CN105441478A - Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 - Google Patents
Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 Download PDFInfo
- Publication number
- CN105441478A CN105441478A CN201610025953.2A CN201610025953A CN105441478A CN 105441478 A CN105441478 A CN 105441478A CN 201610025953 A CN201610025953 A CN 201610025953A CN 105441478 A CN105441478 A CN 105441478A
- Authority
- CN
- China
- Prior art keywords
- ntr2
- ahress
- gene
- tobacco
- pbi121
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/60—Vectors containing traps for, e.g. exons, promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/007—Vectors comprising a special translation-regulating system cell or tissue specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/65—Vectors comprising a special translation-regulating system from plants
Abstract
The invention relates to a method for producing resveratrol by driving AhRESS genes through a tobacco root specific promoter NtR2 and belongs to the field of plant gene engineering. On the basis of cloning the tobacco root specific promoter NtR2 and the peanut AhRESS genes respectively, pBI121 is used as a parent carrier to construct a plant expression carrier pBI121-NtR2-AhRESS; then agrobacterium tumefaciens C58 is converted and tobaccos Cuibi No.1 are genetically transformed through a leaf-disc method to obtain transgenic tobacco plants; the transgenic tobacco plants are subjected to molecular identification and root specific expression function identification. The original tobaccos are genetically transformed by using rooting agrobacterium to mediate the pBI121-NtR2-AhRESS to obtain transgenic original tobaccos, so that the resveratrol only can be specifically expressed in original tobacco roots. The resveratrol in the transgenic original tobacco roots is extracted and is subjected to an HPLC (High Performance Liquid Chromatography) analysis; a result shows that the resveratrol is successfully produced in the transgenic original tobacco hairy roots.
Description
Technical field
The present invention relates to a kind of tobacco root-specific promoter NtR2 drives AhRESS gene to produce the method for trans-resveratrol, belongs to plant genetic engineering field.
Technical background
Trans-resveratrol, its chemistry by name 3,5,4 '-trihydroxy--trans-toluylene (3,5,4 '-trihydroxysitlbene), resvertrol is had another name called, be a kind of important phytoalexin, be present in the plants such as giant knotweed, grape, peanut, in grape pomace and Roots of Peanut, content is particularly abundant.It has multiple biological activity, is a kind of natural antioxidant, can reduces blood fat, anti-platelet clotting, anticancer, anti-inflammatory, and radioprotective is anti-ageing, prevention and cure of cardiovascular disease etc.But the content of the trans-resveratrol that occurring in nature exists is less, utilizes biotechnology to produce trans-resveratrol and be expected to High-efficient Production trans-resveratrol.
In order to improve the content of vegetable material trans-resveratrol, investigator has carried out the research of the key gene RESS genetic transformation of trans-resveratrol synthesis.Giovinazzo etc. carry out tomato genetic transformation with 35S promoter regulation and control Resveratrol synthase gene, measure the aggregate level of ascorbate salt in transgenic Fructus Lycopersici esculenti and glutathione reductase, result shows: the oxidation-resistance of transgenic plant has had significant raising than the oxidation-resistance of wild-type plant.The people such as H ü sken utilize Semen Brassicae campestris specific expression promoter to drive Resveratrol synthase gene to express, transform rape, simultaneously, block another branch road consuming resveratrol synthase substrate, detect T0 for the Res content in rapeseed seeds, find that in its most high-content of fresh weight be 361 μ g/g, also acquire quality improving and the rapeseed seeds that improves of health simultaneously.Gene for the purpose of the Resveratrol synthase gene in peanut such as woods high honour, construct the plant recombination expression vector pB6RS containing goal gene, electroporation is utilized directly to be imported in agrobacterium tumefaciens lba4404 by pB6RS plasmid, by agriculture bacillus mediated by pB6RS transformation of tobacco (Yun yan85), obtain positive plant.But utilize tobacco root-specific to express promoters driven peanut RS gene at tobacco root specifically expressing at present, and the research producing trans-resveratrol have no report.
Tobacco is leaf with crop, and have flourishing root system, general velamen falls as offal treatment, if make Tobacco Root produce trans-resveratrol, then may turn waste into wealth, improve the utility value of tobacco.The present invention is on the basis of having cloned tobacco root-specific promoter NtR2 and peanut AhRESS gene respectively, take pBI121-GUSA as parent vector, the method of being cut connection by enzyme constructs plant expression vector pBI121-NtR2-AhRESS, transform Agrobacterium tumefaciens C58 afterwards, with leaf disk method genetic transformation tobacco dark green No. one (CB-1), obtain transgenic tobacco plant and Molecular Identification has been carried out to it.The RNA that extraction transgene tobacco positive plant root, stem, leaf are respectively organized, carry out RT-PCR respectively, result shows, peanut AhRESS gene is only expressed at Tobacco Root.Extract the trans-resveratrol in transgene tobacco root, carry out HPLC analysis, find that transgene tobacco has only synthesized the trans-resveratrol of peanut in root.The present invention utilizes transgenic technology to produce trans-resveratrol in a large number at Tobacco Root to have established good technical foundation and exploitation prospect.
