CN105505990A - Method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 - Google Patents
Method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 Download PDFInfo
- Publication number
- CN105505990A CN105505990A CN201610025960.2A CN201610025960A CN105505990A CN 105505990 A CN105505990 A CN 105505990A CN 201610025960 A CN201610025960 A CN 201610025960A CN 105505990 A CN105505990 A CN 105505990A
- Authority
- CN
- China
- Prior art keywords
- ntr2
- ahress
- peanut
- resveratrol
- pbi121
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 and belongs to the field of plant genetic engineering. The tobacco root specific promoters NTR2 drive a peanut resveratrol synthase gene AhRESS carrier pBI121-NTR2-AhRESS to carry out genetic transformation on peanuts through mediation of agrobacterium rhizogenes, and the transgene peanut capillary roots for specifically expressing the AhRESS are obtained. Resveratrol in the transgene peanut capillary roots is extracted through an organic solvent extraction method, and the content of resveratrol in the transgene peanut capillary roots is 66.16 micrograms per gram (FW) through high performance liquid chromatography (HPLC) measurement to the maximum degree and is three times of the content of resveratrol in non-transgene capillary roots. The tobacco root specific promoter NTR2 drives the peanut resveratrol synthase gene AhRESS to be specifically expressed in the peanut capillary roots, and then a good foundation is laid for producing resveratrol.
Description
Technical field
The present invention relates to specific promoter NtR2 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, belongs to biology field.
Technical background
Trans-resveratrol (Resveratrol is called for short Res), be a kind of important phytoalexin, be present in the plants such as giant knotweed, grape, peanut, in grape pomace and Roots of Peanut, content is particularly abundant.It has multiple biological activity, is a kind of natural antioxidant, can reduces blood fat, anti-platelet clotting, anticancer, anti-inflammatory, and radioprotective is anti-ageing, prevention and cure of cardiovascular disease etc.It and taxol are all described as green cancer therapy drug.But the content of the trans-resveratrol that occurring in nature exists is less, utilizes plant gene engineering technology High-efficient Production trans-resveratrol to be the important channel obtaining trans-resveratrol in a large number.
Trans-resveratrol is extensively present in spermatophyte, as stilbenes, synthesizes mainly through phenylalanine pathways metabolism.Liu Lei etc. have cloned resveratrol synthase cDNA, and are transformed the hypocotyl of peanut, the hypocotyl of Radix Dauci Sativae; Meanwhile, also peanut RESS transformed yeast.Xu Yufen etc. successfully construct the Yeast expression carrier of peanut RS gene, and are integrated on the karyomit(e) of pichia spp by electroporation; Successfully construct by the peanut RS gene monocotyledon expression vector of Ubi promoters driven, utilize agriculture bacillus mediated and Gene Knock-out Mice transduction sugarcane respectively.Yellow Guoqiang etc. have studied the specifically expressing of Resveratrol synthase gene in Roots of Peanut, and result of study shows: the transcriptional expression of this gene, at the phloem of root, has no expression in its hetero-organization; The process of yeast vat liquor can make the transcriptional expression of this gene obviously strengthen.Gene for the purpose of the Resveratrol synthase gene in peanut such as woods high honour, construct the plant recombination expression vector pB6RS containing goal gene, electroporation is utilized directly to be imported in agrobacterium tumefaciens lba4404 by pB6RS plasmid, by agriculture bacillus mediated by pB6RS transformation of tobacco (Yun yan85), obtain positive plant.
Due to the important physiological function of trans-resveratrol, in recent years, people began one's study and utilized the content of trans-resveratrol in biotechnology raising vegetable material.The investigators such as Giovinazzo carry out tomato genetic transformation with 35S promoter regulation and control Resveratrol synthase gene, measure the aggregate level of ascorbate salt in transgenic Fructus Lycopersici esculenti and glutathione reductase, result shows: the oxidation-resistance of transgenic plant has had significant raising than the oxidation-resistance of wild-type plant.H ü sken etc. utilizes Semen Brassicae campestris specific expression promoter to drive Resveratrol synthase gene to express, and transforms rape, meanwhile, blocks another branch road consuming resveratrol synthase substrate, detects T
0for the Res content in rapeseed seeds, find that in its most high-content of fresh weight be 361 μ g/g, have also obtained quality improving and the rapeseed seeds that improves of health simultaneously.But at present, drive the research of Resveratrol synthase gene Expression product trans-resveratrol to have no report by root-specific promoter.
Agrobacterium rhizogenes (Agrobacteriumrhizogenes) is a kind of Gram-negative soil bacteria, and it can infect most of dicotyledons and minority monocotyledons and gymnosperm, and inducing plant produces Hairy root (hairly root).Hairy root, relative to normal root, has many good qualities.In theory, Hairy root derives from a vegetable cell, is not mosaic, so its stabilization characteristics of genetics, subculture repeatedly still has the hereditary property of original Hairy root; Hairy root can in without the substratum of exogenous hormone autonomous growth, and fast growth, easy to operate and regulation and control, not by limiting in season and region; Some secondary metabolite content in Hairy root is higher than normal root.Therefore, utilizing Hairy root to produce secondary metabolite is a reliable and effective approach.
In peanut is respectively organized, trans-resveratrol is the highest with the content in root.Therefore, obtain a large amount of root fast, both obtained the trans-resveratrol material of planting source property, and then trans-resveratrol can have been extracted in a large number.And Agrobacterium rhizogenes can infect plant, form Hairy root in wound, and Hairy root is without hormonal dependent, can grow fast again, increases hundreds of times even thousands of times at short notice.Based on this, be the shortcut that rapid, high volume produces trans-resveratrol with Hairy root liquid culture.Liu Jie etc. optimize the culture condition of Hairy root, and desk study induction Hairy root produces the condition of trans-resveratrol, result of study shows: the suitableeest basic liquid nutrient medium of peanut root of hair is the MS substratum without hormone, adding plant hormone can the growth of suppression Hairy root in various degree, and 100 μm of ol/L Whitfield's ointments (SA) can improve the synthesis of peanut Hairy root polydatin synthesis secretion and trans-resveratrol.Huang Liping etc. have probed into the difference that different Agrobacterium rhizogenes transforms different varieties Tobacco Hairy Roots efficiency, and result shows: the inductivity of different tobacco bred and the equal remarkably influenced hairly root of agrobacterium rhizogene strain.Fabricio etc. study discovery, peanut Hairy root efficiently can produce trans-resveratrol, and the Hairy root induction of Different growth phases produces Resveratrol content difference, and at suitable growth phase, certain density sodium-acetate induction Hairy root 24h, trans-resveratrol can be secreted in liquid nutrient medium.But at present, drive Resveratrol synthase gene to have no report in the research of peanut Hairy root Expression product trans-resveratrol by root-specific promoter.
The present invention is directed to above research background, Agrobacterium rhizogenes is utilized to mediate pBI121-NTR2-AhRESS genetic transformation peanut, obtain the transgenic peanuts Hairy root that root-specific promoter NTR2 drives AhRESS to express, by Hairy root fluid suspension culture, rapid, high volume obtains Hairy root, and then for the production of trans-resveratrol.This invention drives peanut RS gene AhRESS specifically expressing in peanut Hairy root for utilizing tobacco root-specific promoter NTR2, and then production trans-resveratrol provides good basis.
Summary of the invention
The invention provides specific promoter NtR2 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system.Object is to provide tobacco root-specific promoter NTR2 to drive peanut RS gene AhRESS specifically expressing in peanut Hairy root, and then produces the technology of trans-resveratrol, to utilize plant genetic engineering means High-efficient Production trans-resveratrol.
Tobacco root-specific promoter NTR2 drives AhRESS at an application for a large amount of synthesizing resveratrol of peanut hair-like root system, comprises the following steps:
(1) tobacco root-specific promoter NtR2 and peanut AhRESS gene is cloned;
(2) tobacco root-specific promoter NtR2 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR2-AhRESS;
(3) pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture is turned;
(4) detection of pBI121-NTR2-AhRESS peanut Hairy root Resveratrol content is turned.
In described step (1), in pBI121-NTR2-AhRESS carrier, the sequence of tobacco root-specific promoter NTR2 is SEQIDNo:1, and the sequence of peanut RS gene AhRESS is SEQIDNo:2.
The Agrobacterium rhizogenes that in described step (3), Agrobacterium rhizogenes is given for Agricultural University Of He'nan, the peanut genetic transformation explant of its mediation is respectively blade, cotyledon, epicotyl and Hypocotyl Explants.
Described step (4) transfer pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture used medium is MS substratum+500mg/LCef, subculture medium is MS substratum+300mg/LCef for the first time, second time subculture medium is MS substratum+100mg/LCef, and subculture medium is MS substratum for the third time; After three subcultures, cephamycin concentration is down to 0.
The detection method of described step (5) transfer pBI121-NTR2-AhRESS peanut Hairy root Resveratrol content is HPLC, chromatographic condition is: permaphase ODS (250mm × 4.6mm × 5 μm), moving phase acetonitrile: water (25:75), flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Be specially:
1. tobacco root-specific promoter NtR2 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR2-AhRESS.
(1) clone tobacco root-specific promoter NtR2, and be connected in pMD18-T carrier, obtain pMD18-NtR2 carrier;
(2) pBI121-NtR2-GUSA vector construction: utilize restriction enzyme BamH I and Sac I pair of pBI121 plasmid vector to carry out enzyme and cut, excise the GUSA gene on this carrier, utilize and from pCAMBIA1301 carrier, clone GUSA gene with the special primer of restriction enzyme site, be connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier; Described pBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR2 carrier, NtR2 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR2-GUSA carrier;
(3) structure of pBI121-NtR2-AhRESS carrier: clone's peanut RS gene AhRESS gene, and be connected in pBI121-NtR2-GUSA carrier, obtain pBI121-NtR2-AhRESS carrier.
2. tobacco root-specific promoter NTR2 drives peanut RS gene AhRESS expression vector pBI121-NTR2-AhRESS through Agrobacterium rhizogenes mediated transformation peanut.
Produce at Agrobacterium rhizogenes inducing plant on the basis of Hairy root, utilize pBI121-NTR2-AhRESS vector Agrobacterium rhizogenes, by its mediation genetic transformation peanut, obtain transgenic peanuts Hairy root.Extract the DNA of the Hairy root of transgenic peanuts and contrast with CTAB method, carry out PCR with the upstream and downstream primer of AhRESS gene (AhRESS-F:5 ' ATGGTGTCTGTGAGTGGAATTC3 ' and AhRESS-R:5 ' TTATATGGCCACACTGCGGAGAAC3 ') and rolB gene (rolB-F:5 ' GTCCTTGCAGTGCTAGATTT3 ' and rolB-R:5 ' GAAGGTGCAAGCTACCTCTC3 ') respectively; The RNA of the Hairy root of transgenic peanuts and contrast is extracted with CTAB method, after PrimeScript reversed transcriptive enzyme specification sheets reverse transcription, carrying out RT-PCR, PCR reaction conditions with AhRESS gene specific primer (AhRESS-F:5 ' ATGGTGTCTGTGAGTGGAATTC3 ' and AhRESS-R:5 ' TTATATGGCCACACTGCGGAGAAC3 ') is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.Screen positive Hairy root and carry out next step experiment.
3. turn pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture.
By the cultivation of liquid MS medium, during subculture, reduce the concentration of Cef gradually, until last Cef is down to 0 and Hairy root can grow not contaminated fast in neat liquid MS substratum.It should be noted that the root that explant different loci grows is different hair-like root system, initial with 1 root time degerming.Hairy root fast-propagation is about to a Hairy root and is inoculated in fresh MS substratum, and certain temperature vibration light culture 2 weeks, Hairy root output is more than 100 times of inoculum size.After the transgenic peanuts Hairy root liquid culture that can grow fast of screening gained, results Hairy root.
4. turn the detection of pBI121-NTR2-AhRESS peanut Hairy root Resveratrol content.
Be that vat liquor extracts trans-resveratrol in Hairy root with methyl alcohol, vat liquor concentrates to obtain HPLC detected sample through rotary evaporation, measures Resveratrol content in Hairy root by HPLC.
Beneficial effect
The present invention utilizes tobacco root-specific promoter NTR2 to drive AhRESS gene specifically expressing in Tobacco Root, plant expression vector is converted in peanut through Agrobacterium rhizogenes, make AhRESS gene specifically expressing in peanut Hairy root, expand numerous Hairy root in a large number in a short time by fluid suspension culture, realize the great expression of trans-resveratrol.Transgenic peanuts Hairy root culture of the present invention is simple, growth is quick, stabilization characteristics of genetics, can be and utilizes plant genetic engineering means High-efficient Production trans-resveratrol to provide basis.Utilize organic solvent extraction to extract trans-resveratrol in transgenic peanuts Hairy root, measure through high performance liquid chromatography (HPLC), its Resveratrol content is up to 66.16 μ g/g(FW), be 3 times of Resveratrol content in non-transgenosis Hairy root.
Accompanying drawing explanation
The variation diagram of the pBI121-NTR2-AhRESS genetic transformation Peanut induction Hairy root of Fig. 1 Agrobacterium rhizogenes mediation; A: induce 1 week, B: induce 2 weeks.
In Fig. 2 transgenic peanuts hair-like root system, AhRESS gene RT-PCR detects electrophorogram; M:Marker2000,1-12: turn pBI121-NTR2-AhRESS hair-like root system, 12: positive control, 13: negative control.
Fig. 3 transgenic peanuts hair-like root system fluid suspension culture figure; A: inoculation, B: cultivate 1 week, C: cultivate 2 weeks.
Trans-resveratrol HPLC analytical results in Fig. 4 transgenic peanuts hair-like root system.XH: newly meeting granule root, PTP: Pericarpium Vitis viniferae, A.r: negative Hairy root, 2-(4,7,11): pBI121-NTR2-AhRESS hair-like root system.
Embodiment
The structure of [embodiment 1] pBI121-NtR2-AhRESS carrier
1. the clone of tobacco root-specific promoter NtR2
Take about 0.1g tobacco leaf, be placed in mortar frozen-thawed, be ground into powder rapidly; Utilize the DNA in CTAB method extraction tobacco, dissolve with the RNase sterilized water of 40 μ L, 10ng/ μ L, be placed in 37 DEG C and dissolve about 1h.Get the tobacco DNA point sample that 1 μ L extracts, carry out electrophoresis detection, deposition condition: electrophoretic buffer 1 × TAE, the sepharose of 1.0%, voltage 120V, electrophoresis time is about 20min; Get 1 μ L ultraviolet spectrophotometer simultaneously and measure its concentration.
According to the splicing sequence of the NtR2 promotor of this laboratory clone in early stage acquisition, design primer NtR2-Hind III-promter-F(5 ' accaaagcttGAATATCTTCAGTATATTCGTTGTG3 '), NtR2-Xba I-promter-R(5 ' accatctagaGTCTCCTTCTTAATTTTCTATCAAAG3 '), increase according to following PCR system.This system comprises 32.5 μ LddH
2o, 10 μ L10 × PrimeSTARPCRBuffer(Mg
2+plus), the each 2.5mmol of 4 μ LdNTPMixture(), 1 μ LNtR2-Hind III-primer-F(10 μm ol), 1 μ LNtR2-Xba I-primer-R(10 μm ol), 1 μ L tobacco cDNA, 0.5 μ LPrimeSTARHSDNApolymerase(2.5U/ μ L), system cumulative volume is 50 μ L.
The PCR reaction system of 50 μ L is mixed, is divided into 2 pipes, often manages each 25 μ L.PCR reaction conditions is: 98 DEG C of 5min → (98 DEG C of 10s → 53 DEG C 15s → 72 DEG C 2min) 5cycles → (98 DEG C of 10s → 60 DEG C 15s → 72 DEG C 2min) DEG C 10min → 4,23cycles → 72 DEG C are preserved.
PCR primer reclaims after purifying through agarose gel electrophoresis, and be connected in pMD18-TVector, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 16-24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 12-16h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects, and sequencing result is as SEQIDNO.1.The correct recombinant plasmid of sequencing result is pMD18-NtR2.
2. the clone of peanut RS gene AhRESS
CTAB method is utilized to extract peanut leaf genomic dna, with peanut RS gene special primer RS-BamH I-primer-F(5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGGAATTC3 '), RS-Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCGGAGAACG3 ') carry out PCR detection.It reclaims product and is peanut RES genes encoding frame DNA sequence dna.Be structured in pMD18-T carrier by ligase enzyme, proceed in competent escherichia coli cell DH5 α, select positive colony and carry out order-checking qualification, sequencing result is as SEQIDNO.2.
The structure of 3.pBI121-NtR2-AhRESS carrier
Utilize restriction enzyme BamH I and Sac I pair of pBI121 plasmid vector to carry out enzyme to cut, excise the GUSA gene on this carrier, the special primer (GUSAF-BamH-Spe:5 ' agga-GGATCC-ACTAGTaccatggtagatctgagggtaaatttc3 ' and GUSAR-Sac1-ASC1-Swa1:5 ' agga-gagctc-GGCGCGCCTAAATTTA-GAAATTCGAGCTGGTCACCTGT3 ') with restriction enzyme site is utilized to clone GUSA gene from pCAMBIA1301 carrier, be connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier; Utilized by pMD18-NtR2 carrier restriction enzyme Xba I and Hind III to carry out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Mbuffer, 2.0 μ LXba I, 2.0 μ LHind III, ddH
2o mends to 50 μ L, and mixing, cuts 10-12h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains NtR2 promotor.
Utilize restriction enzyme Xba I and Hind III that pBI121-GUSA carrier is carried out enzyme to cut, excision 35S promoter, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Mbuffer, 2.0 μ LHind III, 2.0 μ LXba I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
NtR2 promotor be connected in the pBI121-GUSA carrier of excision 35S promoter, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, and PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LNtR2-Xho I-primer-F, 0.5 μ LNtR2-Xba I-primer-R, 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 53 DEG C 30s → 72 DEG C 2min) 5cycles → (94 DEG C of 30s → 60 DEG C 30s → 72 DEG C 2min) DEG C 10min → 4,30cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR2-GUSA carrier.
Be connected in pMD18-T carrier by peanut RS gene AhRESS, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 14h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects.The correct recombinant plasmid of sequencing result is pMD18-AhRESS.
Utilize restriction enzyme Sac I and BamH I that pMD18-AhRESS carrier is carried out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains the AhRESS gene with Sac I and BamH I site.
Carry out enzyme with restriction enzyme Sac I and BamH I pair of pBI121-NtR2-GUSA carrier to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
Be connected to by AhRESS gene in pBI121-NtR2-GUSA carrier, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LAhRESS-BamH I-primer-F(5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGGAATTC3 '), 0.5 μ LAhRESS--Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCGGAGAACG3 '), 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 69 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR2-AhRESS carrier.
[embodiment 2] pBI121-NTR2-AhRESS vector Agrobacterium rhizogenes
The pBI121-NTR2-AhRESS plasmid DNA of getting 2 μ about g (volume is less than 20 μ l) joins in 200 μ L Agrobacterium rhizogenes competent cells, blows and beats mixing gently with liquid-transfering gun; Ice bath 30min, then places 5min in liquid nitrogen, then in 42 DEG C of thermostat water baths water-bath 1min, repeat 3 times; Then in placing 5min on ice, add 800 μ LYEB liquid nutrient mediums, shaking culture in 28 DEG C of constant temperature oscillators, after 175rpm, 8h, the centrifugal 3min of 3000rpm, abandon 800 μ l supernatants, the mixing of bacterium liquid will be remained, coat on the YEB flat board containing 50mg/lKan, cultivate in 28 DEG C of constant incubators and form single bacterium colony, about 72h; Picking mono-clonal in the substratum of 400 μ lYEB+50mg/l, 220rpm28 DEG C of shaking culture 16h; , bacterium liquid PCR verifies, empirical tests is positive colony, gets 600 μ l bacterium liquid and 600 μ l50% glycerine (sterilizing) mix in aseptic Eppendorf pipe, is stored in-70 DEG C of refrigerators in liquid nitrogen after quick-frozen.Bacterium liquid PCR verifies that system is as follows:
PCR reaction system:
PBI121-NtR12-AhRESS the primer is: AhRESS-F(5 ' ATGGTGTCTGTGAGTGGAATTC3) and AhRESS-R(5 ' TTATATGGCCACACTGCGGAGAAC3 '); PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.
Result shows, the PCR primer of expression vector plasmid DNA is special object band, and successful conversion is in Agrobacterium rhizogenes for plasmid, and the plasmid vector that the method can realize foreign gene-carrying proceeds to Agrobacterium rhizogenes.
The induction of [embodiment 3] peanut Hairy root
Prepare aseptic seedling and the engineering bacteria of newly meeting granule peanut varieties respectively, utilize Agrobacterium rhizogenes genetic transformation peanut.
(1) preparation of peanut aseptic seedling: configure 0.1% mercury chloride, 1% mercury chloride getting respective amount, according to dilution proportion, is stored in brown bottle, lucifuge, sealing; Get peanut seed 60 in tissue culture bottle, 75% alcohol immersion 1min, acutely shakes, and 0.1% mercury chloride soaks 10min, and acutely shake, sterilized water washes 5 times, each 5min, and sterilized water soaks 2h, and remove seed coat, radicle inserts MS substratum downwards, 3 every bottle; 28 DEG C, light culture 48h, is then moved to the photoperiod of 16h, is cultured to and grows 2 true leaves (about 8-10d) under 8h dark condition.
(2) preparation of engineering bacteria: the bacterium liquid taking out the corresponding recombinant plasmid previously preserved from-80 DEG C of Ultralow Temperature Freezers, carry out drawing plate (YEB containing 50mg/Lkan is dull and stereotyped), picking mono-clonal, shake bacterium, bacterium liquid PCR verifies, empirical tests is the bacterium liquid of positive colony, get part bacterium liquid and shake bacterium in a large number, generally shake 50mL bacterium liquid, 250rpm, 28 DEG C of incubated overnight are to OD
600=0.5(notes having caking to produce, or used time vortex makes in unicellular); Get 45mL bacterium liquid centrifugal in 50mL centrifuge tube, the centrifugal 10min of 4100rpm; Outwell supernatant liquor, precipitation is resuspended in 50mL1/2MS minimum medium, adds Syringylethanone (AS) the 50 μ L of 100mM; The engineering bacteria liquid prepared is preserved 1-2h, for Dual culture (infecting of explant) in 4 DEG C.
(3) Agrobacterium rhizogenes genetic transformation peanut: take out peanut aseptic seedling seedling, obtain blade, cotyledon, epicotyl and Hypocotyl Explants respectively, explant surface is done and is scratched process, be placed in aseptic tissue culture bottle respectively, the engineering bacteria liquid prepared is poured into respectively, constantly rock bottle gently, continue to infect 15min; Outwell engineering bacteria bacterium liquid, blot unnecessary bacterium liquid with aseptic filter paper, various for the peanut infected explant is placed in Dual culture substratum (MS+75 μM of As) Dual culture, 28 DEG C of light culture 2-4d, depending on the growing way of bacterium; Explant after Dual culture is taken out and is placed in aseptic tissue culture bottle, then in sterilized tissue culture bottle, add the Cef aqueous solution that 50mL final concentration is 500mg/L, constantly rock bottle gently, continue 5min, then blade is taken out, repeat once, then blade is put into the bottle containing 50mL sterilized water, constantly rock bottle gently, continue about 5min; This uncured tobacco blade of washed bacterium is proceeded to Hairy root inducing culture (B respectively
5+ 500mg/LCef) in carry out Hairy root induction, every 5-7d switching once, add up the quantity of the hairly root induced after three weeks, the explant of 10 contrasts and 10 explants infected through Agrobacterium rhizogenes are as one group, in order to statistics, add up the hair shape of each group of explant with inductivity.
[embodiment 4] turns pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture
The Hairy root that Peanut induction produces, after degerming, can be used for the preparation of fluid suspension culture and Hairy root sample.
Sterilization step: after Peanut induces 3 weeks, that gets different sites is about 3-5cm Hairy root in liquid culture substratum (MS+500mg/LCef), every bottle of YITIAOGEN, 120rpm, 28 DEG C, light culture, after 1 week, gets well-grown Hairy root in liquid nutrient medium subculture, and subculture medium is MS+300mg/LCef, after cultivating 1 week, subculture is in MS+100mg/LCef, then after cultivating 1 week, subculture is in MS substratum.After three subcultures, cephamycin concentration is down to 0.
Fluid suspension culture: the 3-5 bar root of degerming rear Genetic identification hair-like root system of learning from else's experience respectively, is inoculated in liquid MS medium, 28 DEG C, 120rpm, light culture; Subculture once weekly, inoculates remaining Hairy root filter paper and blot as far as possible, after liquid nitrogen flash freezer, frozen in-80 DEG C of refrigerators.
[embodiment 5] transgenic peanuts Hairy root Genomic PCR is identified
1. the extraction of transgenic peanuts Hairy root DNA
Get transgenic peanuts Hairy root 100mg, in liquid nitrogen, grind plant tissue powdered, and transfer to filling in the centrifuge tube of extract 65 DEG C of preheatings.At 65 DEG C of incubation 45min, frequently mix therebetween.With the chloroform/isoamyl alcohol extraction homogenate of isopyknic 24:1, put upside down mixing (gentleness).4 DEG C, the centrifugal 5min of 10000rpm, reclaims supernatant liquor.In supernatant liquor, add the solution of the CTAB/Nacl of 65 DEG C of 1/10 volume, put upside down mixing (gentleness).With the chloroform/isoamyl alcohol extraction homogenate of isopyknic 24:1, put upside down mixing (gentleness).4 DEG C, the centrifugal 5min of 10000rpm, reclaims supernatant liquor.Add the CTAB precipitated liquid of 1 times of volume, upset mixing, carries out next step after seeing precipitation; Otherwise in 65 DEG C of incubation 30min.In 4 DEG C, the centrifugal 5min of 10000rpm.Shift out supernatant, but do not abandon, by the resuspended precipitation of TE damping fluid of 0.5ml height salt, if precipitation is difficult to resuspended, in 65 DEG C of incubation 30min, repeat to all or most of resolution of precipitate.Add the isopropanol precipitating nucleic acid of 0.6 times of volume, fully mixing (gentleness), 4 DEG C, the centrifugal 15min of 10000rpm.Wash precipitation with 80% ethanol, dry, and precipitate with the buffer solution of 0.1ml.The RNA enzyme finally adding 1/20 volume puts 1h at 37 DEG C.Finally be placed on-20 DEG C to save backup.
2. the PCR of genomic dna detects
The DNA that peanut Hairy root extracts is diluted to 100ng/ μ l, gets 1 μ l as template, add sterile purified water 14.4 μ l successively, 10 × PCRBufferII(Mg
2+plus) 2 μ l, Taq0.1 μ l, dNTPMixture(2.5m) 1.50 μ l, each 0.5 μ l of upstream and downstream primer, primer sequence is: AhRESS-primer-F:5 ' ATGGTGTCTGTGAGTGGAATTC3 ' and AhRESS-primer-R:5 ' TTATATGGCCACACTGCGGAGAAC3 '.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.Result shows, AhRESS gene has been incorporated in this uncured tobacco Hairy root genome.
[embodiment 6] transgenic peanuts Hairy root AhRESS gene RT-PCR identifies
1. the extraction of transgenic peanuts Hairy root total serum IgE
Get 1g Hairy root to be placed in mortar and to add liquid nitrogen grinding, get 0.1g and pour in the 0.5ml guanidinium isothiocyanate denatured homogenate liquid of precooling, fully mix 1min.Add 0.1ml2mol/LNaAc (pH4.0) and mix 1min; Add 0.5ml water-saturated phenol, vibrate 30 seconds, ice bath 5min.Add 0.2ml chloroform: primary isoamyl alcohol (24:1), thermal agitation 2 3min, place 10min on ice.4 DEG C, the centrifugal 15min of 12000g.Carefully pipette upper strata aqueous phase, discard middle and lower floor's organic phase.Add equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1), vibrate 2 3min, places 5min on ice.4 DEG C, the centrifugal 10-15min of 12000g, pipettes upper strata aqueous phase, discards middle and lower floor's organic phase.Add equal-volume Virahol, place-20 DEG C of 30 points of kinds with precipitated rna.4 DEG C, the centrifugal 15min of 12000g collects RNA precipitation, by 75% washing with alcohol precipitation; RNA is deposited in air drying.RNA precipitation is dissolved with 30ulRNase-freeddH2O or deionized formamide.
2. transgenic peanuts Hairy root RT-PCR
Get transgenic peanuts Hairy root total serum IgE 1 μ g, by according to the reaction system in Reverse Transcriptase kit, carry out reverse transcription.Dilute the reverse transcription product of 3 times for template with 1 μ l, add sterile purified water 14.4 μ l successively, 10 × PCRBufferII(Mg
2+plus) 2 μ l, Taq0.1 μ l, dNTPMixture(2.5m) 1.50 μ l, AhRESS-primer-F (5 ' ATGGTGTCTGTGAGTGGAATTC3 ') and each 0.5 μ l of AhRESS-primer-R (5 ' TTATATGGCCACACTGCGGAGAAC3 ').PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.RT-PCR electrophoresis result, as Fig. 2, shows that AhRESS gene is expressed in this uncured tobacco of transgenosis Hairy root.
The extraction of [embodiment 7] transgenic peanuts Hairy root trans-resveratrol
Get the Hairy root of-80 DEG C of preservations and fresh Pericarpium Vitis viniferae, respectively correct amount 0.5g, in liquid nitrogen, grinding fully, be placed in centrifuge tube respectively, add 5mL methyl alcohol, in 60 DEG C of water-baths, extract 1h, the centrifugal 10min of 6000rpm, collects supernatant, in triplicate, merge supernatant liquor, in 45 DEG C of rotary evaporations near dry after filtration, by methanol constant volume to 2mL, with 0.22 μm of membrane filtration, obtain pretreated sample solution, for subsequent use.
The HPLC of [embodiment 8] transgenic peanuts Hairy root Resveratrol content measures
1. trans-resveratrol HPLC detects chromatographic condition: permaphase ODS (250mm × 4.6mm × 5 μm), moving phase acetonitrile: water (25:75), flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
2. the preparation of trans-resveratrol standard substance storing solution: accurately take trans-resveratrol standard substance 5.0mg, dissolve with methyl alcohol (chromatographically pure) and be settled to 50mL, obtain the trans-resveratrol standard substance storing solution of 100mg/L, be placed in 4 DEG C of refrigerators and keep in Dark Place, for subsequent use.
3. the preparation of trans-resveratrol standard working solution: accurately pipette trans-resveratrol standard substance storing solution 2mL, 4mL, 6mL, 8mL, 10mL methyl alcohol (chromatographically pure) respectively and dilute and be settled to 1000mL, obtain a series of trans-resveratrol standard substance working fluid, its mass concentration is respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L.
4. the drafting of typical curve: each 10 μ L of the trans-resveratrol standard solution sample introduction being respectively respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L with mass concentration, record the relation between peak area and Resveratrol content, drawing standard curve.
5. the mensuration of Resveratrol content in Hairy root: get each 10 μ L sample introductions of pretreatment sample solution, every sample does three repetitions, calculates the content of trans-resveratrol in each strain Hairy root, average as experimental result according to typical curve.Result shows, organic solvent extraction is utilized to extract trans-resveratrol in transgenic peanuts Hairy root, measure through high performance liquid chromatography (HPLC), its Resveratrol content is up to 66.16 μ g/g(FW), be Resveratrol content in non-transgenosis Hairy root 3 times (Fig. 4).
The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.
SEQUENCELISTING
<110> University Of Agriculture and Forestry In Fujian
<120> specific promoter NtR2 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system
<130>12
<160>12
<170>PatentInversion3.3
<210>1
<211>1574
<212>DNA
<213> tobacco NTR2 specific promoter sequence
<400>1
gaatatcttcagtatattcgttgtgtattttttcacttagattgtaaagtgtctatcaca60
tctgatataggtcgtagtcctaatggttgtgattatttaactgttacatttcattgggtt120
gatcatcactggaacatgcaaaaatatattattggttataaatttgttgattcaaaacac180
actggagcatttattgctactactgttgtacaaattattaatttttatggattcatcaat240
aaagttttaactatcaccttagataatacttctgctaagtgctaacacaactgcaacaac300
tagcttaatgaaatgattgcaaaattaatccaacttatgcaccggctattaatgaaatga360
ttgcaaaattttaaaagtatttttttcctattccccaagtttatttaatttctactatac420
ttaacccatctttaaaattaagaggtgcaaatggacttgttcgtaaaatttatgagaatt480
tagcaattcaagaaaatgaacaaccatctctcgaagactgccaaactaacatatattctt540
atgttagatcaatatttgataaatataaatctatggaaacaacatgtgggtgaaactagg600
gaagaagaagaatacaatgagatacttaggactgggagctatgacggcatggaactcatg660
gaacatcaatcaacattgccaattccataacaatgtccgagagaaattataaataagtta720
caacgaagttatatatgagcttacaaatattagtatgataatttgtaattggctactaag780
aggcctagttcaaacagaacccttcctagaaggtggctgcatagattatgtgctattcaa840
aagaattatatttgtatgtgagatttgaaagttatattaataaaataaaaggctttaagc900
gttgaatttgttttatgaattgtcttacactctttagttacttaatggcttgaaattgta960
ttaaataaattataactctattataaatttataattactagaatatttcattacaagtct1020
ttttttttaatattttataattctttacttaattttctaattttcgtttaatttttaagt1080
ttattaaataagtcaaaaactaggtgttgcaaactttaaaaacttagtcgttgtcaaaag1140
aatagccgttgccaaactcaatgattaagtaattttttttttaaaacgacacttaaggcc1200
cacgaacccgtcccgtcccgttccgtcccatcccgtttgttagcgggacgggatgagatg1260
gacctaccgtttcgtcccgtcccggctaaatatcgtcccgtcctgttggacagccataga1320
tacccctacttatgtgcacttccttggcctacggaattcaaggaagatatatacagatct1380
ctgaaatagggaaacgcgccatttcctgtttatgaacttttgaattaatcataagcatta1440
ttttcctaacacaatttctacgcatgcttatataaattaatatataatatgtcaagttgt1500
aataatggtgggggtattagctagctatagtatacattttaacacaaactttgatagaaa1560
attaagaaggagac1574
<210>2
<211>1170
<212>DNA
<213> peanut RS gene AhRESS
<400>2
atggtgtctgtgagtggaattcgcaaagttcaaagggcagaaggccctgcaactgtattg60
gcgataggcacagcaaatccaccaaattgtattgatcagagcacatatgctgattattat120
tttagagtaactaacagtgaacacatgactgatctcaagaagaagtttcagcgcatttgt180
gagagaacacaaatcaagaacagacatatgtacttaacagaagagatactgaaagagaat240
cctaacatgtgcgcatataaagcaccgtcgttggatgcaagggaagacatgatgatcagg300
gaggtaccaagggttggaaaagaggctgcaaccaaggccatcaaggaatggggtcagcca360
atgtctaagatcacacatttgatcttctgcaccaccagcggtgttgcattgcctggcgtt420
gattacgaactcatcatactcttaggactcgacccatccgtcaagaggtacatgatgtac480
caccaaggctgcttcgccggtggcactgtccttcgtttggctaaggacttggctgaaaac540
aacaaggatgctcgtgtgcttatcgtttgttctgagaataccgcagtcactttccgtggt600
cctagtgagacagacatggatagtcttgtagggcaagccttgtttgctgatggagctgct660
gcgattatcattggttctgatcctgtgccagaggttgaaaagcctatctttgaaattgtt720
tcgactgatcaaaaacttgtccctaacagccatggagccatcggtggtctccttcgtgaa780
gttgggcttacattctatcttaataagagtgttcctgatattatttcacaaaacatcaat840
gatgcgctcagtaaagcttttgatccattgggtatatctgattataactcaatattttgg900
attgcacatcctggtggacgtgcaattttagaccaggttgaacagaaagtgaacttgaaa960
ccagaaaagatgaaagccactagagacgtgcttagcaattatggtaacatgtcaagtgca1020
tgtgtgtttttcattatggatttgatgaggaagaagtctcttgaagaaggacttaaaacc1080
actggtgaaggacttgattggggtgtgcttcttggctttggtcctggtcttactattgaa1140
accgttgttctccgcagtgtggccatataa1170
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
atggtgtctgtgagtggaattc22
<210>4
<211>24
<212>DNA
<213> artificial sequence
<400>4
ttatatggccacactgcggagaac24
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
gtccttgcagtgctagattt20
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
gaaggtgcaagctacctctc20
<210>7
<211>35
<212>DNA
<213> artificial sequence
<400>7
accaaagcttgaatatcttcagtatattcgttgtg35
<210>8
<211>36
<212>DNA
<213> artificial sequence
<400>8
accatctagagtctccttcttaattttctatcaaag36
<210>9
<211>38
<212>DNA
<213> artificial sequence
<400>9
tcgtggatccgccaccatggtgtctgtgagtggaattc38
<210>10
<211>35
<212>DNA
<213> artificial sequence
<400>10
tcctgagctcttatatggccacactgcggagaacg35
<210>11
<211>43
<212>DNA
<213> artificial sequence
<400>11
aggaggatccactagtaccatggtagatctgagggtaaatttc43
<210>12
<211>48
<212>DNA
<213> artificial sequence
<400>12
aggagagctcggcgcgcctaaatttagaaattcgagctggtcacctgt48
Claims (6)
1. specific promoter NtR2 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: comprise the following steps:
(1) tobacco root-specific promoter NTR2 drives peanut RS gene AhRESS expression vector pBI121-NTR2-AhRESS through Agrobacterium rhizogenes mediated transformation peanut;
(2) pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture is turned;
(3) detection of pBI121-NTR2-AhRESS peanut Hairy root Resveratrol content is turned.
2. specific promoter NtR2 according to claim 1 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: the concrete grammar of step (1) is:
1) tobacco root-specific promoter NtR2 is connected in pMD18-T carrier, obtains pMD18-NtR2 carrier;
2) pBI121-NtR2-GUSA vector construction: utilize restriction enzyme BamH I and Sac I pair of pBI121 plasmid vector to carry out enzyme and cut, excise the GUSA gene on this carrier, utilize and from pCAMBIA1301 carrier, clone GUSA gene with the special primer of restriction enzyme site, be connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier; PBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR2 carrier, NtR2 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR2-GUSA carrier;
3) structure of pBI121-NtR2-AhRESS carrier: by peanut RS gene AhRESS gene, and be connected in pBI121-NtR2-GUSA carrier, obtain pBI121-NtR2-AhRESS carrier.
3. specific promoter NtR2 according to claim 2 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: in described step (1), the sequence of tobacco root-specific promoter NTR2 is SEQIDNo:1, and the sequence of peanut RS gene AhRESS is SEQIDNo:2.
4. specific promoter NtR2 according to claim 1 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: in described step (1), the peanut genetic transformation explant of Agrobacterium rhizogenes mediation is respectively blade, cotyledon, epicotyl and Hypocotyl Explants.
5. specific promoter NtR2 according to claim 1 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: described step (2) transfer pBI121-NTR2-AhRESS peanut Hairy root fluid suspension culture used medium is MS substratum+500mg/LCef, subculture medium is MS substratum+300mg/LCef for the first time, second time subculture medium is MS substratum+100mg/LCef, and subculture medium is MS substratum for the third time; After three subcultures, cephamycin concentration is down to 0.
6. specific promoter NtR2 according to claim 1 drives AhRESS to produce the method for trans-resveratrol at peanut hair-like root system, it is characterized in that: the detection method of described step (3) transfer pBI121-NTR2-AhRESS peanut Hairy root Resveratrol content is HPLC, chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025960.2A CN105505990B (en) | 2016-01-15 | 2016-01-15 | The method that specific promoter NtR2 drives AhRESS to produce resveratrol in peanut hair-like root system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025960.2A CN105505990B (en) | 2016-01-15 | 2016-01-15 | The method that specific promoter NtR2 drives AhRESS to produce resveratrol in peanut hair-like root system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105505990A true CN105505990A (en) | 2016-04-20 |
| CN105505990B CN105505990B (en) | 2019-03-12 |
Family
ID=55714283
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025960.2A Expired - Fee Related CN105505990B (en) | 2016-01-15 | 2016-01-15 | The method that specific promoter NtR2 drives AhRESS to produce resveratrol in peanut hair-like root system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105505990B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
| CN108913716A (en) * | 2018-08-01 | 2018-11-30 | 成都大学 | A kind of rapid induction quinoa hairy method |
| CN110408651A (en) * | 2019-07-31 | 2019-11-05 | 山东省花生研究所 | The method for improving hairy peanut secretion peptide content of peanut |
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
| CN115141838A (en) * | 2022-06-07 | 2022-10-04 | 珠海科技学院 | Construction of resveratrol synthase gene transformation peanut system |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773797A (en) * | 2014-02-19 | 2014-05-07 | 江苏省农业科学院 | Tissue culture method for inducing peanut hairy root |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
-
2016
- 2016-01-15 CN CN201610025960.2A patent/CN105505990B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773797A (en) * | 2014-02-19 | 2014-05-07 | 江苏省农业科学院 | Tissue culture method for inducing peanut hairy root |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
Non-Patent Citations (8)
| Title |
|---|
| GUO,Z.H. ET AL.: ""Arachis hypogaea stilbene synthase mRNA,complete cds"，Accession Number：AY826726.1", 《GENBANK》 * |
| TIANHONG YANG ET AL.: ""Enhanced Production of Resveratrol,Piceatannol,Arachidin-1,and Arachidin-3 in Hairy Root Cultures of Peanut Co-treated with Methyl Jasmonate and Cyclodextrin"", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 * |
| 吴向阳 等: ""HPLC 法测定花生根茎叶中白藜芦醇的含量"", 《食品科学》 * |
| 李凤龙 等: ""植物根特异性启动子研究进展"", 《安徽农业科学》 * |
| 李洁 等: ""白藜芦醇的研究进展"", 《中国现代中药》 * |
| 梁素钰 等: "《新型能源战略植物：橡胶草的开发与利用》", 31 July 2008, 东北林业大学出版社 * |
| 郭仰东: "《植物生物技术实验教程》", 30 June 2015, 《中国农业大学出版社》 * |
| 黄国强 等: ""白藜芦醇合酶基因在花生根中的特异表达"", 《花生学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
| CN108913716A (en) * | 2018-08-01 | 2018-11-30 | 成都大学 | A kind of rapid induction quinoa hairy method |
| CN110408651A (en) * | 2019-07-31 | 2019-11-05 | 山东省花生研究所 | The method for improving hairy peanut secretion peptide content of peanut |
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
| CN115141838A (en) * | 2022-06-07 | 2022-10-04 | 珠海科技学院 | Construction of resveratrol synthase gene transformation peanut system |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105505990B (en) | 2019-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105505990A (en) | Method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 | |
| CN104292317B (en) | Drought resistant correlative protein of plant and coding gene and application thereof | |
| CN104152475A (en) | Tobacco epsilon-lycopene cyclase gene and its application | |
| CN105755020A (en) | Radix notoginseng mitogen-activated protein kinase kinase gene PnMAPKK1 and application thereof | |
| CN104357456A (en) | Specific grape powdery mildew resistant gene VpR8H-1 cDNA (complementary deoxyribonucleic acid) sequence and application of cDNA sequence | |
| CN104086637A (en) | Tobacco strigolactones transport protein NtPDR6 and interference expression vector and application thereof | |
| CN101775409A (en) | Method for obtaining transgenic corns by infecting young ears with agrobacterium | |
| CN102154337A (en) | Gossypium hirsutum mitogen-activated protein kinas 6 (GhMAPK6) gene and application thereof | |
| CN109439663B (en) | Cabbage type rape promoter pBnUnng0942890 and application thereof | |
| CN105543277A (en) | Method for increasing resveratrol produced through peanut hairy root systems in mode that AhRESS is driven by specific promoter NtR12 | |
| CN104531722B (en) | Suaeda salsa RAV genes and the recombinant vector including the gene | |
| CN102618561B (en) | Genes related to stress resistance and application to improving stress resistance of plant to environment | |
| CN105505983A (en) | Method for utilizing NtR2 root promoter for driving AhRESS to generate reseratrol in nicotiana benthamiana hairy roots | |
| CN114149996B (en) | Application of GhAIL6 gene in promoting cotton embryogenic callus formation | |
| CN102499037B (en) | Method for rapid propagation of genetically modified sweet wormwood by hydroponics | |
| CN105505989A (en) | Method for driving AhRESS genes to produce resveratrol in nicotiana benthamiana capillary roots through promoters NtR2 | |
| CN109913466A (en) | The sedum lineare gene of resistance to Cd SlSERK3 and its application | |
| CN104871972B (en) | The high frequency regenerating system method for building up that effectively control watermelon adventitious bud water stainization phenomenon occurs | |
| CN105463016A (en) | Method for inducing transgenic peanut hairy root biological reactor to produce resveratrol | |
| CN110106200B (en) | Application of corn BBM1 gene in improving genetic transformation efficiency of plants | |
| CN107354161A (en) | Watermelon Cla005622 genes are improving the application in liking warm crop low temperature stress resistance | |
| CN105779476A (en) | Tea tree cold-proof gene CsSPMS and plant expression vector construction and application thereof | |
| CN105441478A (en) | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 | |
| CN109837298A (en) | A kind of degeneration-resistant genetic conversion system of sweet cherry roots and its construction method | |
| CN108660143A (en) | Carrier and the application of a kind of cabbage type rape BnKCS1-2 genes and its structure |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190312 Termination date: 20220115 |