICTHNDESGACGQFENREDIELFRPQRFVAPYITV。

preferably, the amino acid sequence of the MBP tag protein is the amino acid sequence corresponding to the MBP tag protein coding sequence on the pMAL-c2X plasmid.

Preferably, the N-terminus of the CsPLA 2 protein is linked to the C-terminus of the MBP tag protein.

Preferably, the CsPLA 2 protein and the MBP tag protein are connected through a connecting peptide.

Further preferably, the amino acid sequence of the linker peptide is the amino acid sequence corresponding to the nucleotide sequence after the MBP tag protein coding sequence and before the Xba1 cleavage site on the pMAL-c2x plasmid.

In a second aspect of the invention, a pharmaceutical formulation for tumor therapy is provided, which comprises the CssPLA2 protein and a pharmaceutically acceptable carrier.

A "pharmaceutically acceptable" component is one that is suitable for use in humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio. A "pharmaceutically acceptable carrier" is a pharmaceutically or comestibly acceptable solvent, suspending agent or excipient for delivering the CssPLA2 protein of the invention to an animal or human. The carrier may be a liquid or a solid.

Pharmaceutically acceptable carriers are various pharmaceutically commonly used adjuvants and/or excipients, including, but not limited to, sugars (such as lactose, glucose and sucrose), starches (such as corn starch and potato starch), cellulose and its derivatives (such as sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose), tragacanth powder, malt, gelatin, talc, solid lubricants (such as stearic acid and magnesium stearate), calcium sulfate, vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter, polyols (such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol), alginic acid, emulsifiers (such as Tween, polyoxyethylene castor oil), wetting agents (such as sodium lauryl sulfate), coloring agents, flavoring agents, tableting agents, stabilizers, antioxidants, preservatives, pyrogen-free water, isotonic saline solutions, phosphate buffers and the like; the carrier can improve the stability, activity, bioavailability and the like of the formula according to needs.

When the medicinal preparation is used, the CsPLA 2 protein serving as the only active ingredient or the CsPLA 2 protein serving as one of the active ingredients can be mixed with one or more pharmaceutically acceptable carriers or excipients to prepare medicinal dosage forms with different administration routes.

Preferably, the pharmaceutical preparation is in the form of a tablet, capsule, powder, granule, syrup, solution, oral liquid, spirit, tincture, aerosol, powder cloud, injection, sterile powder for injection, or suppository. The above formulation types can be understood in terms of the relevant definitions in pharmacy (sixth edition, people health Press, Toruford), and the preparation of the above formulations can be formulated in terms of the relevant formulations in pharmacy (sixth edition, people health Press, Toford).

Preferably, the pharmaceutical composition is in the form of a tablet or an oral liquid.

Preferably, the pharmaceutical preparation of the present invention can be administered by oral, intravenous, intramuscular or subcutaneous routes.

Preferably, the pharmaceutical preparation of the present invention is manufactured by filter sterilization with a filter membrane, or by autoclaving.

In a third aspect of the present invention, there is provided a method of treating cholangiocarcinoma, comprising the steps of: a pharmaceutical formulation for tumor therapy comprising CssPLA2 protein is administered to a patient.

The dosage administered may be determined by a physician, depending on the condition.

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers for the first time that the clonorchis sinensis secretory phospholipase A2 protein (CsPLA 2 protein) has obvious inhibition effect on the growth of bile duct cancer cells through extensive and intensive research, and the inhibition rate is as high as over 86%. Namely, the invention discovers the new application of the CsPLA 2 protein in the preparation of the medicine for treating the bile duct cancer for the first time.

Drawings

FIG. 1: agarose gel electrophoresis identification of the PCR product of the CsPLA 2 target gene, wherein M: DNA standard molecular weight; 1: ddH2O negative control; 2: CsPLA 2 target gene PCR product.

FIG. 2: the double restriction enzyme identification map of the recombinant plasmid pMAL-c 2X/CsPLA 2, M1, M2: DNA standard molecular weight; 1: the empty plasmid XbaI and HindIII are subjected to double digestion; 2: the recombinant plasmid XbaI and HindIII are subjected to double enzyme digestion; 3: CsPLA 2 target gene PCR product.

FIG. 3: 12% SDS-PAGE analysis of the expression product of the recombinant plasmid pMAL-c 2X/CsPLA 2 in Escherichia coli BL21/DE3, M: protein standard molecular weight; 1: before induction of the recombinant plasmid pMAL-c 2X/CsPLA 2 IPTG; 2: the supernatant after the induction of the recombinant plasmid pMAL-c 2X/CsPLA 2 IPTG; 3: precipitation after induction of the recombinant plasmid pMAL-c 2X/CsPLA 2 IPTG; 4: recombinant CssPLA2 protein after resin affinity purification.

FIG. 4: anion exchange chromatography purified recombinant CssPLA2 protein (i.e., MBP-CssPLA2 fusion protein).

FIG. 5: the purity of the purified recombinant CssPLA2 protein was analyzed by 12% SDS-PAGE.

FIG. 6: western blotting identified the recombinant CsPLA 2 protein.

FIG. 7: mass Spectrometry (Mass Spectrum) identified recombinant CsPLA 2 protein.

FIG. 8: the recombinant CsPLA 2 protease activity determination diagram shows that the enzyme activity detection kit of sPLA2 (secretory phospholipase A2) detects that the recombinant CsPLA 2 protein (MBP-CsPLA 2 fusion protein) obtained in example 1 has enzyme activity.

FIG. 9: effect of temperature on recombinant CssPLA2 protease activity.

FIG. 10: effect of enzyme concentration on recombinant CssPLA2 protease activity.

FIG. 11: effect of substrate concentration on recombinant CssPLA2 protease activity.

FIG. 12: CCK8 detects the growth inhibition effect of MBP-CsPLA 2 on human bile duct cancer FRH cells; ESP (clonorchis sinensis secretory excretory protein), MBP protein (maltose binding protein as a control), recombinant CsPLA 2 protein and PBS (negative control group) are respectively used for incubating bile duct cancer FRH cells, and after 24 hours (A), 48 hours (B) and 72 hours (C), CCK8 reagents are respectively used for detecting the absorbance of the cells at 450 nm; as can be seen, after 72 hours, 25ug/ml of MBP-CsPLA 2 obviously inhibited the growth of FRH cells of human cholangiocarcinoma, and the inhibition rate is about more than 86%.

FIG. 13: among them, fig. 13A: 25ug/ml ESP (Clonorchis sinensis secreted excretory proteins), FIG. 13B: 25ug/ml MBP protein (maltose binding protein, as control), fig. 13C: 25ug/ml recombinant CssPLA2 protein, fig. 13D: pro-apoptotic agents (positive control), fig. 13E: PBS (negative control) incubates human bile duct cancer FRH cells respectively, and detecting apoptosis by flow cytometry after 72 hours; the apoptosis percentage of FRH cells at early stage and late stage is increased from 13.4% (PBS group), 26.1% (MBP group) to 44.4% (MBP-CsPLA 2 group), which indicates that MBP-CsPLA 2 promotes the apoptosis of FRH cells of human cholangiocarcinoma.

Detailed Description

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts. These techniques are well described in the literature, and may be found in particular in the study of the MOLECULAR CLONING, Sambrook et al: a LABORATORY MANUAL, Second edition, Cold Spring harbor LABORATORY Press, 1989and Third edition, 2001; ausubel et al, Current PROTOCOLS Inmolecular BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; wolffe, CHROMATINSTRUCUTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; (iii) Methods Inenzymolygy, Vol.304, Chromatin (P.M. Wassarman and A.P.Wolffe, eds.), academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol.119, chromatography protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999, etc.

EXAMPLE 1 clonal expression of recombinant CsPLA 2 protein (i.e., MBP-CsPLA 2 fusion protein)

1.1 using clone plasmid (serial number is Cs4e05) of CsPLA 2 gene in clonorchis sinensis cDNA library as Template (Template), using designed specific primer to proceed PCR amplification of target gene:

CssPLA2 upstream primer (P1): 5' -CTAGTCTAGAAAACCACGGTCAATTTCA-3' (SEQ ID NO.2) is underlined as XbaI cleavage site);

CssPLA2 downstream primer (P2): 5' -GGGAAGCTTGCTCATACAGTAATGTACG-3' (SEQ ID NO.3) is underlined as HindIII cleavage site).

By Ex Taq^TMCarrying out PCR amplification by using the enzyme under the following reaction conditions:

pre-denaturation at 95 ℃ for 10min, and carrying out 30 cycles with reaction cycle parameters of 95 ℃ for 30s, 57 ℃ for 30s and 72 ℃ for 1 min; 10min at 72 ℃.

The PCR reaction system is as follows:

the amplification product of the target gene was identified by 1.0% agarose gel electrophoresis:

(1) weighing 0.6g of agar sugar powder, dissolving in 1 × TAE 60ml solution, heating and boiling for 3-4min, cooling to about 50 deg.C, adding 2.5 μ l of EB substitute (10mg/ml) to final concentration of 0.5 μ g/ml, mixing, and encapsulating;

(2) electrophoresis: mixing a DNA sample (i.e., an amplification product of the target gene, about 5. mu.l) with 1. mu.l of 6 XLoadingBuffer, adding 5. mu.l of DL2000Marker to the well, and starting electrophoresis at 100V until the sample is brought to the position of 2/3 on the gel surface;

(3) the gel was removed and photographed under a gel imager.

As shown in FIG. 1, the obtained amplified product of the target gene has a molecular weight of 828bp, which is consistent with the expectation.

