CN107973849A - A kind of protein and its application for being used to strengthen pig vaccine immune effect - Google Patents
A kind of protein and its application for being used to strengthen pig vaccine immune effect Download PDFInfo
- Publication number
- CN107973849A CN107973849A CN201711243051.7A CN201711243051A CN107973849A CN 107973849 A CN107973849 A CN 107973849A CN 201711243051 A CN201711243051 A CN 201711243051A CN 107973849 A CN107973849 A CN 107973849A
- Authority
- CN
- China
- Prior art keywords
- protein
- vaccine
- seq
- pig
- immune effect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Abstract
The present invention relates to a kind of protein and its application for being used to strengthen pig vaccine immune effect, it is related to genetic engineering field.This is used for the protein for strengthening pig vaccine immune effect, its amino acid sequence is such as shown in (a) or (b)：(a)SEQ ID NO.1；(b) amino acid sequence of SEQ ID NO.1 by the substitution of one or several amino acid residues and/or missing and/or addition and had the function of into the derived sequence for having identical promotion immunocompetence with SEQ ID NO.1.It is applied to commercial available vaccines combined immunization, can improve antigen immunocompetence, strengthen immune effect of vaccine, be highly suitable for the prevention of virus diseases of pigs.
Description
Technical field
The present invention relates to genetic engineering field, and more particularly to it is a kind of be used for strengthen pig vaccine immune effect protein and
It is applied.
Background technology
Each state is seriously constrained as the various communicable diseases caused by the pathogenic microorganisms such as virus, bacterium infect animal
Family and the sound development of regional aquaculture, while also to human health, there are huge hidden danger.Therefore, to animal infectious disease
Control measure research has great economic value and social effect, and vaccine immunity is the main of current prevention and control infectious disease
Measure, but the conventional vaccine used at present is unsatisfactory, it is low with two hang-ups of security difference there are Immune efficiency.Therefore, exist
Strengthen the immune effect of vaccine under safe dose vaccine inoculation, become the focus of current vaccine development research.
Cell factor is produced by immune effector cell and relevant cell, and the cell with important biomolecule activity is adjusted
Albumen, with its security, validity, species is more, technique is simple, and can effectively strengthen the cellular immunity and humoral immunity of body
Reaction, is increasingly taken seriously as immunologic adjuvant.Interleukin 33 (interleukin-33, IL-33) is in 2005
It was found that a kind of Pro-inflammatory mediator, belong to IL-1 families newcomer, it is mainly female thin by epithelial cell, endothelial cell, fiber
Born of the same parents and smooth muscle cell expression.IL-33 can not only excite TH1 immune responses, moreover it is possible to excite TH2 and cytotoxic T cell (CD8
+) immune, this is very important for the prevention and removing of pathogen intrusion.Some researches show that be situated between mouse leucocyte recently
Element -33 and influenza vaccines combined immunization mouse by the way of Nasal immunization, IgG and sIgA antibody significantly increase, Th1 and Th2
Cytokines showed increased, and lethal hit can be resisted.
It is but less as the application of immunologic adjuvant for cell factor on the market.
The content of the invention
The first object of the present invention is to provide a kind of protein for being used to strengthen pig vaccine immune effect, it can be with city
Vaccine combined immunization is sold, antigen immunocompetence can be improved, strengthens immune effect of vaccine, is highly suitable for the prevention of virus diseases of pigs.
The second object of the present invention is to provide a kind of nucleic acid molecules for encoding above-mentioned protein.
The third object of the present invention is to provide a kind of carrier for including above-mentioned nucleic acid molecules.
The fourth object of the present invention is to provide a kind of recombinant cell containing above-mentioned nucleic acid molecules, wherein, protein exists
Recombinant cell high efficient expression, and expression quantity reaches more than the 50% of recombinant cell total protein.
The fifth object of the present invention is to provide above-mentioned protein, above-mentioned nucleic acid molecules, above-mentioned carrier or above-mentioned restructuring thin
Application of the born of the same parents in pig vaccine immunopotentiator is prepared.
The sixth object of the present invention is to provide a boar vaccine immunopotentiator, itself and commercial available vaccines combined immunization,
The effectively immune effect of enhancing vaccine.
The seventh object of the present invention is to provide a kind of preparation method of above-mentioned protein, its is easy to operate for this method, week
Phase is short, of low cost, and specificity is good, is quick on the draw, and the concentration of preparation is higher, is prepared beneficial to a large amount of.