Summary of the invention
The invention provides a kind of tobacco root-specific promoter NtR2 drives AhRESS gene to produce the method for trans-resveratrol.Object is to provide and utilizes tobacco root-specific promoter to drive peanut RS gene only to express, to produce the technology of trans-resveratrol, so that efficiency utilization plant genetic engineering means High-efficient Production trans-resveratrol at tobacco root.The present invention utilizes existing tobacco root-specific promoter to drive peanut RS gene AhRESS(peanut AhRESS gene), by Agrobacterium tumefaciens-Mediated Transformation tobacco leaf production kind dark green No. one (CB-1), obtain through PCR qualification and turn AhRESS genetic tobacco, analyze the root of transgene tobacco respectively by RT-PCR technology, stem, leaf show AhRESS only at the root specifically expressing of tobacco, do not express at stem and leaf, the Resveratrol content being analyzed each organ by HPLC finds that peanut trans-resveratrol is only expressed at tobacco root.This lays a good foundation for utilizing tobacco root to produce trans-resveratrol, and greatly can improve the value of tobacco leaf production.
For achieving the above object, the present invention adopts following technical scheme:
Tobacco root-specific promoter NtR2 drives AhRESS gene to produce a method for trans-resveratrol, comprises the following steps:
Comprise the following steps:
(1) tobacco root-specific promoter NtR2 and peanut AhRESS gene is cloned;
(2) tobacco root-specific promoter NtR2 drives the structure of peanut AhRESS expression vector pBI121-NtR2-AhRESS;
(3) pBI121-NtR2-AhRESS is through Agrobacterium tumefaciens C58 mediated transformation tobacco, obtains transgenic tobacco plant, and carries out Molecular Identification to it;
(4) Molecular Detection is carried out to transfer-gen plant, utilize HPLC to detect the content of trans-resveratrol in root.
In described step (1), the sequence of tobacco root-specific promoter NtR2 is for such as shown in SEQIDNo:1.
In described step (1), the sequence of peanut AhRESS gene is as shown in SEQIDNo:2.
In described step (2), tobacco root-specific promoter NtR2 drives the carrier that sets out of peanut RS gene AhRESS expression vector to be pBI121 plasmid vector, described root-specific promoter drives the promotor of peanut RS gene AhRESS expression vector to be tobacco root-specific promotor NtR2, and described tobacco root-specific promoter gene NtR2 downstream comprises peanut AhRESS gene.
Step (2) concrete grammar comprises the following steps:
1) clone tobacco root-specific promoter NtR2, and be connected in pMD18-T carrier, obtain pMD18-NtR2 carrier;
2) pBI121-NtR2-GUSA vector construction: pBI121 carrier is carried out enzyme and cuts, excises the GUSA gene on this carrier, clones GUSA gene and be connected on pBI121 carrier from pCAMBIA-1301 carrier, builds pBI121-GUSA; PBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR2 carrier, NtR2 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR2-GUSA carrier;
3) structure of pBI121-NtR2-AhRESS carrier: clone's peanut AhRESS gene, and be connected in pBI121-NtR2-GUSA carrier, obtain pBI121-NtR2-AhRESS carrier.
In described step (3), the genetic transformation of pBI121-NtR2-AhRESS carrier adopts the leaf disk method of Agrobacterium tumefaciens C58 mediation; The DNA extracting transgenic tobacco plant blade by CTAB method carries out PCR Molecular Detection; Extract rotaring gene plant blade and root RNA respectively by improved method of CTAB, carry out RT-PCR with after Reverse Transcriptase kit reverse transcription, carry out destination gene expression pattern analysis.
In described step (4), in transgene tobacco root, trans-resveratrol HPLC detection chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Be specially:
1. the clone of tobacco root-specific promoter NtR2
CTAB method is utilized to extract tobacco leaf genomic dna, with tobacco root-specific promoter NtR2 special primer NtR2-Hind III-promter-F(5 ' ACCAAAGCTTGAATATCTTCAGTATATTCGTTGTG3 '), NtR2-Xba I-promter-R(5 ' ACCATCTAGAGTCTCCTTCTTAATTTTCTATCAAAG3 ') carry out pcr amplification, the specific fragment obtained is NtR2 promotor.The sequence of described tobacco root-specific promoter NtR2 is for such as shown in SEQIDNo:1.
The clone of peanut AhRESS gene
CTAB method is utilized to extract peanut leaf genomic dna, with peanut RS gene special primer RS-BamH I-primer-F(5 ' TCGTGGATCCGCC ACCATGGTGTCTGTGAGTGGAATTC3 '), RS-Sac I-primer-R(5 ' TCCTGAGCT CTTATATGGCCACACTGCGGAGAACG3 ') carry out PCR detection.It reclaims product and is peanut RES genes encoding frame DNA sequence dna.The sequence of described peanut AhRESS gene is as shown in SEQIDNo:2.
Tobacco root-specific promoter NtR2 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR2-AhRESS
(1) tobacco root-specific promoter NtR2 is connected in pMD18-T carrier, obtains pMD18-NtR2 carrier;
(2) pBI121-NtR2-GUSA vector construction: utilize restriction enzyme BamH I and Sac I pair of pBI121 plasmid vector to carry out enzyme and cut, excise the GUSA gene on this carrier, utilize and from pCAMBIA1301 carrier, clone GUSA gene with the special primer of restriction enzyme site, be connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier; Utilize restriction enzyme Hind III and Xho I that pBI121-GUSA carrier is carried out enzyme to cut, excision 35S promoter; Utilized by pMD18-NtR2 carrier restriction enzyme Hind III and Xho I to carry out enzyme to cut, obtain NtR2 promotor, NtR2 promotor is connected in the pBI121-GUSA carrier of excision 35S promoter, obtains pBI121-NtR2-GUSA carrier;
(3) structure of pBI121-NtR2-AhRESS carrier: be connected in pMD18-T carrier by peanut RS gene AhRESS, obtains pMD18-AhRESS carrier, and carries out the qualification of order-checking row; Utilize restriction enzyme Sac I and BamH I that pMD18-AhRESS carrier is carried out enzyme to cut, obtain the AhRESS gene with Sac I and BamH I site; Also carry out enzyme with restriction enzyme Sac I and BamH I pair of pBI121-NtR2-GUSA carrier to cut simultaneously; Afterwards AhRESS gene is connected in pBI121-NtR2-GUSA carrier, namely obtains pBI121-NtR2-AhRESS carrier.
Utilize freeze-thaw method building pBI121-NtR2-AhRESS vector introduction Agrobacterium tumefaciens C58
By dark green No. one of leaf disk method transformation of tobacco improved seeds under C58 mediation, obtain transgenic tobacco plant.Transgenic tobacco plant leaf DNA is extracted, testing goal channel genes situation by CTAB method.The RNA of transgenic tobacco plant blade and root is extracted respectively with modified CTAB method, after utilizing PrimeScript ReverseTranscriptase to carry out reverse transcription, with NtR2-trans-F:GTATTAGCTAGCTATAGTATAC, RS-trans-R:GAACTCATCATACTCTTAGGAC primer carries out pcr amplification, the expression pattern of testing goal gene.
The each organ trans-resveratrol qualification of transgene tobacco
Extract the root of transgene tobacco respectively, stem, each 0.5g of leaf texture fully grind in liquid nitrogen, and then with methyl alcohol supersound extraction 1h in 60 DEG C of water-baths, collected by centrifugation, in triplicate, merge supernatant liquor, in 45 DEG C of rotary evaporations near dry after filtration, by methanol constant volume to 2mL, with 0.22 μm of membrane filtration.HPLC is utilized to detect the content of trans-resveratrol in this uncured tobacco of transgenosis Hairy root.
In transgene tobacco root, trans-resveratrol HPLC detection chromatographic condition is: permaphase ODS (250mm × 4.6mm × 5 μm), moving phase acetonitrile: water (25:75), flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Beneficial effect
The present invention utilizes tobacco root-specific promoter NtR2 to drive AhRESS gene specifically expressing in Tobacco Root, tobacco waste root system in production can be made for the production of trans-resveratrol, to improve the economic worth of tobacco; Simultaneously because expressing gene is not expressed at tobacco leaf, do not affect morphological specificity and the quality factor of the blade of tobacco.This, for improving the economic use value of tobacco, has important exploitation prospect.
Accompanying drawing explanation
Fig. 1 plant expression vector pBI121-NtR2-AhRESS schematic diagram.
The pcr amplification electrophorogram of Fig. 2 tobacco NtR2 promotor.M:Marker2000,1,2: tobacco NtR2 promotor.
The pcr amplification electrophorogram of Fig. 3 peanut RS gene AhRESS.M：Marker2000，1：AhRESS。
Fig. 4 plant expression vector pBI121-NtR2-AhRESS bacterium liquid PCR electrophorogram.M:Marker2000,1-12: bacterium liquid PCR, 13: positive control, 14: negative control.
Fig. 5 plant expression vector pBI121-NtR2-AhRESS restriction enzyme digestion and electrophoresis figure.1-3: plasmid 1 is respectively with Sac I, BamH I single endonuclease digestion and Sac I and BamH I double digestion, 4-6: plasmid 2 respectively with Sac I, BamH I single endonuclease digestion and Sac I and BamH I double digestion, 7-9: plasmid 3 is respectively with Sac I, BamH I single endonuclease digestion and Sac I and BamH I double digestion.
In Fig. 6 transgene tobacco hair-like root system genomic dna, AhRESS gene PCR detects electrophorogram.Figure A ~ C.pBI121-NtR2-AhRESS transformation of tobacco CB-1. schemes the PCR qualification of D. transgenic tobacco plant, M:Marker2000,1-20: positive control, 21-23: negative control .E.RT-PCR analyzes the expression of AhRESS gene in Tobacco Root, stem, leaf, NtR2 promotor only starts AhRESS gene and expresses (E3) at root, do not express in stem (E1) and leaf (E2), wherein 1-12 is AhRESS gene PCR product.
Trans-resveratrol HPLC analytical results in this uncured tobacco of Fig. 7 transgenosis hair-like root system.
Embodiment
The clone of [embodiment 1] tobacco root-specific promoter NtR2
Take about 0.1g tobacco leaf, be placed in mortar frozen-thawed, be ground into powder rapidly; Utilize the DNA in CTAB method extraction tobacco, dissolve with the RNase sterilized water of 40 μ L, 10ng/ μ L, be placed in 37 DEG C and dissolve about 1h.Get the tobacco DNA point sample that 1 μ L extracts, carry out electrophoresis detection, deposition condition: electrophoretic buffer 1 × TAE, the sepharose of 1.0%, voltage 120V, electrophoresis time is about 20min; Get 1 μ L ultraviolet spectrophotometer simultaneously and measure its concentration (Fig. 1).
According to the splicing sequence of the NtR2 promotor of this laboratory clone in early stage acquisition, design primer NtR2-Hind III-promter-F(5 ' accaaagcttGAATATCTTCAGTATATTCGTTGTG3 '), NtR2-Xba I-promter-R(5 ' accatctagaGTCTCCTTCTTAATTTTCTATCAAAG3 '), increase according to following PCR system.This system comprises 32.5 μ LddH
2o, 10 μ L10 × PrimeSTARPCRBuffer(Mg
2+plus), the each 2.5mmol of 4 μ LdNTPMixture(), 1 μ LNtR2-Hind III-primer-F(10 μm ol), 1 μ LNtR2-Xba I-primer-R(10 μm ol), 1 μ L tobacco cDNA, 0.5 μ LPrimeSTARHSDNApolymerase(2.5U/ μ L), system cumulative volume is 50 μ L.
The PCR reaction system of 50 μ L is mixed, is divided into 2 pipes, often manages each 25 μ L.PCR reaction conditions is: 98 DEG C of 5min → (98 DEG C of 10s → 53 DEG C 15s → 72 DEG C 2min) 5cycles → (98 DEG C of 10s → 60 DEG C 15s → 72 DEG C 2min) DEG C 10min → 4,23cycles → 72 DEG C are preserved.
PCR primer reclaims after purifying through agarose gel electrophoresis, and be connected in pMD18-TVector, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 16-24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 12-16h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects, and sequencing result is as SEQIDNO.1.The correct recombinant plasmid of sequencing result is pMD18-NtR2.
The clone of [embodiment 2] peanut RS gene AhRESS
CTAB method is utilized to extract peanut leaf genomic dna, with peanut RS gene special primer RS-BamH I-primer-F (5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGG AATTC3 '), RS-Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCG GAGAACG3 ') carry out PCR detection (Fig. 3).It reclaims product and is peanut AhRESS genes encoding frame DNA sequence dna.Be structured in pMD18-T carrier by ligase enzyme, proceed in competent escherichia coli cell DH5 α, select positive colony and carry out order-checking qualification, sequencing result is as SEQIDNO.2.
The structure of [embodiment 3] pBI121-NtR2-AhRESS carrier
(1) pBI121-NtR2-GUSA vector construction
With pCAMBIA-1301 vector plasmid for template, carry out PCR with the special primer (GUSAF-BamH I-Spe I: 5 ' aggaGGATCCACTAGTaccatggtagatctgagggtaaatttc3 ' and GUSAR-Sac I-Asc I-Swa I: 5 ' aggagagctcGGCGCGCCTAAATTTAGAAATTCGAGCTGGTCACCTGT3 ') with restriction enzyme site, it reclaims product and is the GUSA gene of cloning and obtaining.Utilized by pBI121 carrier BamH I and Sac I to carry out enzyme to cut, excise the GUSA gene on this carrier, reclaim enzyme cut after carrier ribbon; GUSA gene is connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier.
Utilized by pMD18-NtR2 carrier restriction enzyme Xba I and Hind III to carry out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Mbuffer, 2.0 μ LXba I, 2.0 μ LHind III, ddH
2o mends to 50 μ L, and mixing, cuts 10-12h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains NtR2 promotor.
Utilize restriction enzyme Xba I and Hind III that pBI121-GUSA carrier is carried out enzyme to cut, excision 35S promoter, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Mbuffer, 2.0 μ LHind III, 2.0 μ LXba I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
NtR2 promotor be connected in the pBI121-GUSA carrier of excision 35S promoter, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, and PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LNtR2-Xho I-primer-F, 0.5 μ LNtR2-Xba I-primer-R, 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 53 DEG C 30s → 72 DEG C 2min) 5cycles → (94 DEG C of 30s → 60 DEG C 30s → 72 DEG C 2min) DEG C 10min → 4,30cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR2-GUSA carrier.
(2) structure of pBI121-NtR2-AhRESS carrier
Be connected in pMD18-T carrier by peanut RS gene AhRESS, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 14h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects.The correct recombinant plasmid of sequencing result is pMD18-AhRESS.
Utilize restriction enzyme Sac I and BamH I that pMD18-AhRESS carrier is carried out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains the AhRESS gene with Sac I and BamH I site.
Carry out enzyme with restriction enzyme Sac I and BamH I pair of pBI121-NtR2-GUSA carrier to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
Be connected to by AhRESS gene in pBI121-NtR2-GUSA carrier, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LAhRESS-BamH I-primer-F(5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGGAATTC3 '), 0.5 μ LAhRESS--Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCGGAGAACG3 '), 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 69 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR2-AhRESS carrier (Fig. 1).
[embodiment 4] pBI121-NtR2-AhRESS carrier genetic transformation tobacco
Utilize and built pBI121-NtR2-AhRESS carrier through Agrobacterium tumefaciens C58 mediated transformation tobacco (Fig. 6), concrete steps are as follows:
(1) explant infects: on Bechtop, tobacco aseptic seedling being taken out from tissue culture bottle is placed on sterilized dry filter paper, filter paper falls to put a sterilized water, filter paper is made to keep moistening, with scalper, this uncured tobacco blade is scaled off, first cut vein, then the edge of leaf is also cut away and (stay wound, be convenient to infect), be cut into the blade of about 0.5cm × 0.5cm size again, this uncured tobacco blade cut is transferred in aseptic tissue culture bottle, first get 20 this uncured tobacco blades, be inoculated into the substratum GIM(MS+1.5mg/L6-BA+0.5mg/LIAA of 2 bottles of Dual culture respectively) middle Dual culture, every bottle graft kind 10, in contrast, then remaining this uncured tobacco blade is divided into four parts, the engineering bacteria liquid containing recombinant plasmid prepared is poured in the tissue culture bottle filling this uncured tobacco blade respectively, constantly rock bottle gently, continue to infect 10min, do not exceed 10min,
(2) Dual culture: outwell and infect liquid, unnecessary bacterium liquid is blotted with aseptic filter paper, this uncured tobacco infected is put into Dual culture base GIM substratum (MS+1.5mg/L6-BA+0.5mg/LIAA) Dual culture, 28 DEG C of light culture 2-3d, depending on the growing way of bacterium, each vector gene respectively has 40 explants, namely respectively has 4 bottles, totally 18 bottles (containing 2 bottles of contrasts);
(3) bacterium is washed: 28 DEG C of light culture 3d, first by 2 bottles contrast tobacco be transplanted to bud inducement substratum SIK-15(MS+1.5mg/L6-BA+0.5mg/LIAA+500mg/LCef+100mg/LKan) in carry out bud inducement, in sterilized tissue culture bottle, then add cephamycin (Cef) aqueous solution that 50mL final concentration is 1000mg/L, this uncured tobacco blade is taken out from Dual culture substratum, be placed in the cephalo aqueous solution, constantly rock bottle gently, continue 10min, then blade is taken out, repeat once, then blade is put into the bottle containing 50mL sterilized water, constantly rock bottle gently, continue about 5min,
(4) bud inducement: this uncured tobacco blade of washed bacterium is proceeded to bud inducement substratum SIK-15(MS+1.5mg/L6-BA+0.5mg/LIAA+500mg/LCef+15mg/LKan) in carry out luring blastogenesis long;
(5) to take root and root of hair: when bud grows to 2cm, indefinite bud can be scaled off and carry out nature root culture (MS+500mg/LCef+0.05mg/LNAA) and hairy root culture.
[embodiment 5] transgene tobacco root RESS specifically expressing
(1) extraction of transgene tobacco root, stem, leaf total serum IgE
By transgene tobacco CB-1 transplant in greenhouse pot, plant to be planted grow to prosperous long-term time, partial blade and stem section are taken off clean, blot with filter paper, be placed in freezing rearmounted-80 DEG C of refrigerators of liquid nitrogen and preserve.Get 1g tissue to be placed in mortar and to add liquid nitrogen grinding, get 0.1g and pour in the 0.5ml guanidinium isothiocyanate denatured homogenate liquid of precooling, fully mix 1min.Add 0.1ml2mol/LNaAc(pH4.0) mix 1min; Add 0.5ml water-saturated phenol, vibrate 30 seconds, ice bath 5min.Add 0.2ml chloroform: primary isoamyl alcohol (24:1), thermal agitation 2 3min, place 10min on ice.4 DEG C, the centrifugal 15min of 12000g.Carefully pipette upper strata aqueous phase, discard middle and lower floor's organic phase.Add equal-volume phenol: chloroform: primary isoamyl alcohol (25:24:1), vibrate 2 3min, places 5min on ice.4 DEG C, the centrifugal 15min of 12000g, pipettes upper strata aqueous phase, discards middle and lower floor's organic phase.Add equal-volume Virahol, place-20 DEG C of 30 points of kinds with precipitated rna.4 DEG C, the centrifugal 15min of 12000g collects RNA precipitation, by 75% washing with alcohol precipitation; RNA is deposited in air drying.RNA precipitation is dissolved with 30ulRNase-freeddH2O or deionized formamide.
(2) RT-PCR of transgene tobacco root, stem, leaf
Get transgene tobacco each total tissue RNA 1 μ g, by according to the reaction system in Reverse Transcriptase kit, carry out reverse transcription.Dilute the reverse transcription product of 3 times for template with 1 μ l, add sterile purified water 14.4 μ l successively, 10xPCRBufferII(Mg
2+plus) 2 μ l, Taq0.1 μ l, dNTPMixture(2.5m) 1.50 μ l, RS-primer-F(5 ' ATGGTGTCTGTGAGTGGAATTC3 ') and RS-primer-R(5 ' TTATATGGCCACACTGCGGAGAAC3 ') each 0.5 μ l.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.
The detection of [embodiment 6] transgene tobacco Resveratrol content
Carry out resveratrol assay according to the following steps to transgenosis and non-transgenic tobacco sample to compare (Fig. 7).
(1) trans-resveratrol HPLC detects chromatographic condition: permaphase ODS (250mm × 4.6mm × 5 μm), moving phase acetonitrile: water (25:75), flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
(2) preparation of trans-resveratrol standard substance storing solution: accurately take trans-resveratrol standard substance 5.0mg, dissolves with methyl alcohol (chromatographically pure) and is settled to 50mL, obtains the trans-resveratrol standard substance storing solution of 100mg/L, is placed in 4 DEG C of refrigerators and keeps in Dark Place, for subsequent use.
(3) preparation of trans-resveratrol standard working solution: accurately pipette trans-resveratrol standard substance storing solution 2mL, 4mL, 6mL, 8mL, 10mL methyl alcohol (chromatographically pure) respectively and dilute and be settled to 1000mL, obtain a series of trans-resveratrol standard substance working fluid, its mass concentration is respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L.
(4) pretreatment: the transgene tobacco getting-80 DEG C of preservations is respectively organized, correct amount 0.5g, in liquid nitrogen, grinding is fully, be placed in centrifuge tube respectively, add 5mL methyl alcohol, supersound extraction 1h in 60 DEG C of water-baths, the centrifugal 10min of 6000rpm, collects supernatant, in triplicate, merge supernatant liquor, in 45 DEG C of rotary evaporations near dry after filtration, by methanol constant volume to 2mL, with 0.22 μm of membrane filtration, obtain pretreated sample solution, for subsequent use.The extraction of liquid MS medium trans-resveratrol is got: 20mL liquid MS medium, 30mL extraction into ethyl acetate 5min; Collect upper organic phase, with Rotary Evaporators, organic phase is steamed to about 1mL in 45 DEG C; Ethyl acetate is settled to 2mL, for subsequent use.
(5) drafting of typical curve: each 10 μ L of the trans-resveratrol standard solution sample introduction being respectively respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L with mass concentration, record the relation between peak area and Resveratrol content, drawing standard curve.
(6) Precision Experiment: the trans-resveratrol standard solution getting 1.0 μ g/mL, continuous sample introduction 5 times, each 10 μ L, survey its peak area, calculate RSD value.
(7) stability experiment: each tissue sample solution of the same transgene tobacco of accurate absorption, in 0h, 2h, 4h, 6h, 8h sample introduction respectively, sample size 10 μ L, measures peak area, calculates RSD value.
(8) circulation ratio experiment: get appropriate each tissue, carry out sample pretreatment according to the method described above, often kind of a sample processes 5 parts, measures peak area respectively, calculates corresponding RSD value.
(9) mensuration of Resveratrol content in each tissue: get each 10 μ L sample introductions of pretreatment sample solution, every sample does three repetitions, calculate root according to typical curve, stem, leaf respectively organize in the content of trans-resveratrol, average as experimental result.Result shows trans-resveratrol only in the synthesis of tobacco root, and the Resveratrol content of this uncured tobacco of transgenosis root is not genetically modified 2.5 times.
The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.
SEQUENCELISTING
<110> University Of Agriculture and Forestry In Fujian
<120> tobacco root-specific promoter NtR2 drives AhRESS gene to produce the method for trans-resveratrol
<130>12
<160>12
<170>PatentInversion3.3
<210>1
<211>1574
<212>DNA
<213> tobacco NTR2 specific promoter
<400>1
gaatatcttcagtatattcgttgtgtattttttcacttagattgtaaagtgtctatcaca
60
tctgatataggtcgtagtcctaatggttgtgattatttaactgttacatttcattgggtt
120
gatcatcactggaacatgcaaaaatatattattggttataaatttgttgattcaaaacac
180
actggagcatttattgctactactgttgtacaaattattaatttttatggattcatcaat
240
aaagttttaactatcaccttagataatacttctgctaagtgctaacacaactgcaacaac
300
tagcttaatgaaatgattgcaaaattaatccaacttatgcaccggctattaatgaaatga
360
ttgcaaaattttaaaagtatttttttcctattccccaagtttatttaatttctactatac
420
ttaacccatctttaaaattaagaggtgcaaatggacttgttcgtaaaatttatgagaatt
480
tagcaattcaagaaaatgaacaaccatctctcgaagactgccaaactaacatatattctt
540
atgttagatcaatatttgataaatataaatctatggaaacaacatgtgggtgaaactagg
600
gaagaagaagaatacaatgagatacttaggactgggagctatgacggcatggaactcatg
660
gaacatcaatcaacattgccaattccataacaatgtccgagagaaattataaataagtta
720
caacgaagttatatatgagcttacaaatattagtatgataatttgtaattggctactaag
780
aggcctagttcaaacagaacccttcctagaaggtggctgcatagattatgtgctattcaa
840
aagaattatatttgtatgtgagatttgaaagttatattaataaaataaaaggctttaagc
900
gttgaatttgttttatgaattgtcttacactctttagttacttaatggcttgaaattgta
960
ttaaataaattataactctattataaatttataattactagaatatttcattacaagtct
1020
ttttttttaatattttataattctttacttaattttctaattttcgtttaatttttaagt
1080
ttattaaataagtcaaaaactaggtgttgcaaactttaaaaacttagtcgttgtcaaaag
1140
aatagccgttgccaaactcaatgattaagtaattttttttttaaaacgacacttaaggcc
1200
cacgaacccgtcccgtcccgttccgtcccatcccgtttgttagcgggacgggatgagatg
1260
gacctaccgtttcgtcccgtcccggctaaatatcgtcccgtcctgttggacagccataga
1320
tacccctacttatgtgcacttccttggcctacggaattcaaggaagatatatacagatct
1380
ctgaaatagggaaacgcgccatttcctgtttatgaacttttgaattaatcataagcatta
1440
ttttcctaacacaatttctacgcatgcttatataaattaatatataatatgtcaagttgt
1500
aataatggtgggggtattagctagctatagtatacattttaacacaaactttgatagaaa
1560
attaagaaggagac
1574
<210>2
<211>1170
<212>DNA
<213> peanut RS gene AhRESS
<400>2
atggtgtctgtgagtggaattcgcaaagttcaaagggcagaaggccctgcaactgtattg
60
gcgataggcacagcaaatccaccaaattgtattgatcagagcacatatgctgattattat
120
tttagagtaactaacagtgaacacatgactgatctcaagaagaagtttcagcgcatttgt
180
gagagaacacaaatcaagaacagacatatgtacttaacagaagagatactgaaagagaat
240
cctaacatgtgcgcatataaagcaccgtcgttggatgcaagggaagacatgatgatcagg
300
gaggtaccaagggttggaaaagaggctgcaaccaaggccatcaaggaatggggtcagcca
360
atgtctaagatcacacatttgatcttctgcaccaccagcggtgttgcattgcctggcgtt
420
gattacgaactcatcatactcttaggactcgacccatccgtcaagaggtacatgatgtac
480
caccaaggctgcttcgccggtggcactgtccttcgtttggctaaggacttggctgaaaac
540
aacaaggatgctcgtgtgcttatcgtttgttctgagaataccgcagtcactttccgtggt
600
cctagtgagacagacatggatagtcttgtagggcaagccttgtttgctgatggagctgct
660
gcgattatcattggttctgatcctgtgccagaggttgaaaagcctatctttgaaattgtt
720
tcgactgatcaaaaacttgtccctaacagccatggagccatcggtggtctccttcgtgaa
780
gttgggcttacattctatcttaataagagtgttcctgatattatttcacaaaacatcaat
840
gatgcgctcagtaaagcttttgatccattgggtatatctgattataactcaatattttgg
900
attgcacatcctggtggacgtgcaattttagaccaggttgaacagaaagtgaacttgaaa
960
ccagaaaagatgaaagccactagagacgtgcttagcaattatggtaacatgtcaagtgca
1020
tgtgtgtttttcattatggatttgatgaggaagaagtctcttgaagaaggacttaaaacc
1080
actggtgaaggacttgattggggtgtgcttcttggctttggtcctggtcttactattgaa
1140
accgttgttctccgcagtgtggccatataa
1170
<210>3
<211>35
<212>DNA
<213> artificial sequence
<400>3
accaaagcttgaatatcttcagtatattcgttgtg
35
<210>4
<211>36
<212>DNA
<213> artificial sequence
<400>4
accatctagagtctccttcttaattttctatcaaag
36
<210>5
<211>38
<212>DNA
<213> artificial sequence
<400>5
tcgtggatccgccaccatggtgtctgtgagtggaattc
38
<210>6
<211>35
<212>DNA
<213> artificial sequence
<400>6
tcctgagctcttatatggccacactgcggagaacg
35
<210>7
<211>22
<212>DNA
<213> artificial sequence
<400>7
gtattagctagctatagtatac
22
<210>8
<211>22
<212>DNA
<213> artificial sequence
<400>8
gaactcatcatactcttaggac
22
<210>9
<211>43
<212>DNA
<213> artificial sequence
<400>9
aggaggatccactagtaccatggtagatctgagggtaaatttc
43
<210>10
<211>48
<212>DNA
<213> artificial sequence
<400>10
aggagagctcggcgcgcctaaatttagaaattcgagctggtcacctgt
48
<210>11
<211>22
<212>DNA
<213> artificial sequence
<400>11
atggtgtctgtgagtggaattc
22
<210>12
<211>24
<212>DNA
<213> artificial sequence
<400>12
ttatatggccacactgcggagaac
24
Claims (7)
1. tobacco root-specific promoter NtR2 drives AhRESS gene to produce a method for trans-resveratrol, it is characterized in that: comprise the following steps:
(1) tobacco root-specific promoter NtR2 and peanut AhRESS gene is cloned;
(2) tobacco root-specific promoter NtR2 drives the structure of peanut AhRESS expression vector pBI121-NtR2-AhRESS;
(3) pBI121-NtR2-AhRESS is through Agrobacterium tumefaciens C58 mediated transformation tobacco, obtains transgenic tobacco plant, and carries out Molecular Identification to it;
(4) Molecular Detection is carried out to transfer-gen plant, utilize HPLC to detect the content of trans-resveratrol in root.
2. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: in described step (1), the sequence of tobacco root-specific promoter NtR2 is for such as shown in SEQIDNo:1.
3. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: in described step (1), the sequence of peanut AhRESS gene is as shown in SEQIDNo:2.
4. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: in described step (2), tobacco root-specific promoter NtR2 drives the carrier that sets out of peanut RS gene AhRESS expression vector to be pBI121 plasmid vector, described root-specific promoter drives the promotor of peanut RS gene AhRESS expression vector to be tobacco root-specific promotor NtR2, and described tobacco root-specific promoter gene NtR2 downstream comprises peanut AhRESS gene.
5. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: step (2) concrete grammar comprises the following steps:
1) clone tobacco root-specific promoter NtR2, and be connected in pMD18-T carrier, obtain pMD18-NtR2 carrier;
2) pBI121-NtR2-GUSA vector construction: pBI121 carrier is carried out enzyme and cuts, excises the GUSA gene on this carrier, clones GUSA gene and be connected on pBI121 carrier from pCAMBIA-1301 carrier, builds pBI121-GUSA; PBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR2 carrier, NtR2 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR2-GUSA carrier;
3) structure of pBI121-NtR2-AhRESS carrier: clone's peanut AhRESS gene, and be connected in pBI121-NtR2-GUSA carrier, obtain pBI121-NtR2-AhRESS carrier.
6. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: in described step (3), the genetic transformation of pBI121-NtR2-AhRESS carrier adopts the leaf disk method of Agrobacterium tumefaciens C58 mediation; The DNA extracting transgenic tobacco plant blade by CTAB method carries out PCR Molecular Detection; Extract rotaring gene plant blade and root RNA respectively by improved method of CTAB, carry out RT-PCR with after Reverse Transcriptase kit reverse transcription, carry out destination gene expression pattern analysis.
7. a kind of tobacco root-specific promoter NtR2 according to claim 1 drives AhRESS gene to produce the method for trans-resveratrol, it is characterized in that: in described step (4), in transgene tobacco root, trans-resveratrol HPLC detection chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025953.2A CN105441478A (en) | 2016-01-15 | 2016-01-15 | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025953.2A CN105441478A (en) | 2016-01-15 | 2016-01-15 | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105441478A true CN105441478A (en) | 2016-03-30 |
Family
ID=55552108
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025953.2A Pending CN105441478A (en) | 2016-01-15 | 2016-01-15 | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105441478A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090035839A1 (en) * | 2005-02-22 | 2009-02-05 | Fluxome Sciences A/S | Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof |
| CN101824404A (en) * | 2009-03-03 | 2010-09-08 | 中国科学院植物研究所 | Resveratrol synthase as well as encoding gene and application thereof |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
-
2016
- 2016-01-15 CN CN201610025953.2A patent/CN105441478A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090035839A1 (en) * | 2005-02-22 | 2009-02-05 | Fluxome Sciences A/S | Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof |
| CN101824404A (en) * | 2009-03-03 | 2010-09-08 | 中国科学院植物研究所 | Resveratrol synthase as well as encoding gene and application thereof |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
Non-Patent Citations (4)
| Title |
|---|
| CHENEY，Y ET AL.: "Accession Number：AY170347.1", 《GENBANK》 * |
| 林荣华: "花生白藜芦醇合酶基因转化烟草与番茄的初步研究", 《万方.中国学位论文全文数据库》 * |
| 许玉芬 等: "花生白藜芦醇合酶基因转化单子叶植物表达载体的构建", 《福建师范大学学报(自然科学版)》 * |
| 郑钦: "花生白藜芦醇合酶基因在烟草根部的表达", 《中国优秀硕士学位论文全文数据库.基础科学辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108164588B (en) | Application of cotton transporter GhBASS5 gene in salt tolerance of plants | |
| CN105505990A (en) | Method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 | |
| CN116004657B (en) | Musa paradisiaca maturation-related gene MbGRF1 and application thereof | |
| CN115466749A (en) | Application method of gingko bZIP transcription factor GbbZIP08 in promotion of plant flavonoid synthesis | |
| CN102061297B (en) | Transgenic method for improving salvianolic acid B content in root of red-rooted salvia | |
| CN106480086A (en) | Quickly obtain method and its application of transgenic peanuts using crosscutting peanut seed | |
| CN105296502A (en) | Pear hexose transport protein gene PbHT1 and application thereof | |
| CN105441478A (en) | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 | |
| CN105907733B (en) | A kind of Sophora alopecuroide inositol transmethylase and its encoding gene and application | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN113637680B (en) | Application of salvia miltiorrhiza transcription factor SmbHLH124 in improving hairy root yield traits of salvia miltiorrhiza | |
| CN105543277A (en) | Method for increasing resveratrol produced through peanut hairy root systems in mode that AhRESS is driven by specific promoter NtR12 | |
| CN105463016B (en) | Method for inducing transgenic peanut hairy root bioreactor to produce resveratrol | |
| CN116732088B (en) | Application of PpyBZR2 gene in promoting pear dormancy bud germination | |
| CN105505989A (en) | Method for driving AhRESS genes to produce resveratrol in nicotiana benthamiana capillary roots through promoters NtR2 | |
| CN105505983A (en) | Method for utilizing NtR2 root promoter for driving AhRESS to generate reseratrol in nicotiana benthamiana hairy roots | |
| CN112011550A (en) | Method for blocking exchange of petiole phloem identification signals | |
| CN103773801A (en) | Application for breeding transgenic water-saving and drought-resistance plant by using aspen ABA (Abscisic Acid) receptor PtPYRL gene | |
| CN116376936B (en) | Method for biosynthesis of ginkgolic acid and gene sequence thereof | |
| CN108660143A (en) | Carrier and the application of a kind of cabbage type rape BnKCS1-2 genes and its structure | |
| CN116769797B (en) | Application of methyl jasmonate and PpyMYC2 gene in germination | |
| CN114395566B (en) | Application of sweet potato ERF transcription factor IbERF4 in promoting synthesis of plant chlorogenic acid substances | |
| CN111713288B (en) | Inoculation method of Chinese wheat mosaic virus CWMV | |
| CN116334131A (en) | Construction method of homologous silencing system of paeonia plant bud dormancy gene | |
| CN115918546A (en) | Transgenic artemisia apiacea and method for improving content of artemisinin in artemisia apiacea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160330 |
|
| RJ01 | Rejection of invention patent application after publication |