CN115466749A - Application method of gingko bZIP transcription factor GbbZIP08 in promotion of plant flavonoid synthesis - Google Patents

Abstract

The invention discloses an application method of a gingko bZIP transcription factor GbbZIP08 in promotion of plant flavonoid synthesis, belonging to the technical field of plant molecular genetic engineering, wherein the invention separates and obtains complete cDNA for coding the GbbZIP08 transcription factor from gingko, the cDNA is connected to a plant overexpression vector, agrobacterium is utilized to mediate and transform plants, and the transient expression of tobacco proves that GbbZIP08 is positioned in plant cell nucleus; transgenic arabidopsis and transgenic tobacco are obtained by an inflorescence infection method and a leaf disc transformation method respectively, and results show that overexpression of GbbZIP08 can improve accumulation of flavonoid substances in plants. The invention provides a certain research basis and gene resources for the research of the bZIP transcription factor for promoting the synthesis of plant flavonoids.

Description

Application method of gingko bZIP transcription factor GbbZIP08 in promotion of plant flavonoid synthesis

Technical Field

The invention belongs to the technical field of plant molecular genetic engineering, and particularly relates to an application method of a gingko bZIP transcription factor GbbZIP08 in promoting plant flavonoid synthesis.

Background

Gingko (Ginkgo biloba L.) is a deciduous tree of Ginkgoaceae and Ginkgoaceae, is the oldest wiggery plant on the earth and is also a unique medicinal plant resource in China. The main active ingredients in folium Ginkgo extract include flavonoids, terpene lactones, long-chain phenols, proanthocyanidins, phenolic acid, etc. Wherein, the content of flavonoid in the ginkgo biloba extract EGB is internationally and uniformly specified to be 24 percent, which has the functions of enhancing immunity, anti-cancer activity, anti-aging activity and the like and has important curative effect on the aspects of preventing and treating cardiovascular and cerebrovascular diseases and the like. However, the very low flavonoid content of most ginkgo varieties has been a significant obstacle to the intensive research and development of ginkgo biloba preparations. At present, genetic improvement is carried out by utilizing a genetic engineering technology aiming at key regulatory factors of secondary metabolites, which has important significance for improving the content of ginkgo flavonoids, and no relevant report about the regulation of the metabolism of the flavonoids by a ginkgo bZIP transcription factor is found at present.

Disclosure of Invention

The invention aims to solve the existing problems and provides an application method of a gingko bZIP transcription factor GbbZIP08 in promoting the synthesis of plant flavonoids.

The invention is realized by the following technical scheme:

an application method of a gingko bZIP transcription factor GbbZIP08 in promoting the synthesis of plant flavonoids comprises the following steps:

step 1: the gene sequence of GbbZIP08 cloned from ginkgo through PCR amplification is shown in a sequence table SEQ ID NO.1, and the coded amino acid sequence obtained through translation is shown in a sequence table SEQ ID NO. 2;

and 2, step: performing first-generation sequencing on the gene sequence cloned in the step 1 to obtain a base sequence of the GbbZIP08 gene, and performing subsequent gene sequence analysis and expression vector construction primer design;

and step 3: the cloned GbbZIP08 is constructed on a pNC-Cam1304-SubC plant subcellular localization vector and a pNC-Cam2304-MCS35S plant overexpression vector by a Nimble cloning method;

and 4, step 4: transforming agrobacterium GV3101 by the pNC-Cam1304-SubC-GbbZIP08 expression vector constructed in the step 3, using the expression vector for tobacco transient transformation, observing the subcellular localization of GbbZIP08 in plants, and using an empty vector as a control;

and 5: transforming the pNC-Cam2304-MCS35S-GbbZIP08 expression vector in the step 3 into agrobacterium, transforming the agrobacterium into arabidopsis by adopting an arabidopsis inflorescence infection method, and transforming the agrobacterium into tobacco by adopting a tobacco leaf disc transformation method;

step 6: obtaining transgenic arabidopsis homozygous seeds by adopting resistance screening, and obtaining a transgenic tobacco regeneration system by a plant tissue culture method; verifying the transgenic plant by using positive PCR, GUS staining and qRT-PCR methods;

and 7: and (4) carrying out flavonoid content detection on the transgenic plant and the wild plant obtained in the step (6), and analyzing the influence of overexpression of GbbZIP08 on flavonoid synthesis in the plant.

Compared with the prior art, the invention has the following advantages:

the invention separates complete cDNA for coding GbbZIP08 transcription factor from ginkgo, connects the cDNA to a plant over-expression vector, transforms plants by agrobacterium mediation, and proves that GbbZIP08 is positioned in plant cell nucleus by tobacco transient expression; transgenic arabidopsis thaliana and transgenic tobacco are obtained by an inflorescence infection method and a leaf disc transformation method respectively, and the result shows that overexpression of GbbZIP08 can improve the accumulation of flavonoid substances in plants. The invention provides a certain research basis and gene resources for the research of bZIP transcription factor promoting plant flavonoid synthesis.

Drawings

FIG. 1 is a heat map of correlation analysis of FPKM value and total flavone content of bZIP gene in 8 tissues of Ginkgo biloba;

FIG. 2 is a diagram showing the result of phylogenetic tree analysis of the amino acid sequence of GbbZIP 08;

FIG. 3 is a schematic diagram of pNC-Cam1304-SubC-pNC-GbbZIP08 plant subcellular localization vector and Cam2304MCS-35S-GbbZIP08 overexpression vector;

FIG. 4 is a graph showing the result of subcellular localization of GbbZIP 08;

FIG. 5 is a diagram of a transgenic Arabidopsis homozygous screen;

FIG. 6 is a diagram obtained by a tobacco genetic transformation system;

FIG. 7 is a diagram showing the positive PCR identification result of the transgenic plant;

FIG. 8 is a GUS staining map of transgenic plants;

FIG. 9 is a diagram showing the result of quantitative analysis of transgenic plant GbbZIP 08;

FIG. 10 is a diagram showing the results of analysis of total flavone content in transgenic plants;

FIG. 11 is a graph showing the results of analysis of kaempferol content in transgenic plants;

FIG. 12 is a diagram showing the result of the anthocyanin content analysis of the transgenic plants.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Examples

An application method of a gingko bZIP transcription factor GbbZIP08 in promoting the synthesis of plant flavonoids comprises the following steps:

(1) Screening and identifying the bZIP gene family of the ginkgo:

based on a gingko genome database, screening 40 GbbZIP genes from the gingko genome database by using local blast; analyzing the correlation between transcriptome data of 8 tissues of gingko and flavonoid content;

it was found that there is a high positive correlation between GbbZIP08 gene and ginkgo biloba flavonoid content (figure 1);

the phylogenetic tree analysis shows that GbbZIP08 is a homologous gene of Arabidopsis AtbZIP56 (FIG. 2);

(2) The GbbZIP08 gene sequence in the ginkgo is obtained:

grinding fresh ginkgo leaves in a mortar precooled by liquid nitrogen, extracting plant RNA according to an RNA extraction kit (TaKaRa) specification, detecting the RNA integrity by using gel electrophoresis after the extraction is finished, detecting the RNA concentration by using a NanoDrop instrument, carrying out reverse transcription on qualified RNA samples by using an RNA reverse transcription kit (Vazyme), and synthesizing cDNA according to a product specification;

designing a cloning primer (U: ATGGCTTTTGGAGATCTCAG; D: TTAAGGTACTGTCTAAGCATG) according to the CDs sequence of GbbZIP08 in the ginkgo genome;

amplifying a target gene by PCR, purifying and recovering, connecting the target gene to a T carrier by using TA cloning, converting to an escherichia coli competence, selecting a monoclonal M13 primer for carrying out bacterial liquid PCR verification, storing a part of a positive cloned bacterial liquid by 50% glycerol for later use, and sending a part of the positive cloned bacterial liquid to a Shanghai bio-corporation for sequencing to obtain a gene sequence shown as a sequence table SEQ ID NO. 1;

(3) Construction of GbbZIP08 expression vector in gingko:

designing a vector construction primer (U: AGTGGTCTCTGTCCAGTCCTATGGCTTTTGGAGATCTCAG; D: GGTCTCAGCAGACCACAAGTTTAAGGTACCTGTCAAGCATG), activating plasmid bacterial liquid, extracting plasmids according to the description of a plasmid extraction kit, performing enzyme digestion on a plant subcellular localization vector pNC-Cam1304-SubC and a plant overexpression vector pNC-Cam2304-MCS35S (figure 3) by adopting SfiI restriction enzyme, and purifying enzyme digestion products for subsequent vector construction;

constructing a recombinant expression vector by using a Nimble cloning kit, converting the recombinant expression vector into escherichia coli competence, selecting a detection primer for single clone to perform PCR verification on bacterial liquid, activating the positive clone bacterial liquid, extracting recombinant plasmid, and transferring the recombinant plasmid into agrobacterium GV3101 by using an electrical transformation method;

(4) Subcellular localization of GbbZIP08 in tobacco:

activating GV3101 agrobacterium containing a recombinant vector twice, culturing until the OD600 value is 0.6-0.8, centrifuging at room temperature of 5000rpm, removing supernatant, resuspending the bacterium with MES buffer solution, adjusting the OD600 value to 0.6, absorbing the bacterium with a 1mL injector, injecting from the back of a tobacco leaf, marking, culturing the tobacco in the dark for 12h after injection, then culturing in an illumination incubator for 3-5 days, tearing the epidermis under the leaf of an injection region, observing fluorescence and taking a picture under a laser confocal microscope, and taking the tobacco leaf of an empty vector as a reference;

it was observed that in the tobacco leaves transferred to the empty vector, the nucleus was stained blue with DAPI dye, but no green fluorescence was observed, whereas in the tobacco epidermal cells transferred to the 35S:: gbbZIP08-GFP fusion expression vector, green fluorescence was observed (fig. 4), and the green fluorescence was overlapped with DAPI blue fluorescence, thereby concluding that GbbZIP08 localized to the nucleus;

(5) GbbZIP08 transformation arabidopsis thaliana:

selecting an arabidopsis plant in a full-bloom stage for infection, watering thoroughly the plant one day before transformation, and trimming the existing fruit pods; pouring GV3101 agrobacterium infection solution (OD 600 is 0.8) containing recombinant vector into a vessel with a large opening, completely soaking arabidopsis inflorescence in the infection solution for about 1min, covering a plastic bag for moisturizing, culturing in the dark for 12h, transferring into an illumination incubator, repeating infection once after a week, culturing infected plants in a plant illumination incubator until seeds are mature, and harvesting T0 generation seeds;

after disinfecting the T0 generation seeds, uniformly spreading the seeds in an MS solid plate containing corresponding antibiotics for culture, growing for about 10 days, and transplanting the seedlings with normal cotyledon and root growth into a plant illumination incubator for culture; after the seedlings are mature, crude DNA of tender leaves is taken, positive PCR verification is carried out by using a carrier detection primer, plants which are detected to be positive are continuously cultured until the seeds are mature, and T1 generation seeds are collected by dividing the plants;

sterilizing the T1 generation seeds, further screening by using a resistant MS solid culture medium, selecting a strain (shown in figure 5) with a positive proportion of 3;

continuously screening the T2 generation seeds in the same way, taking all surviving seedlings in the resistant plate as homozygotes, and continuously culturing to mature plants to obtain T3 generation transgenic arabidopsis homozygotes;

in FIG. 5: A-D represent wild type, T0 generation, T1 generation and T2 generation transgenic Arabidopsis thaliana, respectively;

(6) GbbZIP08 transformed tobacco:

cutting the sterile tobacco leaves into squares of 1cm multiplied by 1cm in a super clean bench, placing the squares in GV3101 agrobacterium infection solution (OD 600 value is 0.8) containing an over-expression vector for 10-15 min, and intermittently shaking the squares to enable the heavy suspension solution to completely soak the leaves; after infection, sucking the surface liquid of the leaves by using sterile filter paper, transferring the leaves with the back face facing downwards into a co-culture medium, and culturing for 48 hours in the dark at 28 ℃;

then transferring the explant into a differentiation culture medium to induce callus and bud (figure 6), forming a seedling body from the adventitious bud to be differentiated, cutting the seedling body and transferring the seedling body to a rooting culture medium to induce rooting, taking the tobacco out of a tissue culture bottle when the plant grows stably, cleaning the culture medium residual at the root part of the tobacco, transplanting the tobacco to nutrient substrate soil, and placing the tobacco in a plant illumination incubator for culture;

(7) And (3) verifying the transgenic plant:

taking 1-2 young leaves of a transgenic plant, putting the young leaves into a 1.5mL centrifuge tube, marking, grinding the leaves to be uniform pulp by using a plant tissue sample grinding machine, and extracting genome DNA of the plant by using a plant DNA crude extraction method;

carrying out positive PCR verification on a transgenic plant by using a detection primer used for vector construction, taking a wild plant DNA as a negative control, taking an escherichia coli bacterial solution containing a recombinant expression vector as a positive control, and detecting a PCR product through agarose gel electrophoresis to find that a target strip obtained by amplification of the transgenic plant is consistent with the PCR length of the bacterial solution, and a target strip is not amplified in the wild plant (figure 7), which indicates that the GbbZIP08 overexpression vector is successfully transferred into arabidopsis thaliana and tobacco;

in fig. 7: p is a PCR positive control of bacterial liquid; c is wild plant negative control; m is 2000bp marker;

putting wild plant leaves and transgenic plant leaves into a 1.5mL centrifuge tube, marking, adding a prepared GUS dye solution to immerse the leaves, wrapping the leaves with tinfoil paper in the dark, putting the leaves into a 37 ℃ constant temperature incubator for incubation overnight, after dyeing is finished, soaking the leaves into 75% alcohol for 16h for decolorization, then changing the alcohol into 95% alcohol for continuous decolorization, changing the alcohol once a day until the leaves are completely white and transparent, putting the decolorized leaves under a body type microscope for observation and recording, and finding that the transgenic plant leaves are dyed blue, but the wild plant leaves are not dyed (figure 8), which indicates that the GbbZIP08 expression vector is successfully expressed in the transgenic plants;

in fig. 8: a is wild type Arabidopsis thaliana; b is transgenic arabidopsis; c is wild tobacco; d is transgenic tobacco;

taking wild type and transgenic plant leaves, extracting plant RNA by referring to a plant RNA extraction kit, carrying out reverse transcription to obtain cDNA, carrying out fluorescent quantitative PCR detection on a target gene by using a target gene quantitative primer (U: GTCCAGTTCTGGTGACCCAC; D: GCCTGTTGGCTCTCCATCTT) and taking the cDNA as a template, and setting 3 biological repeats for each sample by taking the wild type plant as a control;

the Arabidopsis thaliana reference gene is AtUBQ (NM-178970), the tobacco reference gene is NbGADPH (Niben 101Scf05177g02025.1), and the quantitative result is 2 ^-△△CT Calculating by the method;

the expression level of GbbZIP08 in the transgenic plant is obviously higher than that of the wild type (figure 9), which shows that GbbZIP08 successfully and over-expresses in the transgenic plant;

(8) Analyzing the content of flavone in transgenic plants:

grinding wild type and transgenic plant leaves by liquid nitrogen, drying by a freeze dryer, sieving by a 40-mesh sieve, weighing 0.02g of a dried sample by a balance, putting the dried sample into a centrifuge tube, adding 2mL of 75% ethanol into the centrifuge tube, oscillating and extracting for 2h at 60 ℃, centrifuging for 10min at room temperature of 10000 Xg, taking supernatant, adding related reagents in the kit respectively for reaction, taking reaction liquid, measuring the light absorption value at 510nm by using an enzyme-labeling instrument, and calculating the content of flavonoid in the sample, wherein the result is shown in figure 10;

weighing 0.1g of freeze-dried sample, adding 2mL of 75% methanol, carrying out ultrasonic crushing for 30min, centrifuging at room temperature of 10000 Xg for 10min, taking 500 mu L of supernatant, adding 500 mu L of 36% hydrochloric acid, carrying out water bath at 85 ℃ for 1h, naturally cooling to room temperature, and filtering through a 45 mu m organic filter membrane to obtain the product for High Performance Liquid Chromatography (HPLC) detection;

HPLC conditions used for this experiment: column model Hypersil GOLD C18 (4.6 mm. Times.250mm, 5 μm), sample size 20 μ L, mobile phase A:100% acetonitrile, mobile phase B:2% acetic acid, column temperature: 30 ℃, flow rate 1.0mL/min, elution program: 85% B → 67.5% B at 0-14 min, 67.5% B → 10% B at 14-23 min, 10% B → 85% B at 23-24 min, 24-28min, 85% B;

the kaempferol content was measured at a wavelength of 320nm and the results are shown in FIG. 11;

in fig. 11: A-C are chromatograms of kaempferol standard sample, arabidopsis thaliana and tobacco extract at 320nm respectively;

grinding a plant sample by using liquid nitrogen, drying by using a freeze dryer, sieving by using a 40-mesh sieve, weighing 0.1g of freeze-dried sample powder by using a balance, adding 4mL of methanol (containing 1% hydrochloric acid in volume ratio), carrying out ultrasonic treatment at room temperature for 1h, wrapping the sample by using tinfoil paper in a dark place, placing the sample on a shaking table at 120rpm,4h and 5000rpm for centrifuging for 10min, taking 500 mu L of supernatant, adding 500 mu L of distilled water, uniformly mixing the supernatant through oscillation, then adding 500 mu L of chloroform, uniformly mixing the chloroform through oscillation to remove chlorophyll, absorbing the upper aqueous phase, and measuring the light absorption value at 530nm by using a microplate reader;

the anthocyanin content was calculated by the formula 10 × (A530)/g (DW), and the result is shown in FIG. 12;

the detection and analysis show that the content of total flavonoids, kaempferol and anthocyanin in transgenic arabidopsis and tobacco can be remarkably improved by over-expression of GbbZIP08, and the GbbZIP08 can promote the biosynthesis of plant flavonoids.

While the invention has been described with reference to specific preferred embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the following claims.

Claims (1)

1. An application method of a gingko bZIP transcription factor GbbZIP08 in promoting the synthesis of plant flavonoids is characterized by comprising the following steps:

step 1: the gene sequence of GbbZIP08 cloned from ginkgo through PCR amplification is shown in a sequence table SEQ ID NO.1, and the coded amino acid sequence obtained through translation is shown in a sequence table SEQ ID NO. 2;

step 2: performing first-generation sequencing on the gene sequence cloned in the step 1 to obtain a base sequence of the GbbZIP08 gene, and performing subsequent gene sequence analysis and expression vector construction primer design;

and step 3: the cloned GbbZIP08 is constructed on a pNC-Cam1304-SubC plant subcellular localization vector and a pNC-Cam2304-MCS35S plant overexpression vector by a Nimble cloning method;

and 4, step 4: transforming agrobacterium GV3101 by the pNC-Cam1304-SubC-GbbZIP08 expression vector constructed in the step 3, using the expression vector for tobacco transient transformation, observing the subcellular localization of GbbZIP08 in plants, and using an empty vector as a control;

and 5: transforming the pNC-Cam2304-MCS35S-GbbZIP08 expression vector in the step 3 into agrobacterium, transforming the agrobacterium into arabidopsis by adopting an arabidopsis inflorescence infection method, and transforming the agrobacterium into tobacco by adopting a tobacco leaf disc transformation method;

step 6: obtaining transgenic arabidopsis homozygous seeds by adopting resistance screening, and obtaining a transgenic tobacco regeneration system by a plant tissue culture method; verifying the transgenic plant by using positive PCR, GUS staining and qRT-PCR methods;

and 7: and (4) carrying out flavonoid content detection on the transgenic plant and the wild plant obtained in the step (6), and analyzing the influence of overexpression of GbbZIP08 on flavonoid synthesis in the plant.

Images