The eigth object of the present invention is to provide a boar vaccine, it includes above-mentioned protein.
The present invention is solved its technical problem and is realized using following technical scheme.
The present invention proposes a kind of protein for being used to strengthen pig vaccine immune effect, its amino acid sequence such as (a) or (b) institute
Show：(a)SEQ ID NO.1；(b) amino acid sequence of SEQ ID NO.1 is passed through to the substitution of one or several amino acid residues
And/or lack and/or add and there is the derived sequence with identical promotion immunocompetence with SEQ ID NO.1.
Encode the nucleic acid molecules of above-mentioned protein.
Further, in preferred embodiments of the present invention, the base sequence such as SEQ ID NO.2 institutes of above-mentioned nucleic acid molecules
Show.
A kind of carrier, it contains above-mentioned nucleic acid molecules.
A kind of recombinant cell, it contains above-mentioned carrier.
Above-mentioned protein, above-mentioned nucleic acid molecules, above-mentioned carrier or above-mentioned recombinant cell strengthen in preparation pig vaccine immunity
Application in agent.
One boar vaccine immunopotentiator, it includes：Above-mentioned protein or above-mentioned recombinant cell.
A kind of preparation method of above-mentioned protein, it includes the following steps：Above-mentioned recombinant cell is cultivated, from cultured products
Separation, purifying obtain protein.
Further, in preferred embodiments of the present invention, above-mentioned recombinant cell is Escherichia coli.
One boar vaccine, it includes above-mentioned protein.
Compared with prior art, the beneficial effects of the invention are as follows：
For strengthen the protein of pig vaccine immune effect in Escherichia coli can high efficient expression, expression quantity reaches the total egg of thalline
White more than 50%, and its preparation manipulation is simple, the cycle is short, of low cost, specificity is good.
It is applied to enhancing pig vaccine to be immunized, while specifically itself and commercial available vaccines combined immunization can be improved antigen and exempted from
Epidemic disease activity, strengthens immune effect of vaccine, is highly suitable for the prevention of virus diseases of pigs, is easy to promote and apply on a large scale.
Brief description of the drawings
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it will be appreciated that the following drawings illustrate only certain embodiments of the present invention, therefore be not construed as pair
The restriction of scope, for those of ordinary skill in the art, without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the agarose gel electrophoresis schematic diagram for the nucleic acid molecules that the embodiment of the present invention 1 provides；
Fig. 2 is the protein SDS-PAGE electrophoresis result schematic diagrames of IL-33 after purification that the embodiment of the present invention 3 provides.
Embodiment
, below will be in the embodiment of the present invention to make the purpose, technical scheme and advantage of the embodiment of the present invention clearer
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, builds according to normal condition or manufacturer
The condition of view carries out.Reagents or instruments used without specified manufacturer, is the conventional production that can be obtained by commercially available purchase
Product.
The feature and performance of the present invention are described in further detail with reference to embodiments.
It should be noted that the N-terminal of IL-33 does not have obvious signal peptide, IL-33 is produced as big preproprotein form
Raw and secretion, which needs fully processing, and to discharge the biologically active form of maturation, its maturation protein molecular weight is about
18kDa.276 amino acid of pig IL-33 encoding histones, the 120th amino acids of full length protein are selected as N- ends ammonia
Base acid.
Therefore protein of the present invention for strengthening pig vaccine immune effect, inventor selection expression IL-33C ends (the
120-276 amino acids), using its protein product as adjuvant, and commercial available vaccines combined immunization, so as to strengthen the immune effect of vaccine
Fruit, the selection of the protein is inventor by obtained by performing creative labour.
It should also be noted that, in the embodiment that the present invention is enumerated, RNA extracts kits, RT-PCR kit are purchased
From Promega companies；PMD-19T carriers, escherichia coli DH5a competent cell are purchased from Shanghai life work biotechnology clothes
Be engaged in Co., Ltd.
I enzymes of Nco, I enzymes of Xho, pET28a (+) and T4DNA ligases are purchased from TaKaRa companies, Escherichia coli Rosetta
(DE3) competent cell is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Endotoxin removal resin is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Protein shown in sequence 1 is named as IL-33, the encoding gene of IL-33 is named as IL-33, by what is obtained
PMD-19T carriers containing IL-33 are named as pMD19-IL-33.
Embodiment 1
The nucleic acid molecules for the protein for being used to strengthen pig vaccine immune effect are obtained, method is as follows：
The extraction of pig total serum IgE：With reference to the RNA extracts kit specifications of Promega companies, from pig spleen or lymph node etc.
Pig total serum IgE is extracted in tissue.
The reverse transcription of IL-33 target gene and PCR：Reverse transcription is carried out according to the RT-PCR kit of Promega companies, is obtained
Obtain the cDNA of IL-33-mRNA.Reference pig IL-33 gene orders (No. GeneBank：AB292180), following primer is designed：
IL-33-F120：cccatatgagtatcaaagaacattctgct
IL-33-R276：ccctcgagcattaagtttgagagcttaaatg
Using cDNA as template, PCR amplification is carried out with the primer of design：
PCR reaction conditions are as follows：95 DEG C of pre-degenerations 5 minutes, 1 circulation；95 DEG C are denatured 30 seconds, and 55 DEG C are annealed 30 seconds, and 72
DEG C extension 30 seconds, totally 35 circulation；72 DEG C extend 5 minutes eventually.
And 1% agarose gel electrophoresis is carried out to pcr amplification product, the results are shown in Figure 1, and swimming lane M is in wherein Fig. 1
DNA Marker, swimming lane 1 are negative control, and swimming lane 2 is purpose gene, can be obtained through Fig. 1, the size about 470bp of target gene, with
Actual size is consistent.
PCR product is subcloned into pMD-19T carriers, converts escherichia coli DH5a, picking positive monoclonal carries out gene
Sequencing, sequencing result show that PCR product is as shown in the sequence 2 of sequence table.Albumen shown in sequence 2 shown in gene coded sequence 1
Matter.
Certainly, in other examples, the coding shown in sequence 2 can also be directly obtained by the way of chemical synthesis
Gene.
Embodiment 2
Coli expression carrier IL-33/pET28a (+) is built, method is as follows：
(1) pcr amplification product that embodiment 1 obtains is recycled into enzyme with after I double digestion of restriction enzyme Nco I and Xho
Cut product.
(2) I double digestion carrier pET28a (+) of restriction enzyme Nco I and Xho is used, recycles carrier framework.
(3) digestion products of step (1) are connected with the carrier framework of step (2) with T4DNA ligases, obtains connection production
Thing.
(4) connection product of step (3) is converted into Escherichia coli Rosetta (DE3) competent cell, chooses monoclonal progress
PCR identifies that positive colony upgrading grain carries out sequencing identification, and sequencing result shows, has obtained recombinant plasmid I L-33/pET28a.
The structure description of recombinant plasmid I L-33/pET28a：Carrier pET28a (+) I restriction enzyme site of Nco I and Xho it
Between insert DNA shown in the sequence 2 of sequence table.
Embodiment 3
The recombinant cell containing carrier IL-33/pET28a (+) is prepared, method is as follows：
Escherichia coli Rosetta (DE3) containing pET28a-IL-33 is named as Rosetta-IL-33/pET28a, is obtained
To recombinant cell.
The carrier Rosetta/ that obtained recombinant cell Rosetta-IL-33/pET28a and embodiment 2 are obtained
PET28a is inoculated in the LB culture mediums containing 100mg/mL kanamycins respectively, in 37 DEG C, 150rpm shaken cultivations to OD600
=1, IPTG to final concentration of 0.3mM is then added, 4h is induced in 37 DEG C.
Respectively by before the induction of Rosetta-IL-33/pET28a and Rosetta/pET28a and induction after bacterium solution,
12000rpm centrifuges 10min, collects thalline and is resuspended through PBS, and after carrying out ultrasonic bacteria breaking, 12000rpm centrifugation 15min, take supernatant to precipitate
SDS-PAGE electrophoresis is carried out respectively.
According to SDS-PAGE electrophoresis results, there are a 18KD left sides in Rosetta-IL-33/pET28a testing results display precipitation
Right destination protein band, and there is no destination protein band in supernatant, all detected in the supernatant precipitation of Rosetta/pET28a
Less than destination protein.
Respectively by before the induction of Rosetta-IL-33/pET28a and Rosetta/pET28a and induction after bacterium solution,
10000rpm centrifuges 10min, collects thalline and is resuspended through PBS, and 12000rpm centrifuges 15min after carrying out ultrasonic bacteria breaking, collects thalline, uses
PBS suspends, and 12%SDS-PAGE electrophoresis detections is then carried out, with the constant current transferring film 1.5- of membrane area × 0.65mA every square centimeter
2 it is small when, be put into TBST configuration 5% skim milk in, discarded after decoloration confining liquid (5g skim milks are dissolved in 100mL) plus
Enter TBST (25mM NaCl, 100mMTris, 0.2%Tween-20 are settled to 1000mL), the primary antibody that addition is prepared with confining liquid,
When incubation 3 is small at room temperature, preserved after recycling primary antibody.
Film is put into TBST solution and is decolourized, the secondary antibody rear decoloring that the HRP that addition is prepared with confining liquid is marked, adds TBST
Wash 3 rear decolorings of film, developed, it is fixing develop a film, tabletting.
Wherein, the western blot testing results of Rosetta-IL-33/pET28a generate mesh really after showing induction
Albumen, Rosetta/pET28a induction before and induction after all there is no destination protein signal.Result above shows IL-33 in large intestine
Correctly expressed in bacillus.
Embodiment 4
The separation and purifying of protein, method are as follows：
The recombinant cell Rosetta-IL-33/pET28a that embodiment 4 provides is cultivated, separates, purify from cultured products
To above-mentioned protein.
Specially：Cultured products, i.e. bacterium solution after inducing, 10min is centrifuged in 12000rpm, is collected thalline and is resuspended through PBS,
Carrying out ultrasonic bacteria breaking, 12000rpm centrifugation 15min, collects thalline, is suspended with PBS, and after ultrasonic degradation, 12000rpm centrifugation 30min, are received
Collection precipitation, adds washing buffer (0.5%Triton-100,50mM Tris pH8.0,300mM NaCl, 10mM
EDTA) wash, 12000rpm centrifugation 10-20min, collect precipitation, repeated washing 3 times, goes as far as possible using pipette purging for several times
Except bacterial debris.Precipitation is outstanding with resuspensionbuffer (50mM Tris pH8.0,100mM NaCl, 10mM EDTA)
It is floating.12000rpm centrifuges 10-20min, is dissolved by 30mg/mL urea (8M), 4 DEG C of stirring and dissolvings.12000rpm centrifuges 10-
20min, pours out supernatant, is distributed into 2mL/ pipes, is saved backup in -20 DEG C or -80 DEG C.
IL-33 albumen after purification is taken to carry out SDS-PAGE electrophoresis, testing result is as shown in Fig. 2, wherein, Fig. 2 swimming lanes M is
Molecular weight protein Marker, swimming lane 1 are IL-33 albumen after purification.
The method of dilution refolding is used with 1:Albumen (the renaturation formula of liquid of 20 times of dilution proportions after purification：100mM Tris
PH8.0,400mM L-Arg HCl, 2mM EDTA, 5mMGSH, 0.5mM GSSG, 20% glycerine), then with Millipore'sUltra-15 super filter tubes carry out protein concentration, through Instrument measuring protein concentration be 10mg/mL after concentration, concentrate
Albumen afterwards is saved backup in -20 DEG C or -80 DEG C.
Then, by the IL-33 albumen after concentration after Endotoxin removal resin treatment, this batch of IL-33 albumen endogenous toxic material is detected
Cellulose content is less than 0.2EU/ml, meets the requirement of immune animal, you can.Wherein, remove endotoxin after albumen in -20 DEG C or -
80 DEG C save backup.
Test example 1
IL-33 protein liquids prepared by embodiment 4 are diluted to 10 times of volumes with PBS buffer, obtain the dilution of IL-33 albumen
Liquid (1mg/mL).
Examined 1. being imitated with small white mouse
It is each that (can also be subcutaneously injected) 0.2mL IL-33 are injected intraperitoneally using the healthy mice 10 of weight 14-18g, see
Examine 7.During observation, if there is the adverse reaction such as twitch, death caused by IL-33 is injected, this crowd of IL-33 is sentenced not conform to
Lattice；If there are the adverse reactions such as twitch, death caused by non-IL-33 factors, sentence this school and examine invalid, Ying Chongjian, if without
Examine again, then it is unqualified to sentence this crowd of IL-33.
2. examined with cavy school
It is each that (can also be subcutaneously injected) 1mL IL-33, observation 7 is injected intraperitoneally with the healthy guinea pig 10 of weight 350-400g
Day.During observation, if there is the adverse reaction such as twitch, death caused by IL-33 is injected, it is unqualified to sentence this crowd of IL-33；
If there are the adverse reactions such as twitch, death caused by non-IL-33 factors, sentence this school and examine invalid, Ying Chongjian, if without weight
Inspection, then it is unqualified to sentence this crowd of IL-33.
Security verification through small white mouse and cavy the result shows that, the IL-33 that embodiment 2 obtains is safe, is not drawn
Play any adverse reaction.
Test example 2
IL-33 adjuvants and pseudorabies vaccine immunity swinery clinical test
Material includes：Vaccine：SA215 plants of pseudorabies disease live-vaccine, lot number 201506002, by the mythical animals life of Sichuan China
Tetramune Co., Ltd provides.
Experimental animal：21~28 age in days weanling pigs.
Cell culture associated materials and reagent：PK15 cells are by Sichuan Huashen Animal Biolog Products Co., Ltd.'s livestock and poultry biology
Product Key Laboratory of Sichuan Province provides, and hyclone and DMEM culture mediums are purchased from Thermo Fisher Scientific.
IL-33 diluted protein solutions：IL-33 protein liquids (10mg/mL) prepared by embodiment 4 are diluted to PBS buffer
10 times of volumes, obtain IL-33 diluted protein solutions (1mg/mL).
1. animal immune experimental implementation process
(1) by 21 age in days weanling pig 15,3 groups are randomly divided into.
(2) immunizing dose is used according to vaccine specification, wherein the 1st group uses the IL-33 diluted protein solutions prepared；2nd
Group carries dilution using vaccine；3rd group is not immunized, and is negative control group.
(3) for immune programme to be immunized once, immunization ways are Nasal immunization, are adopted within 7,14,21,28 days before immune and after immune
Collect pig vena cava anterior blood, separate serum, measure neutralizing antibody is horizontal.
(4) body temperature, feeding, the mental status of all pigs are observed after being immunized daily, record relative to control group normally and
Abnormal pig, and the continuous seven days body temperature for measuring pig after immune.
(5) PK-15 cells are conventionally passed on, referring next to《Republic of China Veterinary Pharmacopoeia》2005 editions three
Annex《Neutralize experimental method》The fixed virus diluted blood heat-clearing method of middle record carries out all samples the measure of neutralizing antibody titers.With
Group carries out data statistics for unit.
2. result of the test
(1) each group clinical manifestation situation after being immunized
After being immunized using different diluent dilution pseudorabies disease live-vaccine, piglet body temperature, and feeding, drink are measured daily
Water, the state of mind, METHOD FOR CONTINUOUS DETERMINATION 7 days, shown in statistical result table 1.
Clinicing symptom observation result counts after 1 immune swine pseudorabies living vaccines of table
According to table 1, it is immunized using different diluent dilution pseudorabies disease live-vaccine, all piglet body temperature are equal during test
Less than 40.0 DEG C, the person that has no abnormal body temperature.All test pig feedings, drinking-water, the state of mind are normal.
(2) neutralizing antibody changing rule after being immunized
Piglet serum is gathered before immune and after immune, according to《Republic of China Veterinary Pharmacopoeia》2005 editions require to carry out
Porcine pseudorabies virus neutralizing antibody measures, and neutralizing antibody measurement result is as shown in table 2.
Neutralizing antibody measurement result after 2 immune swine pseudorabies living vaccines of table
It can be obtained by table 2, using the test pig neutralizing antibody average value of IL-33 diluted protein solutions 7,14,21,28 after immune
The average daily different degrees of test pig neutralizing antibody for being higher than common dilution group, use IL-33 diluted protein solutions on the 28th afterwards being immunized
Average value is nearly 2 times of common dilution group, shows IL-33 diluted protein solutions can effectively strengthen pseudorabies disease vaccine
Immune effect.
The data of consolidated statement 1 and table 2, show using IL-33 diluted protein solutions and pseudorabies disease vaccine as novel vaccine
Use, the immune effect of vaccine can be significantly increased, effectively prevent the generation of porcine pseudorabies, there is protection to swinery.
Test example 3
Swinery clinical test is immunized with hog cholera vaccine in IL-33 adjuvants
Material includes：Vaccine：Swine fever heat resisting protective live vaccine (cell source), lot number 201506002, by Sichuan China mythical animals
There is provided with biological products Co., Ltd.
Experimental animal：21~28 age in days weanling pigs.
Hog cholera antibody blocks ELISA detection kit to be purchased from IDEXXX companies.
IL-33 diluted protein solutions：IL-33 protein liquids (10mg/mL) prepared by embodiment 2 are diluted to PBS buffer
10 times of volumes, obtain IL-33 diluted protein solutions (1mg/mL).
1. animal immune experimental implementation process
(1) by 21 age in days weanling pig 15,3 groups are randomly divided into.
(2) immunizing dose is used according to vaccine specification, wherein the 1st group uses the IL-33 diluted protein solutions prepared；2nd
Group carries dilution using vaccine；3rd group is not immunized, as negative control group.
(3) for immune programme to be immunized once, immunization ways are intramuscular injection, are adopted within 7,14,21,28 days before immune and after immune
Collect pig vena cava anterior blood, hog cholera antibody measure is carried out after separating serum.
(4) body temperature, feeding, the mental status of all pigs are observed after being immunized daily, record relative to control group normally and
Abnormal pig, and the continuous seven days body temperature for measuring pig after immune.
(5) measure of ELISA antibody kits specification progress hog cholera antibody is blocked according to swine fever.Carried out in units of group
Data statistics.
2. result of the test
(1) each group clinical manifestation situation after being immunized
It is daily to measure piglet body after being immunized using different diluent dilution swine fever heat resisting protective live vaccine (cell source)
Temperature, and feeding, drinking-water, the state of mind, even shown in statistical result table 3.
Clinicing symptom observation result statistics after table 3 is immune
According to table 3, after being immunized using different diluent dilution swine fever heat resisting protective live vaccine, all sons during test
Temperature of pig body is below 40.0 DEG C, the person that has no abnormal body temperature.And all test pigs search for food, drink water, the state of mind is normal.
2. antibody change after immune
Serum is gathered before immune and after immune, is carried out according to kit specification hog cholera antibody titration, measure knot
Fruit statistics is as shown in table 4.
Swine fever blocks ELISA antibody determination results after table 4 is immune
It can be obtained by table 4,21,28 days after being immunized, all pig antibody of test group are the positive, and are diluted using IL-33 albumen
Liquid group antibody blocking rate is above conventional dilution liquid group, and control group, i.e., the 3rd group before immune and it is immune after 7,14,21,
Antibody was feminine gender on 28th.Therefore, the immune effect that vaccine can be significantly increased using IL-33 diluted protein solutions group is illustrated.
The data of consolidated statement 3 and table 4, showing can be as new epidemic disease using IL-33 diluted protein solutions and existing hog cholera vaccine
Seedling uses, while IL-33 diluted protein solutions can significantly increase the immune effect of hog cholera vaccine, effectively prevents the generation of swine fever,
There is protection to swinery.
In conclusion the protein and its application that are used to strengthen pig vaccine immune effect of the offer of the embodiment of the present invention,
For strengthen the protein of pig vaccine immune effect in Escherichia coli can high efficient expression, expression quantity reaches the 50% of bacterial protein
More than, and its preparation manipulation is simple, the cycle is short, of low cost, specificity is good.It is applied to enhancing pig vaccine to be immunized, specifically
By itself and commercial available vaccines combined immunization, antigen immunocompetence can be improved, strengthens immune effect of vaccine, is highly suitable for virus diseases of pigs
Prevention, be easy to promote and apply on a large scale.
Embodiments described above is part of the embodiment of the present invention, instead of all the embodiments.The reality of the present invention
The detailed description for applying example is not intended to limit the scope of claimed invention, but is merely representative of the selected implementation of the present invention
Example.Based on the embodiments of the present invention, those of ordinary skill in the art are obtained without creative efforts
Every other embodiment, belongs to the scope of protection of the invention.
SEQUENCE LISTING
<110>Sichuan Huashen Animal Biolog Products Co., Ltd.
<120>A kind of protein and its application for being used to strengthen pig vaccine immune effect
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 157
<212> PRT
<213> swine
<400> 1
Ser Ile Lys Glu His Ser Ala Ser Leu Ser Thr Tyr Asn Asp His Tyr
1 5 10 15
Ile Thr Phe Ala Phe Glu Asp Gly Ser Tyr Glu Ile Tyr Val Glu Asp
20 25 30
Leu Arg Lys Asp Gln Glu Lys Asp Lys Val Leu Leu Arg Tyr Tyr Asp
35 40 45
Ser Gln Ile Pro Ser Ser Glu Thr Asp Gly Gly Gly Asp His Arg Lys
50 55 60
Leu Met Val Asn Leu Ser Pro Thr Lys Asp Lys Asp Phe Leu Leu His
65 70 75 80
Ala Asn Ser Lys Glu His Ser Val Glu Leu Gln Lys Cys Glu Asn Pro
85 90 95
Leu Pro Glu Gln Ala Phe Phe Val Leu His Glu Gln Pro Ser Lys Cys
100 105 110
Val Ser Phe Glu Cys Lys Ser His Pro Gly Val Phe Leu Gly Val Lys
115 120 125
Asn Asn Gln Leu Ala Leu Ile Lys Leu Gly Glu His Pro Glu Asp Ser
130 135 140
Asn Arg Glu Asn Thr Thr Phe Lys Leu Ser Asn Leu Met
145 150 155
<210> 2
<211> 471
<212> DNA
<213> swine
<400> 2
agtatcaaag aacattctgc ttctctcagt acatataacg atcactacat tacttttgct 60
tttgaggatg gaagttatga gatctatgtt gaagacttga gaaaagacca agagaaagat 120
aaggtgttac tccgttacta tgattcccaa atcccctcaa gtgaaacaga tggtggtggt 180
gatcatcgga aattaatggt aaacctgagc cccacaaaag acaaagattt cttgctgcat 240
gccaacagta aggagcattc tgtggagcta caaaaatgtg aaaacccact gccagaacag 300
gccttctttg tccttcatga gcagccctcc aaatgtgttt catttgaatg taagagccat 360
cctggagtgt ttctaggagt aaagaataac cagctagctc taatcaaact aggggaacac 420
cctgaggatt caaatagaga gaataccaca tttaagctct caaacttaat g 471
Claims (10)
- A kind of 1. protein for being used to strengthen pig vaccine immune effect, it is characterised in that its amino acid sequence such as (a) or (b) institute Show：(a)SEQ ID NO.1；(b) amino acid sequence of SEQ ID NO.1 is passed through to the substitution of one or several amino acid residues And/or lack and/or add and there is the derived sequence with identical promotion immunocompetence with SEQ ID NO.1.
- 2. the nucleic acid molecules of coding protein as claimed in claim 1.
- 3. nucleic acid molecules according to claim 2, it is characterised in that its base sequence is as shown in SEQ ID NO.2.
- 4. a kind of carrier, it is characterised in that it contains claim 2-3 any one of them nucleic acid molecules.
- 5. a kind of recombinant cell, it is characterised in that it contains carrier as claimed in claim 4.
- It is 6. protein as claimed in claim 1, nucleic acid molecules as claimed in claim 2 or claim 3, as claimed in claim 4 Carrier or application of the recombinant cell in pig vaccine immunopotentiator is prepared as claimed in claim 5.
- A 7. boar vaccine immunopotentiator, it is characterised in that it includes：Protein as claimed in claim 1 is such as weighed Profit requires the recombinant cell described in 5.
- 8. a kind of preparation method of protein as claimed in claim 1, it is characterised in that include the following steps：Culture is as weighed Profit requires the recombinant cell described in 5, is separated from cultured products, purifying obtains the protein.
- 9. preparation method according to claim 8, it is characterised in that the recombinant cell is Escherichia coli.
- A 10. boar vaccine, it is characterised in that it includes protein as claimed in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711243051.7A CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711243051.7A CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107973849A true CN107973849A (en) | 2018-05-01 |
| CN107973849B CN107973849B (en) | 2020-07-28 |
Family
ID=62008819
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711243051.7A Active CN107973849B (en) | 2017-11-30 | 2017-11-30 | Protein for enhancing immunity effect of pig vaccine and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107973849B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111925416A (en) * | 2020-08-26 | 2020-11-13 | 中国农业科学院兰州兽医研究所 | Polypeptide for promoting pig body to generate broad-spectrum acquired immune response and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008132709A1 (en) * | 2007-04-26 | 2008-11-06 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth, Near Dublin | Products for altering il-33 activity and methods therefor |
| CN103966253A (en) * | 2014-05-30 | 2014-08-06 | 中国科学技术大学 | Method for efficiently preparing recombinant human interluekin-33 protein |
| CN105744953A (en) * | 2013-10-07 | 2016-07-06 | 宾夕法尼亚大学理事会 | Vaccines with interleukin-33 as an adjuvant |
| JP2017008003A (en) * | 2015-06-25 | 2017-01-12 | 田辺三菱製薬株式会社 | Human anti-IL-33 neutralizing monoclonal antibody |
| CN108064236A (en) * | 2015-03-31 | 2018-05-22 | 免疫医疗有限公司 | Novel IL33 forms, the mutant form of IL33, antibody, measure and its application method |
-
2017
- 2017-11-30 CN CN201711243051.7A patent/CN107973849B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008132709A1 (en) * | 2007-04-26 | 2008-11-06 | Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth, Near Dublin | Products for altering il-33 activity and methods therefor |
| CN105744953A (en) * | 2013-10-07 | 2016-07-06 | 宾夕法尼亚大学理事会 | Vaccines with interleukin-33 as an adjuvant |
| CN103966253A (en) * | 2014-05-30 | 2014-08-06 | 中国科学技术大学 | Method for efficiently preparing recombinant human interluekin-33 protein |
| CN108064236A (en) * | 2015-03-31 | 2018-05-22 | 免疫医疗有限公司 | Novel IL33 forms, the mutant form of IL33, antibody, measure and its application method |
| JP2017008003A (en) * | 2015-06-25 | 2017-01-12 | 田辺三菱製薬株式会社 | Human anti-IL-33 neutralizing monoclonal antibody |
Non-Patent Citations (1)
| Title |
|---|
| LEE E.J.ET AL.: "interleukin-33 [Sus scrofa]", 《NCBI REFERENCE SEQUENCE: NP_001272907.1》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111925416A (en) * | 2020-08-26 | 2020-11-13 | 中国农业科学院兰州兽医研究所 | Polypeptide for promoting pig body to generate broad-spectrum acquired immune response and application thereof |
| CN111925416B (en) * | 2020-08-26 | 2021-12-17 | 中国农业科学院兰州兽医研究所 | Polypeptide for promoting pig body to generate broad-spectrum acquired immune response and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107973849B (en) | 2020-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103319602B (en) | Vaccine carrier | |
| US20140112948A1 (en) | Multi-Target Recombination Gene and the Application of its Protein to Prevent and Cure Helicobacter Pylori | |
| CN109880838B (en) | Recombinant virus for secretory expression of pig O-type foot-and-mouth disease virus multi-epitope gene and preparation method and application thereof | |
| CN104884616B (en) | The method of Limulus factor C albumen is prepared by recombinant in protozoan | |
| CN110872578B (en) | Variant infectious bursal disease virus, subunit vaccine, preparation method and application thereof | |
| CN108586618A (en) | A kind of preparation and application of pig epidemic diarrhea subunit vaccine | |
| CN101624422A (en) | Schistosoma japonicum recombinant multi-epitope antigens, method for expressing and purifying same and application thereof | |
| Khademi et al. | Prevalence of C. burnetii DNA in sheep and goats milk in the northwest of Iran | |
| CN103788190B (en) | β-1,3-glucosan identification albumen and its preparation method and application | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| US11534485B2 (en) | Vaccine used for preventing toxoplasma gondii infection and preparation method therefor | |
| CN107973849A (en) | A kind of protein and its application for being used to strengthen pig vaccine immune effect | |
| CN103184225A (en) | Taenia multiceps antigen gene and recombinant protein and application thereof | |
| CN107551265A (en) | A kind of vaccine for pigs trichina disease and its preparation method and application | |
| CN104804099B (en) | A kind of reinforced polyepitope vaccines of recombination H9N2 subtype avian influenza | |
| CN109021115B (en) | Porcine circovirus trivalent subunit vaccine | |
| CN103243105B (en) | A kind of Trichina recombinant protein and application | |
| CN100567492C (en) | Sheep coenurosis specific gene and separation thereof and evaluation | |
| CN108101974B (en) | Fasciola hepatica multi-epitope fusion diagnostic antigen and application and preparation method thereof | |
| CN106226520A (en) | Antigen of mycobacterium tuberculosis albumen Rv0865 and the application of B cell epitope peptide thereof | |
| CN105753949B (en) | A kind of erysipelothrix rhusiopathiae antigen albumen and application | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN103131719B (en) | Taenia multiceps enolase TmENO recombinant protein with immunizing protection | |
| CN110092840A (en) | A kind of infectious laryngotracheitis of chicken, egg drop syndrome bigeminy polyepitope vaccines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 610225 No.6, Muke Road, xihanggang Avenue, Southwest Airport Economic Development Zone, Shuangliu District, China (Sichuan) pilot Free Trade Zone, Chengdu, Sichuan Province Applicant after: Livestock Bioengineering Co., Ltd Address before: 610000 Chengdu, Sichuan Shuangliu District, Southwest China Airport Economic Development Zone, West Hang Kong Road, animal husbandry Road No. 6 Applicant before: Sichuan Huashen Animal Biolog Products Co., Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |