CN105543263A - Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application - Google Patents

Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application Download PDF

Info

Publication number
CN105543263A
CN105543263A CN201610054950.1A CN201610054950A CN105543263A CN 105543263 A CN105543263 A CN 105543263A CN 201610054950 A CN201610054950 A CN 201610054950A CN 105543263 A CN105543263 A CN 105543263A
Authority
CN
China
Prior art keywords
promoter
vgb
gene
vitreoscilla hemoglobin
puc19
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610054950.1A
Other languages
Chinese (zh)
Inventor
李正强
李海超
米梦丹
张作明
许浩然
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jilin University
Original Assignee
Jilin University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jilin University filed Critical Jilin University
Priority to CN201610054950.1A priority Critical patent/CN105543263A/en
Publication of CN105543263A publication Critical patent/CN105543263A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/02—Carbon-oxygen lyases (4.2) acting on polysaccharides (4.2.2)
    • C12Y402/02002—Pectate lyase (4.2.2.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a vitreoscilla hemoglobin visual label fused protein expression system, a construction method and application of the system to protein purification and belongs to the technical field of bioengineering. A segment of anaerobic promoter sequence is added to the upstream portion of a vitreoscilla hemoglobin gene, the downstream portion is connected with a target gene of thermophilic alkaline pectinase through a link group (the target gene does not have uniqueness), pUC19 serves as an expression vector, coexpression is achieved in escherichia coli E. coli BL21(DE3), and 20 mg of fused protein can be obtained per liter of culture media; due to the fact that the fused protein is in a bright red color, tracking is facilitated, purification difficulty is greatly lowered, and quite high reference value is achieved in the protein purification field.

