CN107973849B - Protein for enhancing immunity effect of pig vaccine and application thereof - Google Patents
Protein for enhancing immunity effect of pig vaccine and application thereof Download PDFInfo
- Publication number
- CN107973849B CN107973849B CN201711243051.7A CN201711243051A CN107973849B CN 107973849 B CN107973849 B CN 107973849B CN 201711243051 A CN201711243051 A CN 201711243051A CN 107973849 B CN107973849 B CN 107973849B
- Authority
- CN
- China
- Prior art keywords
- protein
- vaccine
- immunization
- swine
- enhancing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Abstract
The invention relates to a protein for enhancing the immune effect of a swine vaccine and application thereof, and relates to the field of genetic engineering. The protein for enhancing the immune effect of the pig vaccine has the amino acid sequence shown in (a) or (b): (a) SEQ ID No. 1; (b) the amino acid sequence of SEQ ID NO.1 is substituted and/or deleted and/or added by one or more amino acid residues, and the derivative sequence has the same function of promoting the immunological activity as the derivative sequence of SEQ ID NO. 1. The vaccine is applied to combined immunization with commercial vaccines, can improve the immune activity of antigens and enhance the immune effect of the vaccines, and is very suitable for preventing porcine virus diseases.
Description
Technical Field
The invention relates to the field of genetic engineering, and in particular relates to a protein for enhancing the immune effect of a swine vaccine and application thereof.
Background
Various infectious diseases caused by infection of animals by pathogenic microorganisms such as viruses, bacteria and the like seriously restrict the healthy development of the breeding industry in various countries and regions, and simultaneously have great hidden danger to human health. Therefore, the research on the prevention and treatment measures for animal infectious diseases has great economic value and social significance, the vaccine immunity is the main measure for preventing and controlling infectious diseases at present, but the conventional vaccine used at present is not ideal, and has two problems of low immune efficiency and poor safety. Therefore, enhancing the immune effect of vaccines under safe dose vaccination becomes the focus of the development and research of vaccines at present.
The cytokine is a cell regulatory protein which is produced by immune effector cells and related cells and has important biological activity, and the cytokine is safe, effective, various in types and simple in process, can effectively enhance cellular immunity and humoral immune response of organisms, and is increasingly regarded as an immune adjuvant, interleukin-33 (interleukin-33, I L-33) is a pro-inflammatory cytokine discovered in 2005, belongs to a new member of the I L-1 family, is mainly expressed by epithelial cells, endothelial cells, fibroblasts and smooth muscle cells, I L-33 can not only stimulate TH1 immune response, but also stimulate TH2 and cytotoxic T cells (CD8+) immunity, and is very important for preventing and eliminating pathogen invasion.
However, the application of the cytokine as an immune adjuvant is less in the market.
Disclosure of Invention
The first purpose of the invention is to provide a protein for enhancing the immune effect of a swine vaccine, which can be used for combined immunization with a commercial vaccine, can improve the immune activity of an antigen and enhance the immune effect of the vaccine, and is very suitable for preventing swine viral diseases.
The second object of the present invention is to provide a nucleic acid molecule encoding the above protein.
The third object of the present invention is to provide a vector comprising the above-mentioned nucleic acid molecule.
The fourth object of the present invention is to provide a recombinant cell containing the above nucleic acid molecule, wherein the protein is efficiently expressed in the recombinant cell in an amount of 50% or more of the total protein of the recombinant cell.
The fifth object of the present invention is to provide use of the above protein, the above nucleic acid molecule, the above vector, or the above recombinant cell for preparation of a vaccine immunopotentiator for swine.
The sixth purpose of the invention is to provide a vaccine immunopotentiator for pigs, which is combined with a commercial vaccine for immunization, and effectively enhances the immune effect of the vaccine.
The seventh purpose of the invention is to provide a preparation method of the protein, which has the advantages of simple operation, short period, low cost, good specificity, sensitive reaction, higher preparation concentration and contribution to mass preparation.
The eighth object of the present invention is to provide a vaccine for swine, which comprises the above protein.
The technical problem to be solved by the invention is realized by adopting the following technical scheme.
The invention provides a protein for enhancing the immune effect of a swine vaccine, which has an amino acid sequence shown as (a) or (b): (a) SEQ ID No. 1; (b) the amino acid sequence of SEQ ID NO.1 is substituted and/or deleted and/or added by one or more amino acid residues, and the derivative sequence has the same function of promoting the immunological activity as the derivative sequence of SEQ ID NO. 1.
Nucleic acid molecules encoding the above proteins.
Further, in a preferred embodiment of the present invention, the nucleotide sequence of the above-mentioned nucleic acid molecule is represented by SEQ ID NO. 2.
A vector comprising the nucleic acid molecule.
A recombinant cell comprising the above vector.
The protein, the nucleic acid molecule, the vector or the recombinant cell can be used for preparing vaccine immunopotentiators for pigs.
A vaccine immunopotentiator for swine, comprising: the above protein or the above recombinant cell.
A preparation method of the protein comprises the following steps: culturing the recombinant cell, separating and purifying the culture product to obtain the protein.
Further, in a preferred embodiment of the present invention, the recombinant cell is Escherichia coli.
A vaccine for pigs, which comprises the protein.
Compared with the prior art, the invention has the beneficial effects that:
the protein for enhancing the vaccine immunity effect of the pig can be efficiently expressed in escherichia coli, the expression amount reaches more than 50% of the total protein of the thallus, and the preparation method has the advantages of simple operation, short period, low cost and good specificity.
The vaccine is applied to enhancing the immunity of the pig vaccine, and is particularly combined with the vaccine sold in the market for immunization, so that the antigen immunocompetence can be improved, the vaccine immune effect can be enhanced, the vaccine is very suitable for preventing the pig virus diseases, and the large-scale popularization and application are easy.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a schematic diagram of agarose gel electrophoresis of a nucleic acid molecule provided in example 1 of the present invention;
FIG. 2 is a SDS-PAGE result of purified I L-33 protein according to example 3 of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
It is noted that the N-terminus of I L-33 has no significant signal peptide, I L-33 is produced and secreted as a large preproprotein that needs to be processed sufficiently to release the mature biologically active form, the mature protein of which has a molecular weight of approximately 18 kDa. the porcine I L-33 protein encodes 276 amino acids, and the 120 th amino acid of the full-length protein is selected as the N-terminal amino acid.
Therefore, the protein for enhancing the immune effect of the pig vaccine is obtained by selecting and expressing the C-terminal (amino acid at position 120-276) of I L-33 by the inventor, taking the protein product as an adjuvant, and combining the protein product with the commercial vaccine for immunization, thereby enhancing the immune effect of the vaccine.
In the illustrated embodiment of the present invention, the RNA extraction kit and the RT-PCR kit are purchased from Promega corporation; the pMD-19T vector and Escherichia coli DH5a competent cells were purchased from Shanghai Biotechnology engineering services, Inc.
The NcoI enzyme, the XhoI enzyme, pET28a (+) and the T4DNA ligase were all purchased from TaKaRa, and E.coli Rosetta (DE3) competent cells were purchased from Shanghai Bioengineering services, Inc.
Endotoxin-scavenging resins were purchased from Shanghai Biotechnology engineering services, Inc.
The protein shown in the sequence 1 is named as I L-33, the coding gene of I L-33 is named as I L-33, and the obtained pMD-19T vector containing I L-33 is named as pMD19-I L-33.
Example 1
Obtaining nucleic acid molecules of proteins for enhancing the immune effect of the swine vaccine, wherein the method comprises the following steps:
extraction of total RNA of pigs: total RNA from pig spleen or lymph node tissue was extracted by referring to the instructions of the RNA extraction kit of Promega.
Reverse transcription and PCR of I L-33 target Gene reverse transcription was carried out using RT-PCR kit from Promega to obtain cDNA of I L-33-mRNA, and the following primers were designed with reference to the pig I L-33 gene sequence (GeneBank: AB 292180):
IL-33-F120：cccatatgagtatcaaagaacattctgct
IL-33-R276：ccctcgagcattaagtttgagagcttaaatg
using cDNA as a template, and carrying out PCR amplification by using designed primers:
the PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 5min for 1 cycle; denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds for 35 cycles; final extension at 72 ℃ for 5 min.
And performing 1% agarose gel electrophoresis on the PCR amplification product, wherein the result is shown in FIG. 1, wherein a lane M in FIG. 1 is a DNA Marker, a lane 1 is a negative control, a lane 2 is a target gene, and the target gene has a size of about 470bp, which is consistent with the actual size, as shown in FIG. 1.
And (3) subcloning the PCR product into a pMD-19T vector, transforming Escherichia coli DH5a, selecting a positive monoclonal for gene sequencing, wherein the sequencing result shows that the PCR product is shown as a sequence 2 in a sequence table. The gene shown in sequence 2 encodes the protein shown in sequence 1.
Of course, in other embodiments, the coding gene shown in sequence 2 can also be obtained directly by chemical synthesis.
Example 2
The Escherichia coli expression vector I L-33/pET 28a (+) is constructed by the following method:
(1) the PCR amplification product obtained in example 1 was digested simultaneously with restriction enzymes Nco I and Xho I, and the digested product was recovered.
(2) The vector pET28a (+) was double-digested with restriction enzymes Nco I and Xho I, and the vector backbone was recovered.
(3) And (3) connecting the enzyme digestion product in the step (1) with the vector skeleton in the step (2) by using T4DNA ligase to obtain a connection product.
(4) And (3) transforming the ligation product in the step (3) into an escherichia coli Rosetta (DE3) competent cell, selecting a single clone for PCR identification, extracting a plasmid from a positive clone for sequencing identification, and obtaining a recombinant plasmid I L-33/pET 28a according to a sequencing result.
The structure of recombinant plasmid I L-33/pET 28a describes that the DNA shown in sequence 2 of the sequence table is inserted between the Nco I and Xho I cleavage sites of vector pET28a (+).
Example 3
Recombinant cells containing vector I L-33/pET 28a (+) were prepared as follows:
escherichia coli Rosetta (DE3) containing pET28a-I L-33 was named Rosetta-I L-33/pET 28a to obtain recombinant cells.
The recombinant cells Rosetta-I L-33/pET 28a and the vector Rosetta/pET28a obtained in example 2 were inoculated into L B medium containing 100mg/m L kanamycin, respectively, cultured at 37 ℃ with shaking at 150rpm until OD600 became 1, and IPTG was added to a final concentration of 0.3mM, and induced at 37 ℃ for 4 hours.
Respectively centrifuging the bacterial liquid before and after induction of Rosetta-I L-33/pET 28a and Rosetta/pET28a at 12000rpm for 10min, collecting thalli, carrying out PBS (phosphate buffer solution) resuspension, ultrasonically breaking the thalli, centrifuging at 12000rpm for 15min, and respectively carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoresis on the supernatant and the precipitate.
According to the SDS-PAGE result, the detection result of Rosetta-I L-33/pET 28a shows that a target protein band of about 18KD appears in the precipitate, the target protein band does not exist in the supernatant, and the target protein cannot be detected in both the supernatant and the precipitate of Rosetta/pET28 a.
Respectively centrifuging the bacterial liquid before and after induction of Rosetta-I L-33/pET 28a and Rosetta/pET28a at 10000rpm for 10min, collecting thalli, carrying out PBS heavy suspension, carrying out ultrasonic bacteria breaking, then carrying out 12000rpm centrifugation for 15min, collecting thalli, suspending the thalli by PBS, carrying out electrophoresis detection by 12% SDS-PAGE, transferring membranes for 1.5-2 h at a constant current of × 0.65.65 mA per square centimeter of membrane area, putting the thalli into 5% skimmed milk prepared by TBST, removing sealing liquid after decoloration (5g skimmed milk is dissolved in 100m L), adding TBST (25mM NaCl, 100mM Tris, 0.2% Tween-20 to 1000m L in constant volume), adding primary antibody prepared by sealing liquid, incubating for 3 h at room temperature, recovering the primary antibody, and storing.
And (3) putting the membrane into a TBST solution for decolorization, adding a secondary antibody marked by HRP (horse radish peroxidase) prepared by using a confining liquid for decolorization, adding TBST for membrane washing for 3 times for decolorization, and carrying out development, fixing and film washing and tabletting.
Wherein, the western blot detection result of Rosetta-I L-33/pET 28a shows that the target protein is generated after induction, and the Rosetta/pET28a has no target protein signal before and after induction.
Example 4
The protein is separated and purified by the following method:
the recombinant cell Rosetta-I L-33/pET 28a provided in example 4 was cultured, and the above protein was isolated and purified from the culture product.
Specifically, the method comprises the steps of centrifuging a culture product after induction, namely a bacterial solution, at 12000rpm for 10min, collecting thalli, resuspending the thalli by PBS, ultrasonically breaking the thalli, centrifuging at 12000rpm for 15min, collecting the thalli, suspending the thalli by PBS, ultrasonically lysing the thalli, centrifuging at 12000rpm for 30min, collecting precipitates, adding washing buffer (0.5% Triton-100, 50mM Tris pH8.0, 300mM NaCl and 10mM EDTA) for washing, washing the precipitates for several times by using a pipette, centrifuging at 12000rpm for 10-20min, collecting the precipitates, repeatedly washing for 3 times, removing bacterial fragments as much as possible, suspending the precipitates by using resuspension buffer (50mM Tris pH8.0, 100mM NaCl and 10mM EDTA), centrifuging at 12000rpm for 10-20min, dissolving by using urea (8M) according to the ratio of 30mg/M L, stirring at 4 ℃, centrifuging at 12000rpm for 10-20min, pouring out supernatant, subpackaging into a tube with 2M L/tube, and preserving at-20 ℃ or-80 ℃ for later use.
The purified I L-33 protein was subjected to SDS-PAGE, and the detection results are shown in FIG. 2, wherein lane M of FIG. 2 is a molecular weight protein Marker, and lane 1 is a purified I L-33 protein.
The purified protein was diluted 1: 20-fold by dilution renaturation (renaturation solution formulation: 100mM Tris pH8.0, 400mM L-Arg HCl, 2mM EDTA, 5mM GSSG, 0.5mM GSSG, 20% glycerol) and then reconstituted with Millipore
Concentrating protein with Ultra-15 ultrafiltering tube, measuring protein concentration with instrument to be 10mg/m L, and storing the concentrated protein at-20 deg.C or-80 deg.C for use.
And then, after the concentrated I L-33 protein is treated by endotoxin removing resin, detecting that the endotoxin content of the I L-33 protein in the batch is less than 0.2EU/ml, and meeting the requirement of immunizing animals, wherein the protein after removing the endotoxin is stored at the temperature of-20 ℃ or-80 ℃ for later use.
Test example 1
The I L-33 protein solution prepared in example 4 was diluted to 10-fold volume with PBS buffer to obtain I L-33 protein dilution (1mg/m L).
① test result of mouse
10 healthy mice with the weight of 14-18g are adopted, and are injected with 0.2m L I L-33 in each abdominal cavity (or injected subcutaneously) for 7 days, during the observation period, if adverse reactions such as convulsion and death caused by I L-33 injection occur, the I L-33 of the batch is judged to be unqualified, if adverse reactions such as convulsion and death caused by factors other than I L-33 occur, the correction and the inspection are judged to be invalid, the re-inspection is required, and if the re-inspection is not performed, the I L-33 of the batch is judged to be unqualified.
② checking with guinea pig
10 healthy guinea pigs with the weight of 350-.
The safety verification results of mice and guinea pigs show that I L-33 obtained in example 2 is safe and does not cause any adverse reaction.
Test example 2
I L-33 adjuvant and porcine pseudorabies vaccine immunization swinery clinical test
The material comprises: vaccine: porcine pseudorabies live vaccine SA215, lot 201506002, supplied by Sichuan Shenshou biologicals Co., Ltd.
Experimental animals: weaned piglets of 21-28 days old.
Cell culture related materials and reagents: PK15 cells were obtained from the intensive laboratory of livestock and poultry biological products, Sichuan province, Bioproducts Ltd, for Huashen beasts, Sichuan, and fetal bovine serum and DMEM medium were purchased from Thermo Fisher Scientific.
I L-33 protein dilutions I L-33 protein solutions (10mg/m L) prepared in example 4 were diluted to 10-fold volume with PBS buffer to give I L-33 protein dilutions (1mg/m L).
① procedure for animal immunization experiment
(1) 15 weaned piglets of 21 days old were randomly divided into 3 groups.
(2) The immunization doses were used according to the vaccine instructions, wherein the prepared I L-33 protein diluent was used in group 1, the vaccine diluent was used in group 2, and the group 3 was not immunized and was a negative control group.
(3) The immunization program is one-time immunization, the immunization mode is nasal drop immunization, venous blood of the pig anterior cavity is collected 7, 14, 21 and 28 days before and after immunization, serum is separated, and the level of a neutralizing antibody is determined.
(4) After immunization, all pigs were observed daily for body temperature, feed intake, mental status, normal and abnormal pigs relative to the control group were recorded, and the body temperature of the pigs was measured seven consecutive days after immunization.
(5) PK-15 cells were passaged according to a conventional method, and then the measurement of the neutralizing antibody titer was carried out on all samples with reference to a fixed virus dilution serum method recorded in the three appendix, neutralization experimental method, of pharmacopoeia of the people's republic of China, edition 2005. Data statistics are performed in units of groups.
② test results
(1) Clinical manifestations of groups after immunization
After the porcine pseudorabies live vaccine is diluted by different diluents for immunization, the body temperature, the food intake, the water intake and the mental state of the piglets are measured every day for 7 days, and the statistical results are shown in table 1.
TABLE 1 statistics of clinical symptom observation results after immunization of porcine pseudorabies live vaccine
According to the table 1, different diluents are used for diluting the porcine pseudorabies live vaccine for immunization, the body temperature of all piglets is lower than 40.0 ℃ in the test period, and the piglets are not seen with abnormal body temperature. All test pigs were normal in terms of food intake, water intake, and mental status.
(2) Law of change of neutralizing antibody after immunization
Serum of piglets is collected before and after immunization, and neutralizing antibodies of the porcine pseudorabies virus are determined according to the requirements of the 2005 edition of pharmacopoeia of the people's republic of China, and the results of the neutralizing antibody determination are shown in Table 2.
TABLE 2 determination of neutralizing antibodies after immunization of porcine pseudorabies live vaccines
As can be seen from Table 2, the average value of the neutralizing antibody of the test pig using the I L-33 protein diluent is higher than that of the common diluent group in different degrees on days 7, 14, 21 and 28 after immunization, and the average value of the neutralizing antibody of the test pig using the I L-33 protein diluent on day 28 after immunization is nearly 2 times that of the common diluent group, which shows that the I L-33 protein diluent can effectively enhance the immune effect of the porcine pseudorabies vaccine.
The data in the table 1 and the table 2 are combined, so that the I L-33 protein diluent and the porcine pseudorabies vaccine are used as a new vaccine, the immune effect of the vaccine can be obviously enhanced, the porcine pseudorabies can be effectively prevented, and the porcine pseudorabies vaccine has protective power for a swinery.
Test example 3
I L-33 adjuvant and hog cholera vaccine immunization swinery clinical test
The material comprises: vaccine: hog cholera heat-resistant protectant live vaccine (cell source), lot 201506002, was supplied by Sichuan warrior biologies, Inc.
Experimental animals: weaned piglets of 21-28 days old.
The detection kit for detecting the swine fever antibody blocking E L ISA is purchased from IDEXXX company.
I L-33 protein dilutions I L-33 protein solutions (10mg/m L) prepared in example 2 were diluted to 10-fold volume with PBS buffer to give I L-33 protein dilutions (1mg/m L).
① procedure for animal immunization experiment
(1) 15 weaned piglets of 21 days old were randomly divided into 3 groups.
(2) The immunization doses were used according to the vaccine instructions, wherein group 1 used the prepared I L-33 protein diluent, group 2 used the vaccine diluent itself, and group 3 was not immunized as a negative control.
(3) The immunization program is one-time immunization, the immunization mode is intramuscular injection, venous blood of the front cavity of the pig is collected 7, 14, 21 and 28 days before and after immunization, and the swine fever antibody is measured after separating serum.
(4) After immunization, all pigs were observed daily for body temperature, feed intake, mental status, normal and abnormal pigs relative to the control group were recorded, and the body temperature of the pigs was measured seven consecutive days after immunization.
(5) The swine fever antibody was measured according to the instructions of the swine fever blocking E L ISA antibody kit.
② test results
(1) Clinical manifestations of groups after immunization
After the swine fever heat-resistant protective agent live vaccine (cell source) is diluted by using different diluents for immunization, the body temperature of piglets, the feeding, drinking and mental states are measured every day, and the statistical results are shown in a table 3.
TABLE 3 post-immunization clinical symptom observations statistics
According to the table 3, after the swine fever heat-resistant protective agent live vaccine is diluted by different diluents for immunization, all piglets have the body temperature lower than 40.0 ℃ in the testing period, and the abnormal body temperature is not seen. And all test pigs were normal in food intake, water intake, mental status.
② rules of antibody Change following immunization
Serum is collected before and after immunization, the swine fever antibody titer is measured according to the kit instructions, and the statistical data of the measurement results are shown in table 4.
TABLE 4 Swine fever Block E L ISA antibody assay results after immunization
As can be seen from Table 4, all pig antibodies in the test groups were positive 21 and 28 days after immunization, and the antibody blocking rate was higher in the group using the I L-33 protein diluent than in the conventional diluent group, while the antibodies in the control group, i.e., group 3, were negative before immunization and 7, 14, 21 and 28 days after immunization.
The data in tables 3 and 4 are combined, so that the I L-33 protein diluent and the existing swine fever vaccine can be used as a new vaccine, and meanwhile, the I L-33 protein diluent can remarkably enhance the immune effect of the swine fever vaccine, effectively prevent the occurrence of swine fever and protect a swinery.
In summary, the protein for enhancing the pig vaccine immune effect and the application thereof provided by the embodiment of the invention can be efficiently expressed in escherichia coli, the expression amount is more than 50% of the total protein of the thallus, and the protein is simple in preparation operation, short in period, low in cost and good in specificity. The vaccine is applied to enhancing the pig vaccine immunity, and particularly, the vaccine is combined with a vaccine sold in the market for immunization, so that the antigen immunocompetence can be improved, the vaccine immune effect can be enhanced, the vaccine is very suitable for preventing pig virus diseases, and the vaccine is easy to popularize and apply in a large range.
The embodiments described above are some, but not all embodiments of the invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
SEQUENCE LISTING
<110> Sichuan Huashen animal bioproduct Co., Ltd
<120> protein for enhancing vaccine immune effect of pigs and application thereof
<160>2
<170>PatentIn version 3.5
<210>1
<211>157
<212>PRT
<213>swine
<400>1
Ser Ile Lys Glu His Ser Ala Ser Leu Ser Thr Tyr Asn Asp His Tyr
1 5 10 15
Ile Thr Phe Ala Phe Glu Asp Gly Ser Tyr Glu Ile Tyr Val Glu Asp
20 25 30
Leu Arg Lys Asp Gln Glu Lys Asp Lys Val Leu Leu Arg Tyr Tyr Asp
35 40 45
Ser Gln Ile Pro SerSer Glu Thr Asp Gly Gly Gly Asp His Arg Lys
50 55 60
Leu Met Val Asn Leu Ser Pro Thr Lys Asp Lys Asp Phe Leu Leu His
65 70 75 80
Ala Asn Ser Lys Glu His Ser Val Glu Leu Gln Lys Cys Glu Asn Pro
85 90 95
Leu Pro Glu Gln Ala Phe Phe Val Leu His Glu Gln Pro Ser Lys Cys
100 105 110
Val Ser Phe Glu Cys Lys Ser His Pro Gly Val Phe Leu Gly Val Lys
115 120 125
Asn Asn Gln Leu Ala Leu Ile Lys Leu Gly Glu His Pro Glu Asp Ser
130 135 140
Asn Arg Glu Asn Thr Thr Phe Lys Leu Ser Asn Leu Met
145 150 155
<210>2
<211>471
<212>DNA
<213>swine
<400>2
agtatcaaag aacattctgc ttctctcagt acatataacg atcactacat tacttttgct 60
tttgaggatg gaagttatga gatctatgtt gaagacttga gaaaagacca agagaaagat 120
aaggtgttac tccgttacta tgattcccaa atcccctcaa gtgaaacaga tggtggtggt 180
gatcatcgga aattaatggt aaacctgagc cccacaaaag acaaagattt cttgctgcat 240
gccaacagta aggagcattc tgtggagcta caaaaatgtg aaaacccact gccagaacag 300
gccttctttg tccttcatga gcagccctcc aaatgtgttt catttgaatg taagagccat 360
cctggagtgt ttctaggagt aaagaataac cagctagctc taatcaaact aggggaacac 420
cctgaggatt caaatagaga gaataccaca tttaagctct caaacttaat g 471
Claims (10)
1. A protein for enhancing the vaccine immunity effect of a pig is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 1.
2. A nucleic acid molecule encoding the protein of claim 1.
3. The nucleic acid molecule according to claim 2, wherein the base sequence is as shown in SEQ ID No. 2.
4. A vector comprising the nucleic acid molecule of any one of claims 2 to 3.
5. A recombinant cell comprising the vector of claim 4.
6. Use of the protein of claim 1, the nucleic acid molecule of claim 2 or 3, the vector of claim 4, or the recombinant cell of claim 5 in the preparation of a vaccine immunopotentiator for swine.
7. A vaccine immunopotentiator for swine, comprising: the protein of claim 1 or the recombinant cell of claim 5.
8. A method for producing the protein of claim 1, comprising the steps of: culturing the recombinant cell according to claim 5, and isolating and purifying the protein from the culture product.
9. The method according to claim 8, wherein the recombinant cell is Escherichia coli.
10. A vaccine for swine comprising the protein of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711243051.7A CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711243051.7A CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107973849A CN107973849A (en) | 2018-05-01 |
| CN107973849B true CN107973849B (en) | 2020-07-28 |
Family
ID=62008819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711243051.7A Active CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107973849B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113845572B (en) * | 2020-08-26 | 2023-11-21 | 中国农业科学院兰州兽医研究所 | Polypeptide for promoting pig organism to generate broad-spectrum acquired immune response and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008132709A1 (en) * | 2007-04-26 | 2008-11-06 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth, Near Dublin | Products for altering il-33 activity and methods therefor |
| CN103966253A (en) * | 2014-05-30 | 2014-08-06 | 中国科学技术大学 | Method for efficiently preparing recombinant human interluekin-33 protein |
| CN105744953A (en) * | 2013-10-07 | 2016-07-06 | 宾夕法尼亚大学理事会 | Vaccines with interleukin-33 as an adjuvant |
| JP2017008003A (en) * | 2015-06-25 | 2017-01-12 | 田辺三菱製薬株式会社 | Human anti-IL-33 neutralizing monoclonal antibody |
| CN108064236A (en) * | 2015-03-31 | 2018-05-22 | 免疫医疗有限公司 | Novel IL33 forms, the mutant form of IL33, antibody, measure and its application method |
-
2017