1.2 double digestion, recovery and purification of the target gene (CsPLA 2 gene) and plasmid pMAL-c2 x:

(1) inoculating DH5 α containing prokaryotic expression plasmid pMAL-c2x, extracting empty plasmid pMAL-c2x with a plasmid miniprep kit (operating according to kit instructions), identifying with 1.0% agarose gel electrophoresis, and confirming with expectations;

(2) performing 1.0% agarose gel electrophoresis on the target gene amplification product obtained in the step 1.1, cutting gel according to the molecular weight of the gene, recovering and purifying by using a DNA gel recovery kit (operating according to the kit specification), and performing 1.0% agarose gel electrophoresis identification on a small amount of recovered products to accord with the expectation;

(3) plasmid pMAL-c2x and the recovered and purified target gene amplification product were subjected to double digestion with XbaI and HindIII, respectively, in the following manner:

10×K Buffer	2.0μl
		PCR Produt/pMAL-c2Xvector	8.0μl
XbaI	1.0μl
		HindIII	1.0μl
dd H₂O	8.0μl
		Total volume	20.0μl

(4) and (3) uniformly mixing the double enzyme digestion systems, placing the mixture in water bath at 37 ℃ for reaction for 30min, performing agarose gel electrophoresis on reaction products respectively, cutting gels according to respective molecular weights, recovering and purifying the double enzyme digestion products by using a DNA gel recovery kit, and storing the double enzyme digestion products at-20 ℃ for later use.

1.3 ligation of the Gene of interest (CsPLA 2 Gene) and the expression vector pMAL-c2 x:

and (3) carrying out double enzyme digestion on the target gene recovered and purified in the step (1.2) and the pMAL-c2x double enzyme digestion product according to the volume ratio of 4: 1 mix and set up a 20. mu.l ligation:

T4DNA ligase Buffer	2.0μl
		Purified PCR Product	4.0μl
Purified pMAL-c2X vector	1.0μl
		T4DNA ligase(5U/μl)	1.0μl
dd H₂O	12.0μl
		Total volume	20.0μl

and (3) stirring and uniformly mixing the components of the connection reaction system (namely, uniformly mixing the components of the samples by adopting a small centrifuge), and reacting at room temperature for 1h to obtain a connection product.

1.4 transformation of the ligation product

(1) Add 10. mu.l of the ligation product obtained in 1.3 above to 200. mu.l of DH5 α/DE3 competent cells, mix gently and ice-wash for 30 min;

(2) then placing in a water bath at 42 ℃ for 90sec (the time needs to be strictly controlled and the shaking cannot be carried out);

(3) immediately taking out and placing on ice for 5 min;

(4) adding 800 μ l LB culture medium into EP tube in ultra clean bench, mixing, and sealing;

(5) slowly shaking at 37 ℃ and 150rpm for 1-1.5 h;

(6) centrifuging at 4 deg.C and 4,000rpm for 5min, and discarding 800. mu.l of supernatant;

(7) and (3) blowing the precipitate by using a pipette, uniformly mixing, then coating 200 mu l of bacterial suspension on an ampicillin-resistant solid agar culture plate, culturing in an incubator at 37 ℃, inverting the plate after the plate is dried, and continuously culturing for 14-16 h.

1.5 positive clone identification:

(1) picking the monoclonal colony growing on the culture plate, inoculating into 5ml LB culture medium containing 5 mul ampicillin, shaking at 37 deg.C and 250rpm overnight;

(2) using the bacterial liquid as a template, carrying out PCR amplification on the target gene by using the primers and the reaction conditions in the step 1.1, and carrying out identification by using 1.0% agarose gel electrophoresis;

(3) selecting positive bacteria liquid (containing target genes), extracting recombinant plasmids of the positive bacteria by using a plasmid small quantity extraction kit, carrying out enzyme digestion by using the double enzyme digestion system in the 1.2, and carrying out 1.0% agarose gel electrophoresis on enzyme digestion products to identify whether the recombination is successful. The results are shown in FIG. 2, which indicates that the recombinant plasmid pMAL-c 2X/CsPLA 2 was successfully recombined.

(4) Sequencing the successfully identified positive clones (completed by Guangzhou Egyi Biotechnology Co., Ltd.) to ensure the accuracy of the inserted fragments in the positive clone recombinant plasmids.

According to the sequencing result, the nucleotide sequence of the target gene is shown as SEQ ID NO.2, and specifically comprises the following steps:

AAACCACGGTCAATTTCAAGGGACAAGCCACATGCTGAATTGGAATGGAGTGGAAAGTTGTCAGACAATCAGACAATTCATATATGGACAGTAGCATCGAAAGGACTATTTGGAGAGATCTCGAAACCGGCTTGGATCCAGGTTGATATCCGAGGCTCAAATTCCAGTCAAGACGCCATTCGTCTGATATTCGATCAAGAGCATCGACTCCGTTATTGTGTGTTCGGTACAGACACTGTCGAAACATCAGTCAGTCTGGACGACGCGGATTTACTGACCAGAAATCCCATCTATCTGGAGCACTTTTTTTTCACGTCGGCCAATGAATTCCTTCGAGCGTGTAAAGAGCTCCGGAGGGCGTCAGAAGAGCCGGCCAAACTGGTCCGTCGTCCGAGAACTGCCTACCGGGCTAACCCGATGATAATGCCTGGCACACTATGGTGTGGCAAAGGTAATGCTGCCACGCGCGAACGAACATTTGGTGACGAAATCGAGACTGACATGTGCTGTCGAACTCATGACCGATGTTTTGAAAACATCCAGAGTCTGACGAGTAAATTCGGATACTACAATCCATCGCCAGTGACGATTTCAAATTGTGAATGCGACGATGAGTTCCTCAGCTGTCTTGAAAACGCAGGAACTGAAGCAGCCACTCGAGTTGGAAACCTGTACTTCAATGTATTCAAAATTCCGTGTTTCTTGCGGCGCACCGAACGCATTTGTACCCACAATGACGAAAGCGGAGCATGTGGACAATTTGAAAATAGAGAAGATATTGAACTGTTCCGCCCGCAACGTTTTGTTGCTCCGTACATTACTGTATGA are provided. Fully indicates that the inserted fragment in the positive cloning recombinant plasmid is complete and correct.

1.6 inducible expression of the recombinant plasmid in E.coli BL21/DE 3:

(1) transforming escherichia coli BL21(DE3) competent cells into recombinant plasmids pMAL-c 2X/CsPLA 2 which are verified to be correct through sequencing and comparison, coating the competent cells on an ampicillin-resistant agar culture plate, placing the culture plate in an incubator at 37 ℃ for culture, inverting the plate after the plate is dried, and continuing to culture for 14-16 hours; selecting a monoclonal, inoculating the monoclonal into 5ml of LB liquid medium, performing shake culture at 37 ℃ and 250rpm, and then performing bacterial liquid PCR and double enzyme digestion identification;

(2) inoculating the recombinant and empty plasmid pMAL-c2x which are verified to be correct into 5ml of LB culture medium with ampicillin resistance respectively, shaking and culturing at 37 ℃ and 250rpm overnight;

(3) the following day is as follows: 100 (volume of bacteria liquid: volume of culture medium), inoculating the overnight thermophilic bacteria into LB culture medium, culturing at 37 ℃ and 250rpm with shaking until OD600 is 0.5-0.6;

(4) 1ml of bacterial liquid is taken as a control of non-induced expression; respectively adding IPTG with final concentration of 0.3mmol/L, and performing induced culture at 37 deg.C and 250rpm for 4 h; 1ml of bacterial liquid is taken as a sample after induction expression;

(5) centrifuging control and sample, collecting a little precipitate, adding 5 μ l DTT and 95 μ l 1 xSDS, mixing, stirring, and boiling for 5-10 min;

(6) centrifugation was carried out at 13,000rpm for 1min, and 10. mu.l of the supernatant was aspirated for SDS-PAGE (12%);

(7) and (3) dyeing the gel at room temperature for 30min by using Coomassie brilliant blue R250, boiling and decoloring, and observing whether the recombinant CsPLA 2 protein is expressed or not.

1.7 Mass expression and purification of recombinant CsPLA 2 protein (i.e., MBP-CsPLA 2 fusion protein)

First, mass expression of recombinant CssPLA2 protein was performed:

(1) the recombinant was inoculated into 5ml of ampicillin-resistant LB medium, shaken at 37 ℃ and 250rpm overnight;

(2) the following day was counted from overnight at 1: transferring the culture medium into an LB culture medium according to the volume ratio of 100, and culturing the culture medium at 37 ℃ and under the condition of shaking at 250rpm until the OD600 is 0.5-0.6; respectively adding IPTG with the final concentration of 0.3mmol/L, and carrying out induced expression for 4h at 37 ℃ and 250 rpm;

(3) centrifuging the bacterial solution at 4 deg.C and 8,000rpm for 15min to collect thallus;

(4) resuspending the cells, as 1: 20 volume ratio (20mM Tris 7.4: medium) 1 Xbinding buffer (20mM Tris 7.4);

(5) the thallus suspension is placed on ice for ultrasonic crushing for 2 times (ultrasonic treatment is stopped for 2sec after 1sec, and ultrasonic treatment is carried out for 15min each time);

(6) centrifuging at 4 deg.C and 13,000rpm for 20min, collecting supernatant and precipitate, sucking 30 μ l of supernatant, adding 2 μ l DTT and 8 μ l 4 xSDS loading buffer solution; a small amount of the precipitate was removed, 5. mu.l of DTT and 95. mu.l of 1 XSDS loading buffer were added, the sample was mixed and boiled for 5-10min, and the expression of the recombinant CsPLA 2 protein was observed on 12% SDS-PAGE, as shown in FIG. 3.

Next, affinity purification of the recombinant CssPLA2 protein was performed:

(1) pretreatment of the Amylose resin affinity chromatography column: 3 times volume of deionized water; 3 volumes of 0.1% SDS; 1 volume of deionized water; column buffer (20mM Tris7.4, 200mM NaCl,1mM EDTA) at 3 volumes;

(2) filtering the obtained supernatant twice with 0.45 μm filter membrane; when the buffer solution is reduced to be close to the surface of the resin, adding a supernatant sample, passing through the column for three times, and simultaneously retaining an effluent liquid;

(3) washing with at least 100 volumes of 1 × binding buffer to remove contaminating proteins;

(4) adding 10 times of 10mM maltose (maltose) elution buffer solution for elution, and collecting the eluate;

(5)3 times volume of deionized water is used; 3 volumes of 0.1% SDS; 1 volume of deionized water; 3 times of the volume of the column buffer; washing Amylose resin with 3 volumes of 20% ethanol and storing the resin in 20% ethanol;

(6) absorbing 30 μ l of eluate, adding 2 μ l of DTT and 8 μ l of 4 xSDS loading buffer, boiling for 5-10min, and analyzing the purity of the purified recombinant CsPLA 2 protein by 12% SDS-PAGE, as shown in FIG. 3;

(7) according to the electrophoresis result, the eluent containing the relatively pure recombinant CsPLA 2 protein is filled into a dialysis bag, the dialysis is carried out in Tris buffer solution (pH 8.0) at the temperature of 4 ℃, the dialysate is replaced once every 4 hours, and the total time of fluid replacement is 3-4 times;

(8) further purifying the recombinant CsPLA 2 protein by anion exchange chromatography (Anionexchange chromatography) using a medium-high pressure chromatography system and an anion exchange column (HiTrap QFF); washing the column with 15ml of buffer (20mM Tris-HCl, pH8.0), adding the recombinant CsPLA 2 protein sample, eluting with 5mM-500mM NaCl buffer (20mM Tris-HCl, pH8.0, 5mM-500mM NaCl), and collecting the eluate; when eluted with 100mM and 300-400mM NaCl buffers, a distinct peak was observed, as shown in FIG. 4. Respectively absorbing 30 μ l of eluate of each gradient, adding 2 μ l of DTT and 8 μ l of 4 xSDS loading buffer solution, boiling for 5-10min, and analyzing the purity of the purified recombinant CsPLA 2 protein by 12% SDS-PAGE; the peak eluted with 300-mM NaCl buffer was the target recombinant CsPLA 2 protein (i.e., MBP-CsPLA 2 fusion protein), and 12% SDS-PAGE shown in FIG. 5 revealed a single band with a molecular weight of about 76kDa, indicating that the molecular weight of the resulting recombinant CsPLA 2 protein (MBP-CsPLA 2 fusion protein) was consistent with the expected molecular weight. The molecular weight of the CsPLA 2 protein was approximately 34kDa, and the molecular weight of the MBP tag protein attached to the pMAL-c2x plasmid was approximately 42kDa, so that the recombinant CsPLA 2 protein (MBP-CsPLA 2 fusion protein) had a molecular weight of approximately 76 kDa.

1.8Western blot and mass spectrum identification of recombinant CsPLA 2 protein:

recombinant CssPLA2 proteins were identified using the CssPLA2 monoclonal antibody and mass spectrometry methods, respectively.

Firstly, Western blotting was used to identify recombinant CsPLA 2 protein:

(1) after 12% SDS-PAGE is carried out on the recombinant CsPLA 2 protein, the gel is placed in an electrotransfer buffer solution to be soaked for 15 min;

(2) preparing a PVDF membrane and several pieces of filter paper, wherein the PVDF membrane is sequentially treated according to the following sequence: 10sec in 100% methanol → 5min in deionized water → 10min in electrotransfer buffer solution, and simultaneously, directly soaking the filter paper in the electrotransfer solution;

(3) the installation sequence of the pore plates is as follows: black orifice plate, gel fiber pad, filter paper, gel, PVDF membrane, filter paper, gel fiber pad, white orifice plate; aligning the gel, the PVDF membrane and the filter paper, exhausting bubbles in each layer, and correctly placing the layers in an electrotransfer tank after the layers are installed;

(4) rotating the film on ice for 1-1.5h at a constant pressure of 100V;

(5) soaking the PVDF membrane in methanol for 10sec, taking out and completely drying the PVDF membrane by using filter paper;

(6) soaking the PVDF membrane in a 5% skimmed milk powder solution, and sealing at room temperature for 2 h;

(7) washing the membrane with PBST for 3 times and 5 min/time;

(8) PVDF membrane was mixed with a solution of 1: 300 dilution (1% BSA in diluent) of the CsPLA 2 monoclonal antibody of clonorchis sinensis

Incubation at 4 ℃ overnight;

(9) washing the membrane with PBST 5 times for 5 min/time;

(10) incubating the PVDF membrane with rabbit anti-mouse IgG (diluted 1: 2,000) labeled with HRP, and incubating at room temperature for 1 h;

(11) washing the membrane with PBST 5 times for 5 min/time;

(12) the membrane was completely dried with filter paper, developed by immersing in ECL luminescence solution (1 ml each of A, B solutions), and photographed using a fluorescence and chemiluminescence imaging analysis system. The results are shown in FIG. 6, which indicates that the recombinant CsPLA 2 protein obtained in example 1 is correct.

Mass spectrometric identification of recombinant CssPLA2 protein was identified by the proteomics center of the zhongshan medical school of the zhongshan university. The results are shown in FIG. 7, which also indicates that the recombinant CsPLA 2 protein obtained in example 1 is correct.

Specifically, the recombinant CsPLA 2 protein contains CsPLA 2 protein and MBP tag protein. The amino acid sequence of the CsPLA 2 protein is shown as SEQ ID NO.1, and specifically comprises the following steps:

KPRSISRDKPHAELEWSGKLSDNQTIHIWTVASKGLFGEISKPAWIQVDIRGSNSSQDAIRLIFDQEHRLRYCVFGTDTVETSVSLDDADLLTRNPIYLEHFFFTSANEFLRACKELRRASEEPAKLVRRPRTAYRANPMIMPGTLWCGKGNAATRERTFGDEIETDMCCRTHDRCFENIQSLTSKFGYYNPSPVTISNCECDDEFLSCLENAGTEAATRVGNLYFNVFKIPCFLRRTERICTHNDESGACGQFENREDIELFRPQRFVAPYITV are provided. The amino acid sequence of the MBP tag protein of CsPLA 2 is the corresponding amino acid sequence of the MBP tag protein coding sequence on the pMAL-c2x plasmid. The N-terminus of the protein is linked to the C-terminus of the MBP tag protein. The CsPLA 2 protein and the MBP tag protein are connected through a connecting peptide. The nucleotide coding sequence of the connecting peptide is specifically the nucleotide sequence after the MBP tag protein coding sequence on the pMAL-c2x plasmid and before the Xba1 enzyme cutting site.

And (3) knotting: after extensive and intensive research, a plurality of prokaryotic expression plasmids such as pET-30a, pET-32a, pET-26b, pGEX-4T-1 and pMAL-c2x are tried, and finally, only pMAL-c2x plasmid can express soluble and bioactive CsPLA 2 protein.

Example 2 determination of enzymatic Activity of recombinant CsPLA 2 protein obtained in example 1

The enzymatic activity of the recombinant CssPLA2 protein obtained in example 1 was measured using the secretory PLA2(sPLA2) enzymatic activity assay kit, using honeybee secretory PLA2 as a positive control and MBP tag protein (maltose binding protein) as a negative control.

The principle is as follows: phospholipase A2(Phospholipase A2), abbreviated as PLA2, hydrolyzes the second fatty acyl bond (sn-2) of glycerophospholipids to form lysophospholipids and fatty acids.

The method comprises the following operation steps:

(1) negative control group: adding 10ul DTNB, 5ul reaction buffer solution and 10ul MBP control protein into a small hole of an enzyme label plate;

(2) positive control group: adding 10ul DTNB, 5ul reaction buffer solution and 10ul honeybee PLA2 protein into the small hole of the ELISA plate;

(3) experimental groups: adding 10ul DTNB, 5ul reaction buffer solution and 10ul MBP-CsPLA 2 fusion protein into the small hole of the enzyme label plate (the concentration of the MBP-CsPLA 2 fusion protein is 1-4mg/ml as much as possible, which is equivalent to 10-40 mu g of protein contained in each 10ul sample to be detected);

(4) adding 200ul of phospholipid substrate (Diheptanoyl Thio-PC) into each small hole to start reaction, and gently shaking the enzyme label plate to mix reaction liquid uniformly;

(5) absorbance at 414nm was measured using a multifunctional microplate reader.

As a result, as shown in FIG. 8, the enzyme activity detection kit for sPLA2 (secreted phospholipase A2) detected that the recombinant CsPLA 2 protein (MBP-CsPLA 2 fusion protein) obtained in example 1 had enzyme activity. However, the CssPLA2 protein obtained by the prior expression technology, for example, the prior document f.hu et al./Molecular & Biochemical parasitity 167(2009) 127-.

The effects of temperature, enzyme concentration, and substrate concentration on enzyme activity are shown in FIGS. 9 to 11, respectively. From FIG. 9, it can be seen that the recombinant CsPLA 2 protein obtained in example 1 of the present invention still has good enzymatic activity at 50 degrees, indicating that its stability is particularly good.

Example 3 removal of endotoxin from recombinant CsPLA 2 protein

3.1 according to Detoxi-Gel^TMThe Endotoxin Removing Gel kit instruction book comprises the following operations:

(1) recovering the activity of the resin after the resin naturally settles for about 30min at room temperature;

(2) regenerated Detoxi-Gel resin: washing the resin with 1% sodium deoxycholate in an amount which is 5 times the volume of the resin, and then adding water for injection in an amount which is 3-5 times the volume of the resin to remove the detergent;

(3) balancing resin: 3-5 times volume of water for injection is added into the column.

(4) Sample adding: the recombinant CsPLA 2 protein solution obtained in example 1 was put into a dialysis bag, dialyzed at 4 ℃ in PBS buffer (pH 7.4), and the dialysate was changed every 4 hours or so for 3 to 4 times in total; putting the dialysis bag after dialysis into sucrose, and concentrating protein by utilizing the water absorption of the sucrose; adding 1ml of concentrated recombinant CsPLA 2 protein solution, and in order to obtain higher binding efficiency, putting the recombinant CsPLA 2 protein into resin, and incubating for 1-1.5h at room temperature; then adding water for injection, and collecting effluent;

(5) repeating the step (2) to remove residual endotoxin and regenerate the resin;

(6) storing the resin in 25% ethanol, and standing at 2-8 ℃;

(7) the collected tube effluents were subjected to 12% SDS-PAGE.

3.2 Limulus reagent detection whether the recombinant CsPLA 2 protein after removing endotoxin is qualified

Experimental groups: 100. mu.l of the recombinant CsPLA 2 protein sample + 100. mu.l of water for detection; control group: 200 μ l of assay water.

After the solution in the detection tube is mixed gently, the tube opening is sealed by a sealing membrane, the tube opening is vertically placed in a water bath at 37 ℃, the temperature is kept for 60min, after the end, the detection tube is gently taken out, the tube is slowly inverted, if gel is formed in the tube, and if the gel does not deform and slip from the tube wall, the tube is positive (namely contains endotoxin); those which did not form a gel or formed a gel that deformed to slip off the tube wall were negative (i.e., endotoxin free). Care was taken not to shake during incubation to avoid affecting gel formation.

Through detection, the recombinant CsPLA 2 protein after removing endotoxin is qualified and can be used for subsequent cell experiments.

Example 4CCK8 method for detecting growth inhibition effect of recombinant CsPLA 2 protein on human cholangiocarcinoma FRH cells

(1) Inoculating cells into 20ml cell culture flask, culturing at 10% FBS-164037 deg.C and 5% CO2, and subculturing in 96-well plate at cell density of 1 × 10⁵Culturing at 37 deg.C for 24 hr, wherein each volume is 100 μ l;

(2) after the cells adhere to the wall, culturing in a serum-free culture medium for 24h, and then discarding the culture solution; respectively preparing 25ug/ml of clonorchis sinensis secretory excretory protein (ESP), 25ug/ml of MBP-tagged protein and 25ug/ml of recombinant CsPLA 2 protein by using 2% FBS-1640 culture medium containing no recombinant CsPLA 2 protein and PBS as negative control; the central cell culture well of each plate was divided into 4 groups, wherein 100. mu.l of the culture medium containing 25. mu.g/ml ESP, 25ug/ml MBP control protein, 25ug/ml recombinant CsPLA 2 protein and 2% FBS-1640 containing no recombinant protein and added PBS was added to each of the 4 cell wells, and CO was added to the culture medium₂Culturing in an incubator at 37 deg.c;

(3) color generation: after the culture medium is changed with the 2% FBS-1640 culture medium containing 100. mu.l/well for 24h, 48h and 72h, 10. mu.l CCK8 is added into each well, and CO is added₂Culturing in an incubator at 37 deg.C for 3.5 hr;

(4) color comparison: selecting a wavelength of 450nm, measuring the absorbance value of each hole by using a full-automatic enzyme standard instrument, and recording the result.

CCK8 detects the growth inhibition effect of MBP-CsPLA 2 on human cholangiocarcinoma FRH cells, and the result is shown in FIG. 12.

ESP (clonorchis sinensis secretory excretory protein), MBP protein (maltose binding protein as a control), recombinant CsPLA 2 protein (MBP-CsPLA 2) and PBS (negative control group) are used for respectively incubating bile duct cancer FRH cells, and after 24 hours (A), 48 hours (B) and 72 hours (C), CCK8 reagents are respectively used for detecting the absorbance of the cells at 450 nm; as can be seen from FIG. 12, after 72 hours, 25ug/ml of MBP-CsPLA 2 significantly inhibited the growth of FRH cells of human cholangiocarcinoma, with an inhibition rate of about 86%. MBP protein (maltose-binding protein) as a control has no effect of inhibiting the growth of FRH cells of the human cholangiocarcinoma, so that it is fully demonstrated that the CsPLA 2 protein has the effect of obviously inhibiting the growth of the FRH cells of the human cholangiocarcinoma, and the inhibition rate is about more than 86%.

Example 5 flow cytometry for detecting growth inhibition effect of recombinant CsPLA 2 protein on human cholangiocarcinoma FRH cells

(1) Human bile duct cancer cells are cultured in 10% FBS-1640 medium at 37 ℃ and 5% CO₂Culturing in incubator, transferring to six-well cell culture plate, and culturing at 1 × 10⁵Per ml, 2ml per pore volume;

(2) after the cells are attached to the wall, the cells are cultured in a serum-free medium for 24h, and then the culture solution is discarded. 25ug/ml of clonorchis sinensis secretory excretory protein (ESP), 25ug/ml of MBP-tagged protein, 25ug/ml of recombinant CsPLA 2 protein were prepared separately in 2% FBS-1640 medium, with PBS added in the presence of 1: 2000 2% FBS-1640 medium of pro-apoptotic agent as positive control; all cells were first starved (serum-free culture), cultured for 24h, and the medium was discarded, and a solution containing 25. mu.g/ml ESP, 25ug/ml MBP control protein, 25ug/ml recombinant CsPLA 2 protein, 1: 2000 apoptosis promoting agent and 2% FBS-1640 culture solution containing PBS, respectively culturing for 72 hr;

(3) digesting the cells with 0.25% pancreatin into a 15ml centrifuge tube; centrifuging the suspension cells (centrifuging at 2000rpm for 5min) and collecting; the adherent cells are digested and collected by pancreatin without EDTA (note: the pancreatin digestion time is not easy to be too long, otherwise false positive is easy to cause);

(4) washing the cells with PBS twice (centrifugation at 2000rpm for 5min) to collect 1-5 × 10⁵A cell;

(5) adding 500 mu L Binding Buffer suspension cells;

(6) adding 5 mu L of Annexin V-FITC, uniformly mixing, adding 10 mu L of Propidium Iodide, uniformly mixing, and reacting for 5-15 min at room temperature in a dark place; performing flow cytometry detection within 1 h;

(7) detecting with flow cytometer, wherein the number of cells should not be less than 1 × 10⁵。

The results are shown in FIG. 13, FIG. 13: among them, fig. 13A: 25ug/ml ESP (Clonorchis sinensis secreted excretory proteins), FIG. 13B: 25ug/ml MBP protein (maltose binding protein, as control), fig. 13C: 25ug/ml recombinant CssPLA2 protein, fig. 13D: pro-apoptotic agents (positive control), fig. 13E: PBS (negative control) incubates human bile duct cancer FRH cells respectively, and detecting apoptosis by flow cytometry after 72 hours; the apoptosis percentages of the FRH cells at the early stage and the late stage are increased from 13.4 percent (PBS group) and 26.1 percent (MBP group) to 44.4 percent (MBP-CsPLA 2 group), which indicates that MBP-CsPLA 2 promotes the apoptosis of the FRH cells of the human cholangiocarcinoma, and therefore, the CsPLA 2 protein fully plays a role in obviously inhibiting the growth of the FRH cells of the human cholangiocarcinoma.

In summary, the results of the experiments in examples 4 and 5 fully demonstrate the growth inhibitory effect of CssPLA2 protein on FRH cells of cholangiocarcinoma (hepatoportal cholangiocarcinoma). The invention discovers the new application of the CsPLA 2 protein in preparing the medicine for treating the cholangiocarcinoma for the first time.

While the invention has been described with respect to a preferred embodiment, it will be understood by those skilled in the art that the foregoing and other changes, omissions and deviations in the form and detail thereof may be made without departing from the scope of this invention. Those skilled in the art can make various changes, modifications and equivalent arrangements, which are equivalent to the embodiments of the present invention, without departing from the spirit and scope of the present invention, and which may be made by utilizing the techniques disclosed above; meanwhile, any changes, modifications and variations of the above-described embodiments, which are equivalent to those of the technical spirit of the present invention, are within the scope of the technical solution of the present invention.

Claims

Use of CsPLA 2 protein in preparation of medicine for treating bile duct cancer.
2. The use according to claim 1, wherein the CssPLA2 protein is a recombinant CssPLA2 protein.
3. The use according to claim 2, wherein the recombinant CssPLA2 protein comprises a CssPLA2 protein and an MBP tag protein.
4. The use according to claim 3, wherein the amino acid sequence of the CsPLA 2 protein is as shown in SEQ ID No. 1.
5. The use according to claim 3, wherein the MBP-tag protein has an amino acid sequence corresponding to the MBP-tag protein coding sequence on the pMAL-c2X plasmid.
6. The use according to claim 3, wherein the N-terminus of the CsPLA 2 protein is linked to the C-terminus of the MBP tag protein.
7. The use according to claim 3, wherein the CsPLA 2 protein and the MBP tag protein are linked by a linker peptide.