Description

A kind of Vitreoscilla hemoglobin visual mark expressing fusion protein system, construction process and application
Technical field
The invention belongs to technical field of bioengineering, be specifically related to a kind of Vitreoscilla hemoglobin visual mark expressing fusion protein system, construction process and the application in protein purification thereof.
Background technology
In the research of protein structure group, obtain highly purified protein and be very important, in the structure function and interactional research of protein, usually need high, the folding correct protein of purity.So how can be purified the single target protein of derived components is the problem that everybody pays close attention to all the time.In 20th century, fusion tag technology is a kind of gene recombination technology that recent development is got up, and its major technique holds at the 5 ' end or 3 ' of target protein gene group the encoding gene inserting certain label, builds the genome sequence merged.Then expressed by suitable Host Strains, the specificity medium of the label by merging and solid phase combines by the fusion rotein of expression, thus substantially increases the efficiency of protein purification, also makes Protein purification techniques become easier.In recent years, along with the development of protein tag technology, its function also becomes more and more diversified, but is mainly used in the purifying of albumen.
Finding in the researching and analysing of fusion rotein, the purification efficiency of label to albumen of fusion rotein has a great impact.Compare with traditional Protein purification techniques, fusion rotein label technique makes protein purification speed accelerate, and protein content increases, and has not only saved time and cost, and has improve efficiency.Learn in the research to protein structure and function simultaneously, fusion tag is also creating very important effect to the physico-chemical property of target protein and configuration aspects, is mainly manifested in three aspects: the content adding fusion rotein, the solubleness adding fusion rotein, facilitate the folding of fusion protein molecule.
Vitreoscilla hemoglobin (Vitreoscillahemoglobin, VHb) be the comparatively deep oxygen associated proteins of a kind of current research, be present in animals and plants and microorganism widely, also be find the earliest at present, to the prokaryotic organism oxyphorase the most thorough that its structure and function is studied.Vitreoscilla hemoglobin is made up of two identical subunits and two b type protohemes, and molecular weight is 16kDa, and each subunit has 146 amino acid, has peroxidase activity.No matter Vitreoscilla hemoglobin is express in prokaryotic organism or in yeast, concentration and the speed of growth of cell can both be increased, the output of fusion rotein is increased, increases antibiotic output, especially under anoxic conditions, biological restoration function will have greatly improved.Just because of this superiority that VHb molecule itself has, it is made to be obtained application by as a kind of visual mark.
Vitreoscilla hemoglobin is a kind of anaerobism albumen, but its expression can promote the growth of bacterium, and research finds, presents certain corresponding relation between both.When oxygen concentration is very low, be below about 5%, the expression amount of Vitreoscilla hemoglobin can be improved by contrast on the contrary, and the simultaneously growth of bacterium is also corresponding to be improved.When the expression amount of Vitreoscilla hemoglobin acquires a certain degree, the speed of growth of bacterium no longer increases, and remains on a corresponding level.The overexpression of Vitreoscilla hemoglobin can produce toxicity to Host Strains, the death of host bacterial may be caused, thus make the biological function of Vitreoscilla hemoglobin can not get playing, so in host bacterial, the expression of Vitreoscilla hemoglobin must control within a corresponding horizontal extent.Vitreoscilla hemoglobin gene has a very strong promotor (its natural promoter is anaerobism promotor), if Vitreoscilla hemoglobin gene is connected in the plasmid of a high copy, certainly will make Vitreoscilla hemoglobin overexpression, thus toxicity is produced to host bacterial, this is unfavorable for the biological function research of Vitreoscilla hemoglobin on the contrary.So be connected to by Vitreoscilla hemoglobin gene in the plasmid of low copy, perhaps produced problem above can be avoided.Thus Vitreoscilla hemoglobin can enoughly be expressed, and be conducive to the growth promoting host bacterial, thus be unlikely to occur that the overexpression of Vitreoscilla hemoglobin makes the burden of protein expression too heavy, define nonactive dimer, the folding enzymes structure of Host Strains is made a mistake, thus has destructive influences to the growth of host bacterial.
We apply Vitreoscilla hemoglobin as a kind of fusion tag in the present invention, its gene and a kind of colourless alkaline pectinase gene CD deriving from hot clostridium Caldicellulosiruptorbescii6275 are merged, express a kind of fusion rotein, fusion rotein will bring redness, make colourless alkaline pectase CD also can bring redness, can be very easy to like this follow the tracks of and alkaline pectase CD detected in follow-up purge process.Vitreoscilla hemoglobin is a kind of 16kDa small molecular weight protein, and solubleness is high, no matter is express in prokaryotic organism or in yeast, can both increases concentration and the speed of growth of cell, the output of fusion rotein is increased.Just because of this superiority that Vitreoscilla hemoglobin molecule itself has, it is made to be obtained application by as a kind of visual mark.Alkaline pectase CD molecular weight is 22kDa, and character is clear, and structure is simple, but owing to being a kind of without chromoprotein, in follow-up purge process, being difficult to follow the tracks of and monitoring, thus making protein purification procedures become difficulty.So our imagination Vitreoscilla hemoglobin is as fusion tag, and alkaline pectase CD amalgamation and expression, make alkaline pectase CD also bring redness, convenient colourless albumen sepn and purifying originally.
Summary of the invention
First object of the present invention is to provide a kind of construction process of novel transparent Tremellineae haemoglobin visual mark expressing fusion protein system.
Second object of the present invention is to provide a kind of preparation method of novel transparent Tremellineae haemoglobin visual mark fusion rotein.
Up to the present Vitreoscilla hemoglobin gene is widely studied, its natural promoter is anaerobism promotor, transcribe if the promotor carried with carrier starts, induce with IPTG, then affect the growth of thalline, the final expression amount of albumen is also very low, therefore we synthesize one section of anaerobism promoter sequence, HindIII and BbsI restriction enzyme site (being synthesized by Sangon Biotech (Shanghai) Co., Ltd.) is added respectively at 5 ' end and 3 ' end, this anaerobism promoter sequence is connected with after pUC19 expression vector respectively double digestion, obtain recombinant vectors pUC19+promoter, with Vitreoscilla genome for template, design primer, reacts acquisition 3 ' by PCR and holds the Vitreoscilla hemoglobin gene sequence vgb ' (5 ' end and 3 ' end restriction enzyme site are respectively BbsI and PstI) linking group and thrombin cleavage site gene containing glycine, this gene order vgb ' is connected with after recombinant vectors pUC19+promoter respectively double digestion, obtains recombinant vectors pUC19+promoter+vgb ', with pET20b (+)-PelC-CD for template, design primer, reacts amplification by PCR and obtains 3 ' the thermo philic alkali pectin lyase gene C D of end containing 6 histidine-tagged genes (5 ' end and 3 ' end restriction enzyme site are respectively PstI and BamH I), this gene C D is connected with after recombinant vectors pUC19+promoter+vgb ' respectively double digestion, obtains recombinant vectors pUC19+promoter+vgb '+CD, recombinant vectors pUC19+promoter+vgb '+CD is transformed in escherichia coli expression host E.coliBL21 (DE3), obtain visual mark expressing fusion protein system (i.e. recombinant bacterium), the plasmid map schematic diagram obtained as shown in Figure 2.
Visual mark expressing fusion protein system (recombinant bacterium) will be obtained and be first transferred to large system (4LLB substratum/5L Erlenmeyer flask) LB substratum amplification 16 ~ 24h (170 ~ 200r/min, 37 DEG C) again with after the activation of little system (20mLLB substratum/50mL Erlenmeyer flask) LB substratum; Then in confined conditions, shaking speed is transferred to 100 ~ 120r/min, and temperature drops to 25 DEG C, starts expressed fusion protein, expression time 24 ~ 36h; 4000r/min ~ 6000r/min collected by centrifugation thalline, with the damping fluid of pH=7 ~ 8 (as Tris-HCl, PBS etc., determine according to the different target protein connected) dissolve thalline, fusion rotein is obtained by ultrasonication, Ni-NTA affinity chromatography, dialysis, its aminoacid sequence, as shown in SEQIDNO.3, omnidistancely can follow the tracks of albumen whereabouts by range estimation.The fusion rotein of expressing with this recombinant bacterium not only has alkaline pectin enzymic activity, also has the peroxidase activity of Vitreoscilla hemoglobin.Learnt by Activity determination, the Vitreoscilla hemoglobin visual mark of front end is little to alkaline pectase effect of vigor.If there is the necessity removing visual mark, can by the Ni-NTA affinity chromatography that tries again after zymoplasm cleavage of fusion proteins, it is Vitreoscilla hemoglobin visual mark and zymoplasm that stream wears liquid, due to identical chromatography column, histidine-tagged or in target protein side, therefore the colourless target protein of wash-out imidazole concentration used and elution volume and wash-out fusion rotein is the same, does not need monitoring equally.
E. coli BL21 (DE3) used in the present invention is the host cell generally used in a kind of this area, and prokaryotic expression carrier pUC19 is also the art common carrier, and the two all obtains by commercial sources; Genetic engineering bacterium with alkaline pectase CD gene is built by this laboratory, can obtain, bacterium numbering CGMCCNO.11461 from China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC); The source bacterial strain vitreoscilla of Vitreoscilla hemoglobin gene can buy at American Type Culture Collecti (ATCC), and this gene also can synthetic; Gene chemical synthesis and examining order are completed by Sangon Biotech (Shanghai) Co., Ltd..
Accompanying drawing explanation
Fig. 1: be promoter+vgb '+CD gene sequencing spectrogram.
Fig. 2: be pUC19+promoter+vgb '+CD fusion expression vector plasmid map (vgb ' comprise Vitreoscilla hemoglobin gene+glycine link group gene+thrombin cleavage site gene).
Fig. 3: for containing pUC19+promoter+vgb '+CD fusion expression vector recombinant bacterium ultrasonication after, the color camera (redness) of supernatant liquor.
Fig. 4: be SDS-PAGE protein electrophoresis figure of fusion rotein, Vitreoscilla hemoglobin, alkaline pectase CD, wherein 1 road is Marker, 2 roads are alkaline pectase CD, 3 roads are fusion rotein, 4 roads are Vitreoscilla hemoglobin VHb.
Fig. 5: for fusion rotein, go the cracking pectin of the alkaline pectase CD of visual mark to compare vigor.
SEQIDNO.1 is promoter+vgb ' nucleotide sequence.
SEQIDNO.2 is the nucleotide sequence of fusion gene vgb '+CD.
SEQIDNO.3 is the aminoacid sequence of fusion rotein vgb '+CD.
Embodiment
The experimental technique used in following embodiment if no special instructions, is normal experiment method.
The consumptive material used in following embodiment, reagent, instrument, if no special instructions, all can obtain from commercial channels.
NanoDrop microspectrophotometer is used to detect nucleic acid/protein concentration in following embodiment.
Embodiment 1: containing the structure of the original recombinant bacterium of pUC19+promoter+vgb ' carrier
Anaerobism promoter sequence (promoter) as follows is synthesized by Sangon Biotech (Shanghai) Co., Ltd.: GGTCTCGGATCC aAGCTTaCAGGACGCTGGGG tTAAAAGTATTTGAGTTTTGATGTGGATTAAGTTTTAAGAGG cAATAAAGATTATAATAAgTGCTGCTACACCATACTGATGTATGGCAAAACCATAATAATGAACTTAAG gAAGACcCTCATGTTAGA
Wherein AAGCTT is HindIII restriction enzyme site, and GAAGAC is BbsI restriction enzyme site (the non-palindromic sequence of this restriction enzyme site), and the 33 to 92 Nucleotide is anaerobism promoter gene sequence.
Anaerobism promoter sequence HindIII and BbsI37 DEG C is carried out double digestion 12h, and pUC19 expression vector HindIII and BbsI37 DEG C carries out double digestion 3h, system following (20 μ L):
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 100bp and 2700bp fragment respectively.
Anaerobism promoter sequence after gel is reclaimed and the 16 DEG C of connections of pUC19 expression vector are spent the night, system following (20 μ L):
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 2800bp fragment, i.e. pUC19+promoter.
With Vitreoscilla genome for template (extracting test kit by bacterial genomes to extract from Vitreoscilla bacterium), design primer, react acquisition 3 ' by PCR and hold the Vitreoscilla hemoglobin gene sequence vgb ' linking group and thrombin cleavage site gene containing glycine, design of primers is as follows:
Upstream primer:
5’CTTAAG GAAGACCCTCATGTTAGACCAGCAAACCATTAA3’
Downstream primer:
5’AAAA CTGCAGGCTGCCGCGCGGCACCAGGCCTCCGCCTCCGCCTTCAACCGCTTGAGCGTACAAATC3’
Wherein GAAGAC is BbsI restriction enzyme site, and CTGCAG is PstI restriction enzyme site, and GGCGGAGGCGGAGGC is glycine link group, and CTGGTGCCGCGCGGCAGC is thrombin cleavage site gene (writes in downstream primer and want reverse complemental).
PCR reaction system is as follows: (primer concentration is 20 μm of ol/L)
PCR reaction conditions: 94 DEG C of denaturation 10min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min, 30 rear 72 DEG C of extension 10min of circulation, 4 DEG C of preservations.
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 600bp fragment, i.e. vgb '.
Vgb ' gene BbsI and PstI37 DEG C of double digestion 12h, pUC19+promoter carrier BbsI and PstI37 DEG C of double digestion 3h, system following (20 μ L):
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 600bp and 2800bp fragment respectively.
Vgb ' gene after gel is reclaimed and the 16 DEG C of connections of pUC19+promoter carrier are spent the night, and obtain recombinant vectors pUC19+promoter+vgb ', system following (20 μ L):
The preparation of competent cell: by E.coliBL21 (DE3) at line LB plate culture medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, agar 15g/L) upper picking list bacterium colony, be inoculated into LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L) in.37 DEG C of shaking culture.Measure OD 600value, works as OD 600when value reaches 0.3 (approximately cultivate 3 ~ 4 hours, this is the key of Success in Experiment).Get above-mentioned bacterial culture fluid in 50mL centrifuge tube, place 10min on ice.4 DEG C of centrifugal 10min (4000r/min), pour out substratum, are inverted the mouth of pipe so that substratum flows to end.With the 0.1mol/LCaCl of ice-cold (4 DEG C) 210mL suspension cell precipitates, and places 30min on ice.4 DEG C of centrifugal 10min (4000r/min).Pour out supernatant liquor, with ice-cold 0.1mol/LCaCl 22mL suspension cell precipitation (must be placed on ice).Packing cell, what add precooling contains 30% (v/v) glycerine, and often pipe 200 μ L packing ,-80 DEG C of Refrigerator stores, this cell is competent cell.This recipient cell can be directly used in the transformation experiment of DNA, also in-80 DEG C of Refrigerator stores, can use in order to later.When-80 DEG C of Refrigerator stores, can effectively preserve more than 1 year, but can not multigelation, once freeze thawing ,-80 DEG C of Refrigerator stores can not be carried out again.
The preparation of recombinant bacterial strain: it is the competent cell E.coliBL21 (DE3) of-80 DEG C of Refrigerator stores is placed in ice melt 5min that the DNA of competent cell transforms.Add and connect product pUC19+promoter+vgb ' 2 μ L (50ng), place 30min on ice after mixing gently.After placing 90s in 42 DEG C of water-baths, in ice, place 3min immediately.Often pipe adds the LB substratum of 800 μ L, cultivates 1h (160r/min) for 37 DEG C.Get appropriate spread plate, flat-plate inverted is placed in 37 DEG C of incubators and cultivates a night.Picking list bacterium colony was equipped with in 6mL and shook to muddiness in the test tube of LB substratum next day, get 100 μ L bacterium liquid to add 100 μ L30% (v/v) glycerine and be stored in-80 DEG C of refrigerators, the little extraction reagent kit of residue bacterium liquid plasmid extracts plasmid DNA order-checking, and promoter+vgb ' (i.e. anaerobism promotor+VHb gene vgb+ glycine link group+thrombin cleavage site) correct sequencing result is as shown in SEQIDNO.1.
Embodiment 2: containing the structure of the recombinant bacterium of pUC19+promoter+vgb '+CD fusion expression vector
With pET20b (+)-PelC-CD be template (with bacterial genomes extract test kit extract from the genetic engineering bacterium of CGMCCNO.11461), design primer, by PCR method amplification alkaline pectase CD gene, amplified production is carried out agarose gel electrophoresis, reclaims purifying 600bp.Design of primers is as follows:
Upstream primer:
5’AAAA CTGCAGATGGGTGGTGTTTTAGTATTACAGATACAATAATTGTAAAATC3’
Downstream primer:
5’CGC GGATCCTCA GTGGTGGTGGTGGTGGTGCTCGAGGTATTGATGTATCGTGATGGGA3’
Wherein CTGCAG is PstI restriction enzyme site, and GGATCC is BamHI restriction enzyme site, and CACCACCACCACCACCAC is histidine-tagged (write in downstream primer is reverse complementary sequence).
PCR reaction system is as follows: (primer concentration is 20 μm of ol/L)
PCR reaction conditions: 94 DEG C of denaturation 10min, 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 1min, 30 rear 72 DEG C of extension 10min of circulation, 4 DEG C of preservations.
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 600bp fragment, i.e. alkaline pectinase gene CD.
Alkaline pectinase gene CD BamHI and PstI37 DEG C of double digestion 12h, pUC19+promoter+vgb ' carrier BamHI and PstI37 DEG C of double digestion 3h, system following (20 μ L):
Agarose gel electrophoresis, reclaims test kit with DNA gel and reclaims 600bp and 3400bp fragment respectively.
Alkaline pectinase gene CD after gel is reclaimed and the 16 DEG C of connections of pUC19+promoter+vgb ' carrier are spent the night, and obtain final recombinant expression vector pUC19+promoter+vgb '+CD, system following (20 μ L):
The preparation of recombinant bacterial strain: the competent cell E.coliBL21 (DE3) of-80 DEG C of Refrigerator stores is placed in ice and melts 5min.Add and connect product pUC19+promoter+vgb '+CD2 μ L (50ng), place 30min on ice after mixing gently.After placing 90s in 42 DEG C of water-baths, in ice, place 3min immediately.Often pipe adds the LB substratum of the pre-temperature of 800 μ L, cultivates 1h (160r/min) for 37 DEG C.Get appropriate spread plate, flat-plate inverted is placed in 37 DEG C of incubators and cultivates a night.Picking list bacterium colony was equipped with in 6mL and shook to muddiness in the test tube of LB substratum next day, get 100 μ L bacterium liquid to add 100 μ L30% (v/v) glycerine and be stored in-80 DEG C of refrigerators, the little extraction reagent kit of residue bacterium liquid plasmid extracts plasmid DNA order-checking, and the correct result of antigen-4 fusion protein gene vgb '+CD is as shown in SEQIDNO.2.
Embodiment 3: the preparation and purification of fusion rotein
Preparation seed liquor: the recombinant bacterium obtained in embodiment 2 is seeded to 5 ‰ (v/v) and is equipped with in the 50mL Erlenmeyer flask of 20mL seed culture medium, 37 DEG C, 170r/min vibrates 8h to OD 600=6.0, obtain seed liquor; The solvent of described seed culture medium is water, and solute and the final concentration at described seed culture medium thereof are respectively: Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L; The pH value of substratum is 7.0.
Fermentation culture: get seed liquor and be seeded to (volume ratio of substratum and Erlenmeyer flask is conducive to greatly anaerobism and expresses) in the Erlenmeyer flask of the 5L that 4L fermention medium is housed with the inoculum size of 5 ‰ (v/v); First 37 DEG C, 170r/min shaking culture 16h, then shuts bottleneck with sizeable sealed membrane, 25 DEG C, 110r/min continues shaking culture 30h, acquisition fermented liquid.
Described fermention medium identical with foregoing seed culture based component (being LB substratum, seed culture medium 20mL, fermention medium 4L).
By in above-mentioned steps obtain the centrifugal 10min of fermented liquid 6000r/min, abandon supernatant, collect thalline (1L bacterium liquid collect one pipe, put into-20 DEG C of preservations);
Point isolated fusion protein from this thalline, concrete grammar is as follows:
The formula of damping fluid 10 × Tris-HCl (200mM): get 24.2gTris-base and be placed in 1L beaker, adds the abundant stirring and dissolving of about 800mL deionized water, adjusts pH to 8.0, solution volumetric flask is settled to 1L, 4 DEG C of preservations with 1mol/LHCl.10 times are diluted during use.
Fusion protein purification process: the thalline of centrifugal rear acquisition is dissolved in 20mM, pH8.0Tris-HCl damping fluid according to the ratio of 1g/10mL, be placed in ultrasonication 30min on ice, when bacterium liquid is become bright from viscous pasty state, 4 DEG C, the centrifugal 20min of 12000r/min, collection supernatant protein liquid (red, as shown in Figure 3); By supernatant protein liquid by the process of Ni-NTA affinity chromatography, first wash with the damping fluid not containing imidazoles the foreign protein not hanging up pillar, then use 50mM imidazoles-Tris-HCl wash-out, obtain eluted protein liquid; Whole process collects albumen by range estimation.Namely the protein liquid that eluted protein liquid dialysed overnight obtains adds the fusion rotein of visual mark, and often liter of bacterium liquid can ferment and produce 20mg fusion rotein, and its aminoacid sequence is as shown in SEQIDNO.3.SDS-PAGE protein electrophoresis figure as shown in Figure 4.(remove Vitreoscilla hemoglobin label if necessary, can first use zymoplasm cleavage of fusion proteins, then try again Ni-NTA affinity chromatography, first by the buffer solution elution not containing imidazoles, it is Vitreoscilla hemoglobin visual mark and zymoplasm that stream wears liquid, due to identical chromatography column, histidine-tagged or in target protein side, therefore the colourless target protein of wash-out imidazole concentration used and elution volume and wash-out fusion rotein is the same, does not need monitoring.)
Embodiment 4: the vitality test of fusion rotein
Fusion rotein neutral and alkali pectinase activity measuring method is specific as follows:
The preparation of substrate: take 0.2g polygalacturonic acid and be placed in 100mL beaker, add and be about dissolved in the abundant stirring and dissolving of 80mL, 50mMGly, adjust pH to 9.5 with 1mol/LNaOH, solution volumetric flask is settled to 100mL, is made into the substrate of 0.2% (w/v).
Control group: add 100 μ L, 0.8mM, CaCl in 800 μ L substrates 2, 70 DEG C of preheating 1min, add the Tris-HCl of 100 μ L, 20mM, pH8.0, measure the absorbance of 235nm in 1min;
Experimental group: add 100 μ L, 0.8mM, CaCl in 800 μ L substrates 2, 70 DEG C of preheating 1min, add 100 μ L, 10 -3the fusion rotein solution of μm ol/mL, measures the absorbance of 235nm in 1min.
The standard enzyme unit (1U) alive of alkaline pectase is defined as: under these conditions, make polygalacturonic acid produce the enzyme amount needed for unsaturated polygalacturonic acid of 1 μm of ol in the 1min reaction times.
Alkaline pectase enzyme (U/mL) calculation formula alive is as follows:
In formula: 4600 (Lmol -1cm -1) for unsaturated polyester galacturonic acid is at the molar absorptivity at 235nm place
The Rate activity adopted in the present invention is U/mmol, molecular weight not containing the alkaline pectase CD of visual mark is 22kDa, the molecular weight of the alkaline pectase CD with visual mark is 40kDa, result as shown in Figure 5, result shows the alkaline pectase CD being with visual mark, and namely fusion rotein has very higher specific activity equally.
The present invention adds the preceding paragraph Vitreoscilla hemoglobin (VHb) visual mark by molecular cloning means in target protein front end, expressed fusion protein is started by anaerobism promotor, both ensure that expressing quantity, make again color on target protein band, greatly facilitate following protein purification, at protein purification art, there is some reference value.
Content disclosed in this invention, believes that those skilled in the art can apply the present invention to greatest extent.Therefore the preferred specific embodiments before should be understood to only illustrate, but not limits the scope of the invention by any way.This area researchist, when not departing from its purport and scope, can carry out various modifications and changes to the present invention.

Claims (7)

1. a construction process for Vitreoscilla hemoglobin visual mark expressing fusion protein system, its step is as follows:
(1) synthesize anaerobism promoter sequence, this anaerobism promoter sequence is connected with after pUC19 expression vector respectively double digestion, obtains recombinant vectors pUC19+promoter;
(2) with Vitreoscilla genome for template, design primer, reacts acquisition 3 ' by PCR and holds containing glycine link group and the Vitreoscilla hemoglobin gene sequence vgb ' of thrombin cleavage site gene;
(3) the recombinant vectors pUC19+promoter that the gene order vgb ' step (2) obtained and step (1) obtain is connected after double digestion respectively, obtains recombinant vectors pUC19+promoter+vgb ';
(4) with pET20b (+)-PelC-CD for template, design primer, reacts amplification by PCR and obtains 3 ' end containing the thermo philic alkali pectin lyase gene C D of 6 histidine-tagged genes;
(5) the recombinant vectors pUC19+promoter+vgb ' that lyase gene CD step (4) obtained and step (3) obtain is connected after double digestion respectively, obtains recombinant vectors pUC19+promoter+vgb '+CD;
(6) recombinant expression vector pUC19+promoter+vgb '+CD is transformed in escherichia coli expression host E.coliBL21 (DE3), obtains visual mark expressing fusion protein system.
2. the construction process of a kind of Vitreoscilla hemoglobin visual mark expressing fusion protein system as claimed in claim 1, is characterized in that: the nucleotides sequence of anaerobism promotor is classified as TTAAAAGTATTTGAGTTTTGATGTGGATTAAGTTTTAAGAGGCAATAAAGATTATA ATAA.
3. the construction process of a kind of Vitreoscilla hemoglobin visual mark expressing fusion protein system as claimed in claim 1, is characterized in that: in recombinant vectors pUC19+promoter+vgb ', the nucleotide sequence of promoter+vgb ' gene is as shown in SEQIDNO.1.
4. the construction process of a kind of Vitreoscilla hemoglobin visual mark expressing fusion protein system as claimed in claim 1, is characterized in that: in recombinant vectors pUC19+promoter+vgb '+CD, the nucleotide sequence of fusion rotein vgb '+CD gene is as shown in SEQIDNO.2.
5. a Vitreoscilla hemoglobin visual mark expressing fusion protein system, is characterized in that: be prepared by any one method of Claims 1 to 4.
6. the application of Vitreoscilla hemoglobin visual mark expressing fusion protein system according to claim 5 in protein purification.
7. a preparation method for Vitreoscilla hemoglobin visual mark fusion rotein, is characterized in that: be that the visual mark expressing fusion protein system that any one obtains by Claims 1 to 4 is first transferred to large system LB substratum amplification 16 ~ 24h again with after little system LB substratum activation; Then in confined conditions, shaking speed is transferred to 100 ~ 120r/min, and temperature drops to 25 DEG C, starts expressed fusion protein, expression time 24 ~ 36h; 4000r/min ~ 6000r/min collected by centrifugation thalline, with the buffer solution thalline of pH=7 ~ 8, obtain fusion rotein by ultrasonication, Ni-NTA affinity chromatography, dialysis, its aminoacid sequence is as shown in SEQIDNO.3.
CN201610054950.1A 2016-01-27 2016-01-27 Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application Pending CN105543263A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610054950.1A CN105543263A (en) 2016-01-27 2016-01-27 Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610054950.1A CN105543263A (en) 2016-01-27 2016-01-27 Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application

Publications (1)

Publication Number Publication Date
CN105543263A true CN105543263A (en) 2016-05-04

Family

ID=55822821

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610054950.1A Pending CN105543263A (en) 2016-01-27 2016-01-27 Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application

Country Status (1)

Country Link
CN (1) CN105543263A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058273A (en) * 2017-05-05 2017-08-18 西北工业大学 A kind of visible protein based on heme-binding domain expresses the application of fusion tag

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101291589B1 (en) * 2012-03-13 2013-08-05 영남대학교 산학협력단 A METHOD FOR DERACEMIZATION OF HOMOALANINE USING D-AMINO ACID OXIDASE AND ω-TRANSAMINASE
CN104892751A (en) * 2015-06-27 2015-09-09 吉林大学 Self-organized recombinant vitreoscilla hemoglobin and gene and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101291589B1 (en) * 2012-03-13 2013-08-05 영남대학교 산학협력단 A METHOD FOR DERACEMIZATION OF HOMOALANINE USING D-AMINO ACID OXIDASE AND ω-TRANSAMINASE
CN104892751A (en) * 2015-06-27 2015-09-09 吉林大学 Self-organized recombinant vitreoscilla hemoglobin and gene and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIANG-JUNG CHIEN ET AL.,: ""Coexpression of Vitreoscilla Hemoglobin Reduces the Toxic Effect of Expression of D-Amino Acid Oxidase in E. coli"", 《BIOTECHNOL. PROG》 *
张桂敏等: ""将透明颤菌血红蛋白基因vgb转移到"", 《华中农业大学学报》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107058273A (en) * 2017-05-05 2017-08-18 西北工业大学 A kind of visible protein based on heme-binding domain expresses the application of fusion tag

Similar Documents

Publication Publication Date Title
CN111647579B (en) Thermolabile exoinulase mutant MutQ23 delta 9 and preparation and application thereof
US20230220439A1 (en) Protein complex based on dna enzymes of e family of escherichia coli and application thereof in artificial protein scaffolds
CN112725319B (en) Alginate lyase FaAly7 with polyG substrate specificity and application thereof
CN102260694A (en) Acidproof medium-temperature alpha-amylase and preparation method thereof
CN113801239B (en) Polypeptide tag, highly soluble recombinant nitrilase and application thereof in synthesis of medicinal chemicals
CN111304186B (en) Construction method of high-catalytic-activity heparin C5 isomerase strain
CN103194434B (en) Novel sulfolobus solfataricus trehalose hydrolase, gene of hydrolase, recombinant expression vector containing gene, and recombinant bacterium, and preparation of hydrolase
CN105543263A (en) Vitreoscilla hemoglobin visual label fused protein expression system, construction method and application
CN105039370A (en) Fusion gene for biosynthesis of resveratrol, expression vector thereof and resveratrol preparation method
CN105950593A (en) Prokaryotic recombinant expression and preparation method of lysyl endopeptidase
CN115960879A (en) High-throughput screening method of D-psicose 3-epimerase mutant library and obtained mutant
CN116144622A (en) Cyclodextrin glucosyltransferase with improved solvent tolerance and preparation thereof
CN105368856B (en) A kind of saltant type thermo philic alkali pectin lyase enzyme gene, engineering bacteria, enzyme and its application than raising living
CN107603965A (en) Acid starch enzyme mutant that heat endurance improves and its preparation method and application
CN111518791B (en) Sucrose hydrolase mutant and preparation method and application thereof
CN110951716B (en) Circumscribed alginate lyase VsAly7D, recombinant strain thereof and application thereof
CN103194432B (en) Novel maltooligosyl trehalose synthase, gene of synthase, recombinant expression vector containing gene, and recombinant bacterium, and preparation of synthase
CN102417900A (en) ATC racemase and coding gene thereof, and application of recombinant expression protein thereof
CN103667212B (en) Glucoamylase and application thereof
CN113699131A (en) Alpha-cyclodextrin glucosyltransferase mutant and application thereof
CN105647898A (en) Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
CN112251420A (en) Bacterial levan synthetase from strict anaerobe
CN115896138B (en) Anaerobic sulfatase mature enzyme gene, anaerobic sulfatase mature enzyme, and preparation methods and application thereof
CN109762834A (en) It is a kind of obtain aromatic series prenyltransferase fermentation and a step purifying method
CN102352337B (en) Recombinant bacteria expressed by escherichia coli genome N-acetylase by control of heterogenous promoter, and use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20160504

WD01 Invention patent application deemed withdrawn after publication