- 2017-11-30 CN CN201711243051.7A patent/CN107973849B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008132709A1 (en) * | 2007-04-26 | 2008-11-06 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth, Near Dublin | Products for altering il-33 activity and methods therefor |
| CN105744953A (en) * | 2013-10-07 | 2016-07-06 | 宾夕法尼亚大学理事会 | Vaccines with interleukin-33 as an adjuvant |
| CN103966253A (en) * | 2014-05-30 | 2014-08-06 | 中国科学技术大学 | Method for efficiently preparing recombinant human interluekin-33 protein |
| CN108064236A (en) * | 2015-03-31 | 2018-05-22 | 免疫医疗有限公司 | Novel IL33 forms, the mutant form of IL33, antibody, measure and its application method |
| JP2017008003A (en) * | 2015-06-25 | 2017-01-12 | 田辺三菱製薬株式会社 | Human anti-IL-33 neutralizing monoclonal antibody |
Non-Patent Citations (2)
| Title |
|---|
| interleukin-33 [Sus scrofa];LEE E.J.et al.;《NCBI Reference Sequence: NP_001272907.1》;20151225;全文 * |
| LEE E.J.et al..interleukin-33 [Sus scrofa].《NCBI Reference Sequence: NP_001272907.1》.2015, * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107973849A (en) | 2018-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108586618B (en) | Preparation and application of porcine epidemic diarrhea subunit vaccine | |
| AU2018232999A1 (en) | Synthetic peptide-based emergency vaccine against foot and mouth disease (FMD) | |
| MXPA06015105A (en) | Identifying virally infected and vaccinated organisms. | |
| US20220105170A1 (en) | African swine fever vaccine | |
| US10545148B2 (en) | Marker system, in particular for baculovirus-expressed subunit antigens | |
| WO2019223749A1 (en) | Acinetobacter baumannii immunogenic protein and composition and application thereof | |
| CN111763256A (en) | Cloning of chicken CR2 gene, expression and purification of protein and preparation of polyclonal antibody thereof | |
| CN111856006B (en) | Application of mycoplasma bovis secretory protein MbovP274 | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| CN116836243A (en) | F protein mutant before fusion of respiratory syncytial virus and application thereof | |
| CN107973849B (en) | Protein for enhancing immunity effect of pig vaccine and application thereof | |
| KR20190096965A (en) | Isolation of a Novel Pastivirus That Causes Innate Progression A | |
| CN110257405B (en) | Mycoplasma bovis alcohol dehydrogenase gene and encoding protein and application thereof | |
| CN105218668B (en) | EF-Tu protein monoclonal antibody MAb of Malta brucellosis as well as preparation method and application thereof | |
| CN111529700A (en) | Echinococcus multilocularis leukamidopeptidase subunit vaccine LAP and preparation method and application thereof | |
| US20070092532A1 (en) | Arthritis vaccines and methods | |
| CN113861277A (en) | Bovine rotavirus recombinant VP8 protein and application thereof | |
| CN109021115B (en) | Porcine circovirus trivalent subunit vaccine | |
| CN114315984A (en) | N protein epitope mutation marker for preparing PRRSV gene II type epitope deletion vaccine strain and application thereof | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN112426523A (en) | Pig vaccine containing antiviral composition and application | |
| Sritun et al. | Expression of recombinant S2 domain of spike protein of porcine epidemic diarrhea virus | |
| CN114315988A (en) | Coronavirus recombinant protein and application thereof in detecting cellular immunity | |
| Dong et al. | Construction and evaluation of novel plasmid DNA encoding somatostatin fused to a tissue plasminogen activator (tPA) in mice | |
| Bergamin et al. | Porcine B-cell activating factor promotes anti-FMDV antibodies in vitro but not in vivo after DNA vaccination of pigs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 610225 No.6, Muke Road, xihanggang Avenue, Southwest Airport Economic Development Zone, Shuangliu District, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan Province Applicant after: Livestock Bioengineering Co., Ltd Address before: 610000 Chengdu, Sichuan Shuangliu District, Southwest China Airport Economic Development Zone, West Hang Kong Road, animal husbandry Road No. 6 Applicant before: Sichuan Huashen Animal Biolog Products Co., Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |