CN111575292B - DNA molecule, application thereof and method for obtaining high-root-quantity ramie plant - Google Patents

Abstract

The invention relates to the technical field of transgenosis, in particular to a DNA molecule, application thereof and a method for obtaining a high-root-quantity ramie plant. The DNA molecule is characterized in that a 2000-2500 bp sequence at the upstream of a 5' untranslated region translation initiation site of a ramie BnWOX8 gene is replaced by a DNA sequence shown in SEQ ID NO: 1. The invention transfers the modified DNA molecule into ramie plants, and the obtained ramie strains show higher root system production and have no obvious influence on the content of total flavonoids in the root system.

Description

DNA molecule, application thereof and method for obtaining high-root-quantity ramie plant

Technical Field

The invention relates to the technical field of transgenosis, in particular to a DNA molecule, application thereof and a method for obtaining a high-root-quantity ramie plant.

Background

Ramie is a traditional economic crop in China, has a habit of being used as a medicinal material for a long time, and especially plays an important role in national medicine. The ramie portion generally used in traditional Chinese medicine is root system. Zang Gu et al (2002) mention in the book "Ramie medical insurance value and its development prospect shallow analysis", Ramie is mainly used in gynecology, urology, respiratory system, digestive system and other diseases such as diabetes, and its pharmacology is that the ramie root contains flavonoid glycoside, ursolic acid, superoxide dismutase (SOD) etc., wherein each 100g of ramie root dry powder contains flavonoid 0.36g and phenolic substance 0.37 g. Chenbaofeng et al (2016) in Ramie research progress statistics found that there are 11 kinds of flavonoids in Ramie root system. Zhang Shi Yong et al (2015) recorded in the clinical application research of ramie root in 6 nations of Guizhou, the ramie root has wide application in nations such as Tujia, Yi, Buyi, Mulao, Dai and Dong, and has the efficacies of clearing away heat and toxic materials, stopping bleeding, inducing diuresis, reducing edema, preventing miscarriage, setting broken bones and the like.

Animal experiments prove that the ascorbic effect of the flavonoid compound (vitamin P) is 10 times better than that of the vitamin C. Natural flavonoids mostly exist in the form of glycosides, and various flavonoid glycosides can be formed due to different types, amounts, connection positions and connection modes of saccharides. Research shows that the flavone has various effects, is a strong antioxidant, can effectively remove oxygen free radicals in vivo, such as anthocyanin can inhibit the full-stage overflow of lipid peroxides, the oxidation prevention capability is more than ten times of that of vitamin E, and the antioxidation can prevent the degeneration and the aging of cells and the occurrence of cancers. The flavone can improve blood circulation and reduce cholesterol, and the flavone in the fructus fici also contains a PAF anticoagulation factor, which greatly reduces the incidence of cardiovascular and cerebrovascular diseases and can also improve the symptoms of the cardiovascular and cerebrovascular diseases. Meanwhile, vitamin P is actually a mixture consisting of flavonoids rather than a single substance. Different raw materials have different medicinal effects due to different flavonoids, for example, propolis contains two unique components: 5, 7-dihydroxy-3 ', 4 ' -dimethylflavone and 5-hydroxy-4 ', 7-dimethoxybiflavone, and has antibacterial, antiviral, and anti-protozoan effects. Ginkgo biloba leaf flavonoids have various effects of anti-inflammation, anti-cyclic adenosine monophosphate esterase activity, anti-histamine activity and the like.

Therefore, the improvement of the content of the phenolic substances in the ramie root system has important significance for improving the unique medicinal value of the ramie root system. The current ramie root system acquisition comes from two ways of wild ramie excavation and conventional ramie planting. Both of these methods have a significant problem, resulting in difficulty in meeting the demands for intensive processing. On the one hand, the content variation of active ingredients is large, the growth is slow, and the collection period is overlong. The wild ramie grows dispersedly, and the collection cost is very high. The root system is excavated after the ramie is cultivated for more than 10 years. On the other hand, the ramie root system excavated from the soil carries a large amount of soil, the root system is also seriously lignified, a large amount of labor and materials are needed for procedures such as cleaning, drying, crushing, extracting and the like, and the young root system with high phenol content is difficult to collect, so that the production cost is further increased. Therefore, a simple and efficient production method of the ramie root system with high flavone content is urgently needed in the production.

At present, the report shows that the flooding treatment can improve the flavone content of ginkgo leaves, but the drought can also cause similar changes, and even the research shows that the soil water content and the content of ginkgo leaf flavonoids have no obvious correlation. The content of total flavonoids in tobacco does not change obviously under the stress of waterlogging, but the content of total phenols and total alkaloids rises. The watery watercress has higher soluble protein content under the water-logging treatment but has higher flavonoid content under the drought treatment. A large number of researches show that the drought treatment can improve the content of flavonoids in the overground parts of plants. A large number of researches show that alternate wetting and drying, flooding and drought treatments have obvious influence on the metabolism of plants, but different crops, different researches and different areas have great difference, and the research conclusion is inconsistent. A ramie water culture seedling method is disclosed in a patent of an industrial seedling raising method for ramie (CN105052528B), and a ramie repairing method in a cadmium-polluted paddy field (CN109433819A) is disclosed in a patent of a method for harvesting ramie root systems in a paddy field. On the basis of the prior art, a production method for improving the content of the flavone in the ramie root system through other ways needs to be developed.

Disclosure of Invention

In view of the above, the present invention provides a DNA molecule, its application and a method for obtaining a high-root ramie plant. The ramie strain obtained by the method has high root system production and has no obvious influence on flavone content.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a DNA molecule, wherein the base sequence of the DNA molecule is shown as SEQ ID NO: 3, replacing a 2000-2500 bp sequence at the upstream of a 5' untranslated region translation initiation site of the ramie BnWOX8 gene with a sequence shown in SEQ ID NO: 1.

Plants of different species show a great difference in their regenerative capacity. For example, although plants such as tobacco and tomato show a very strong ability to regenerate organs from the head, mature tissues of plants such as rice, wheat and corn are difficult to culture. The research suggests that WUSCHEL-related homeobox (WOX) transcription factor plays an important role in regulating the process of plant root regeneration from the beginning. Studies in the model plant arabidopsis thaliana suggest that the response of the WOX gene and its encoded product to plant hormone signals is critical in regulating plant root regeneration. But the response capability of different species or different gene members of WOX family of the same species to the endogenous auxin is obviously different, and the WOX gene has a complex regulation network and has environmental specificity. Meanwhile, many WOX genes have been found in the plant kingdom, and there are more than 10 members whose functions are verified only in arabidopsis thaliana. The Arabidopsis WOX 11-WOX 14 are related to root development, and the functions of homologous genes of the genes in crops such as rice are different. The ramie root system growth is promoted, and a WOX gene member which can be purposely expressed in the root system of the ramie is required to be found and then regulated. How to find the gene capable of obviously regulating and controlling the growth of the ramie root system under the water culture condition in a plurality of WOX gene families has great difficulty.

Promoters (Promoters) are an integral part of genes, like gene "switches", that determine the activity of genes, control the initiation time of gene expression (transcription) and the extent of expression. However, the promoter itself does not control gene activity, but controls gene activity by binding to a transcription factor (transcription factor). Earlier researches found that a member of ramie WOX gene family (named as BnWOX8) is specifically expressed in ramie root tissues, and sequence polymorphism exists in promoter regions of ramie germplasm with different root regeneration capabilities. Therefore, the WOX8 gene function can be regulated and controlled by editing the sequence of the promoter region.

Further, the sequence of SEQ ID NO.1 is synthesized, and the 5' untranslated region and the 2000-2500 bp sequence at the upstream of the translation initiation site of the BnWOX8 gene are replaced by the sequence of SEQ ID NO. 1. The edited BnWOX8 gene is transferred into a ramie plant to obtain a ramie mutant line with the BnWOX8 gene over-expression. This strain showed a higher root production and had no significant effect on flavone content.

In the invention, the coding sequence of ramie BnWOX8 gene is shown as SEQ ID NO: 2, respectively.

The invention also provides application of the DNA molecule in preparation of a high-root-content ramie plant.

The invention also provides a recombinant expression vector which comprises the DNA molecule.

The invention also provides a recombinant agrobacterium strain which comprises the recombinant expression vector.

The invention also provides a method for obtaining the ramie plant with high root number, which comprises the following steps:

replacing 2000-2500 bp sequences at the upstream of the 5' untranslated region translation initiation site of the ramie BnWOX8 gene with SEQ ID NO: 1 to obtain a modified DNA molecule;

connecting the modified DNA molecules with an expression vector to obtain a recombinant expression vector;

transforming the recombinant expression vector into agrobacterium to obtain a recombinant agrobacterium strain;

preparing ramie callus, transforming the recombinant agrobacterium strain into the ramie callus, and performing differentiation culture and rooting culture to obtain a high-root ramie plant.

Preferably, the callus differentiation culture medium for preparing ramie callus is as follows: MS + 0.1-1.0 mg/L TDZ + 0.01-0.1 mg/L2, 4-D + 0.005-0.015 mg/L IAA.

Preferably, the callus differentiation medium used for differentiation culture is: MS + 0.1-1.0 mg/L TDZ + 0.01-0.1 mg/L2, 4-D + 0.005-0.015 mg/L IAA + 100-1000 mg/L carbenicillin + 10-100 mg/L kanamycin.

Preferably, the rooting culture medium used for rooting culture is as follows: MS + 0.005-0.015 mg/L NAA.

The invention also provides a method for obtaining the ramie plant with high root number, which comprises the following steps:

replacing 2000-2500 bp sequences at the upstream of the 5' untranslated region translation initiation site of the ramie BnWOX8 gene with SEQ ID NO: 1 to obtain a modified DNA molecule;

connecting the modified DNA molecules with an expression vector to obtain a recombinant expression vector;

preparing ramie protoplast cells, transferring the recombinant expression vector into the protoplast cells by a PEG (polyethylene glycol) mediated transformation method, and culturing to obtain callus;

and performing differentiation culture on the callus, and screening to obtain a high-root ramie plant.

The invention provides a DNA molecule, application thereof and a method for obtaining a ramie plant with high root quantity. The DNA molecule is characterized in that a 2000-2500 bp sequence at the upstream of a 5' untranslated region translation initiation site of a ramie BnWOX8 gene is replaced by a DNA sequence shown in SEQ ID NO: 1. The invention has the technical effects that:

the root system yield under the water culture condition is obviously improved on the basis of any ramie variety without influencing the content of substances such as flavone and the like. In the existing production, a transgenic ramie variety aiming at root growth or flavone content improvement is not available, so that a lot of time, labor and material cost are needed when a variety which is suitable for ramie root growth and has high flavone content is screened under a water culture condition, and a method for further improving the root yield is lacked. For example, to find a variety with a significant effect of total phenol or total flavone components on inflammation, a large number of varieties need to be screened for content first, and then screened for hydroponics adaptability, if the content is not matched with the hydroponics adaptability, screening failure is caused, and the cost is increased if the screening range is expanded. Therefore, if the variety with high brass content is transformed in water culture adaptability or the variety with water culture adaptability and flavone content matched is optimized in productivity, the remarkable effects of cost saving and efficiency improvement can be achieved. According to the invention, on the basis of researching the function of the BnWOX8 gene, the BnWOX8 gene overexpression ramie plant is obtained, the ramie mutant strain is suitable for water culture, the root system grows and develops quickly, a developed blanket root layer can be formed quickly, the ramie can adapt to the water culture environment more effectively, the yield of the root system is improved, and the content of target substances such as flavone is not obviously influenced.

Drawings

FIG. 1 shows the hydroponic culture of ramie;

FIG. 2 shows a hydroponic ramie blanket root system;

FIG. 3 shows PCR and GUS staining identification of BnWOX8 gene overexpression ramie strain;

FIG. 4 shows the fluorescent PCR verification of BnWOX8 gene overexpression ramie strain.

Detailed Description

The invention discloses a DNA molecule, application thereof and a method for obtaining a high-root-quantity ramie plant, and a person skilled in the art can realize the DNA molecule by properly improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The reagent or the instrument used in the method for obtaining the ramie plant with high root number provided by the invention can be purchased from the market. The ramie is of medium ramie 2 variety.

The invention is further illustrated by the following examples:

example 1

(1) Obtaining of recombinant agrobacterium strain containing pBI21-BnWOX8 overexpression vector

The method comprises the following specific steps:

1) synthesis of the sequence of SEQ ID NO. 1:

synthesized by a solid phase phosphoramidite triester method. The sequence of SEQ ID NO.1 is as follows:

ATTTTATGAATGATCTGTTGATATGTTTTAGACATGTTGATAAGTGGTGCGTTTTTTTCGTTCGATGTGCGTTGTCTTTTTGAGAAACTGCCAAGTTGGGAATTTGATGGCGTAGATATCTGAGACTTTTGTTGCCTGATGTGCTCGTTTCCATGCTTTTGTTGTTTGGGTAATACTTTTGGCATGTTGATATTTGATTGGCTATTGATTTACTAAACAATGTTTTTATTGGGTTTTATTTTGAAAAATTATCCCCAAAGTTTCAAGTTAATGTCAAATGAACATTTTTTATTGACTTTTCTAGACGAGGTGAGGGGTCAGTATAACTTGCGAGTTAGATACAAGATACAAGGGTTTTCTTGATATTGTTTATCCTTTTGGGGCCTAATTTTACGGTTTAGGCCGTATATAATATTTCAAAATTGTCCTTAAAAGCTAAAATAAATTAAATTTTCAATGTTTCTGTGTCTTTATTTTCATTGGTCATTGTTAAGCGAAGATGATTTGGAGATCAGCCGCGAACGTATCGTATCGGTTCGGTTACTAAAAACACCCCTCTTCGTCGGCTTATGGTCTTTGTGTCTCAATTGTCTCTGTCTCAATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCAGTCACTTGTCTCATGTCTCATATTGTTGTTGATGGGTTAGTTCCTTTAGGTTTTGTTCCATTCTGGGTCTCTGTGTGTCTCAGTGCTTTAACTGCGAGTTCTGCCTCATTATAAGCTGAGGGAATGAGATGAGAGATTGATGTACGGGGGGAGAGGAGAATTTTGTTTCGCTTTTTGGTTTATTAAATGTTGATGCCAAAAATACTTTATTATTTTTTGAATAAAGGTAAATTGTCGATTTAAAAAAAAAGTCGACAAAAGTTGGATATAGGATATAGGAAGGGGCATTGTTCTATGATATATAATTTCTTATGATTTACCAATAGGAAGTTTTATTACGATTTTTTAGAAACTTAATATGTTTTAAGGGATAATTTTATATAATTTTCTCTTGGGTTATATGTTGGTTCAACAATAGCTGTGATATGTCATTGCTTGGCTGGGTTATTATGTATTTTGTTGAGTTCTACTTTTATTTCACATGCTGTCTCATTTTAAGTTTCATTTGATACAGAAGTTCGGCTATGAAATAATTCAATTTAATGTACCATTCTTTTAGTTGGCAAATAATCCGCTCGAATGTTAAAGCGTATAAATTAATATTATCATTGGTACGGTATACAGTATAATGTCCGTTGAAGTTCGCATGTTATGTATAAAGGGAACGACATTATGGCTAATTGACTGTCTCATGAATTCCATTTTTCCCTATTGCATTTGCTGGTGGGTTTTGATCTTATTATAAAGCCCTAGCCTAACTCAATCGATTGCCAATTTGATTAATTAGCAAGACAAGTGCGAAAGGATAACCGAAAGCTGATGTGATTTATTGGAAATAAGGATAAGCATGCTTTTATGTGAATCGAAATCCGAGCTTATAGTAAAATGTACGGACGGTTTTGAAACAATTACATAATTATGGAGGGTTTTGAAAGAGCTTCCACTTATAGTGGTTTTGTCAACTTGTTGCAAAATGATGGGTTGTGTGGGACAGTCTTCTTAATCTAATTATGTTAGGTGGTTAAGCAAATTAGTGAAACTTGCCGTAAGTTGCACTACATGTACAGACAAGTCTGGGTCTTTCAGCCAAAATGTCTCAAAAACTAAAGCTACCCAACCCAACATGCTTTGTGTCCGCCAAAACCAGCAAGAGCCCCTTTATTTTTATGCTTGTTTTACTTTCTAGGCTTTTGTTTTGTTTGTTTTTTTGTTTTAACCTTGTGTAATTTATTATTTGGCGTAAAAACTCGAAAACATGTCACATGAGGATTCTACATTATGTCTCAATTTGAGAGGGAAGAAGGAATTAATACGCGACACCATAGTTTAGCAGTAACGTAGTGAAAGTGGTAATTATTAATAACAATAATAATTAGCTGTAACGTAGTGAAAATGGTAATTTTTTGCGCAATTAGCGACGCTGAATGCTACAACACCGCGCTGACCTTCTGAGCCAGCCTCTATATTTGGAACTCTTATTTTATTTTTGGGTCATAACTTGTTATTTCCTCAAACCCAAAAAGAAAAAGAAAAATTCATTCGCTCGCTCTCTCACTCCACGCAGGTTGGACCACTAATCTTTTGCTCGAGGAACTCCAGAGTCCACAGTATCTGTGTCAGAGGTATTCGCTTTATTCTATATATATATATATATATATATATATATGTTAATGGGTTTGGTCGTTGGTTGACAAAATTCAAGGGTTTTGTTTATGAAATTTGAAGGAAGAGACGAGAGCGTAGAAGAAGAAG

2) a BnWOX8 gene promoter region modification:

replacing a 2000-2500 bp sequence at the upstream of a translation initiation site of a 5' untranslated region of the BnWOX8 gene by a sequence of SEQ ID NO.1 by a homologous recombination method.

The coding sequence of the BnWOX8 gene is shown as SEQ ID NO. 2:

ATGTTGTTGGAAGCGGAAAAAGAGGTAGAGAATTTGAGTCCAAATGCAAATACAAACCAAAAAGAAGAAGAAGGGTTTGGAGGTTTGTTTGTGAAAGTGATGACTGACGAACAATTGGAGCTTCTGAGATATCAGATCTCTGTCTACGCCACCATCTCTGAGCAACTTGCTGACTTACACAAGTCCTTCACTTCCCAACAACATCTTTCTGGAATGAAGTTGGGGAATCTTAACTATGATCCACTAATGGCATATGGCGGCCACAAGATCACTTCAAGGCAGAGGTGGTCTCCATCGCCTGCGCAGCTTCAAGTGCTTGAGCGAATTTTTGACGAAGGTAATGGGACTCCGAGCAAGCAGAAGATCAAGGAGATAACCACCGAACTCTCTCAACACGGCCAAATTTCTGAAACCAATGTGTACAACTGGTTCCAGAACAGGAGGGCTCGTTCAAAACGGAAGCAGTCAGTCGCAACACCAAACAATGCGGAACCGGAAGCAGAGTCTGAAACTCATGATTTCCTTAAGGAAAATGCGAAACCAGAAGACGCCGAATTCTATGACAACTCCGCAAAACCAAGCAATGATCATGTGTACTTTCCGAGCCCTGAGGAGTTGATAAGTTGGTCGGAAAATGAAAGCGTGATCGAGCTACAACACGCCTTGCCAGCCTGGACAGGATTTGGCGTTGAAGAGCTGTAG

the modified BnWOX8 gene and the sequence of the non-coding region at the 5' end are shown in SEQ ID NO. 3: ATTTTATGAATGATCTGTTGATATGTTTTAGACATGTTGATAAGTGGTGCGTTTTTTTCGTTCGATGTGCGTTGTCTTTTTGAGAAACTGCCAAGTTGGGAATTTGATGGCGTAGATATCTGAGACTTTTGTTGCCTGATGTGCTCGTTTCCATGCTTTTGTTGTTTGGGTAATACTTTTGGCATGTTGATATTTGATTGGCTATTGATTTACTAAACAATGTTTTTATTGGGTTTTATTTTGAAAAATTATCCCCAAAGTTTCAAGTTAATGTCAAATGAACATTTTTTATTGACTTTTCTAGACGAGGTGAGGGGTCAGTATAACTTGCGAGTTAGATACAAGATACAAGGGTTTTCTTGATATTGTTTATCCTTTTGGGGCCTAATTTTACGGTTTAGGCCGTATATAATATTTCAAAATTGTCCTTAAAAGCTAAAATAAATTAAATTTTCAATGTTTCTGTGTCTTTATTTTCATTGGTCATTGTTAAGCGAAGATGATTTGGAGATCAGCCGCGAACGTATCGTATCGGTTCGGTTACTAAAAACACCCCTCTTCGTCGGCTTATGGTCTTTGTGTCTCAATTGTCTCTGTCTCAATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCAGTCACTTGTCTCATGTCTCATATTGTTGTTGATGGGTTAGTTCCTTTAGGTTTTGTTCCATTCTGGGTCTCTGTGTGTCTCAGTGCTTTAACTGCGAGTTCTGCCTCATTATAAGCTGAGGGAATGAGATGAGAGATTGATGTACGGGGGGAGAGGAGAATTTTGTTTCGCTTTTTGGTTTATTAAATGTTGATGCCAAAAATACTTTATTATTTTTTGAATAAAGGTAAATTGTCGATTTAAAAAAAAAGTCGACAAAAGTTGGATATAGGATATAGGAAGGGGCATTGTTCTATGATATATAATTTCTTATGATTTACCAATAGGAAGTTTTATTACGATTTTTTAGAAACTTAATATGTTTTAAGGGATAATTTTATATAATTTTCTCTTGGGTTATATGTTGGTTCAACAATAGCTGTGATATGTCATTGCTTGGCTGGGTTATTATGTATTTTGTTGAGTTCTACTTTTATTTCACATGCTGTCTCATTTTAAGTTTCATTTGATACAGAAGTTCGGCTATGAAATAATTCAATTTAATGTACCATTCTTTTAGTTGGCAAATAATCCGCTCGAATGTTAAAGCGTATAAATTAATATTATCATTGGTACGGTATACAGTATAATGTCCGTTGAAGTTCGCATGTTATGTATAAAGGGAACGACATTATGGCTAATTGACTGTCTCATGAATTCCATTTTTCCCTATTGCATTTGCTGGTGGGTTTTGATCTTATTATAAAGCCCTAGCCTAACTCAATCGATTGCCAATTTGATTAATTAGCAAGACAAGTGCGAAAGGATAACCGAAAGCTGATGTGATTTATTGGAAATAAGGATAAGCATGCTTTTATGTGAATCGAAATCCGAGCTTATAGTAAAATGTACGGACGGTTTTGAAACAATTACATAATTATGGAGGGTTTTGAAAGAGCTTCCACTTATAGTGGTTTTGTCAACTTGTTGCAAAATGATGGGTTGTGTGGGACAGTCTTCTTAATCTAATTATGTTAGGTGGTTAAGCAAATTAGTGAAACTTGCCGTAAGTTGCACTACATGTACAGACAAGTCTGGGTCTTTCAGCCAAAATGTCTCAAAAACTAAAGCTACCCAACCCAACATGCTTTGTGTCCGCCAAAACCAGCAAGAGCCCCTTTATTTTTATGCTTGTTTTACTTTCTAGGCTTTTGTTTTGTTTGTTTTTTTGTTTTAACCTTGTGTAATTTATTATTTGGCGTAAAAACTCGAAAACATGTCACATGAGGATTCTACATTATGTCTCAATTTGAGAGGGAAGAAGGAATTAATACGCGACACCATAGTTTAGCAGTAACGTAGTGAAAGTGGTAATTATTAATAACAATAATAATTAGCTGTAACGTAGTGAAAATGGTAATTTTTTGCGCAATTAGCGACGCTGAATGCTACAACACCGCGCTGACCTTCTGAGCCAGCCTCTATATTTGGAACTCTTATTTTATTTTTGGGTCATAACTTGTTATTTCCTCAAACCCAAAAAGAAAAAGAAAAATTCATTCGCTCGCTCTCTCACTCCACGCAGGTTGGACCACTAATCTTTTGCTCGAGGAACTCCAGAGTCCACAGTATCTGTGTCAGAGGTATTCGCTTTATTCTATATATATATATATATATATATATATATGTTAATGGGTTTGGTCGTTGGTTGACAAAATTCAAGGGTTTTGTTTATGAAATTTGAAGGAAGAGACGAGAGCGTAGAAGAAGAAGATGTTGTTGGAAGCGGAAAAAGAGGTAGAGAATTTGAGTCCAAATGCAAATACAAACCAAAAAGAAGAAGAAGGGTTTGGAGGTTTGTTTGTGAAAGTGATGACTGACGAACAATTGGAGCTTCTGAGATATCAGATCTCTGTCTACGCCACCATCTCTGAGCAACTTGCTGACTTACACAAGTCCTTCACTTCCCAACAACATCTTTCTGGAATGAAGTTGGGGAATCTTAACTATGATCCACTAATGGCATATGGCGGCCACAAGATCACTTCAAGGCAGAGGTGGTCTCCATCGCCTGCGCAGCTTCAAGTGCTTGAGCGAATTTTTGACGAAGGTAATGGGACTCCGAGCAAGCAGAAGATCAAGGAGATAACCACCGAACTCTCTCAACACGGCCAAATTTCTGAAACCAATGTGTACAACTGGTTCCAGAACAGGAGGGCTCGTTCAAAACGGAAGCAGTCAGTCGCAACACCAAACAATGCGGAACCGGAAGCAGAGTCTGAAACTCATGATTTCCTTAAGGAAAATGCGAAACCAGAAGACGCCGAATTCTATGACAACTCCGCAAAACCAAGCAATGATCATGTGTACTTTCCGAGCCCTGAGGAGTTGATAAGTTGGTCGGAAAATGAAAGCGTGATCGAGCTACAACACGCCTTGCCAGCCTGGACAGGATTTGGCGTTGAAGAGCTGTAG

3) Obtaining of recombinant Agrobacterium strains

Carrying out double enzyme digestion on the modified BnWOX8 gene coding sequence (shown in SEQ ID NO. 3) and the overexpression vector pBI121 respectively, and connecting the double enzyme digestion product with T4 DNA ligase after purifying and recovering to obtain a recombinant vector; the recombinant vector is transformed into an escherichia coli competent cell (E.coli DH5 alpha) and then is transferred into an agrobacterium LBA4404 strain to obtain a recombinant agrobacterium strain.

(2) The method for obtaining the BnWOX8 gene overexpression ramie strain comprises the following steps:

1) overexpression vector-mediated overexpression of the BnWOX8 gene:

cutting the leaves of aseptic ramie seedling into about 1-2cm under aseptic condition²The small pieces of (4) were placed in a callus differentiation medium (MS +0.5mg/L TDZ +0.03 mg/L2, 4-D +0.01mg/L IAA) and cultured in the dark at 24 ℃ for 2 days; placing leaf callus and Agrobacterium liquid (containing pBI21-BnWOX8 overexpression vector recombinant Agrobacterium strain) with OD600 value of 0.6 in a constant temperature shaker, shaking and culturing for 8 minutes, taking out leaf callus, placing on sterile filter paper, filtering, and placing in callus culture medium under dark condition for 2 days; then, the co-cultured callus is subjected to degerming treatment, and is placed in a callus differentiation culture medium (MS +0.5mg/L TDZ +0.03 mg/L2, 4-D +0.01mg/L IAA +500mg/L carbenicillin +50mg/L kanamycin) again, and is cultured for about 7 weeks under illumination at 25 ℃, after the callus grows out, the callus is transferred to a rooting culture medium (MS +0.01mg/L NAA) to promote the seedling to take root, and after 3-leaf regeneration seedlings are generated, a ramie mutant strain with BnWOX8 gene overexpression is identified through GUS staining, Sourthenblot, fluorescent quantitative PCR and the like (figure 1-3).

2) Auxin response element modification mediated overexpression of the BnWOX8 gene: (modification of CRISPR technology is also possible, and the following methods provide only homologous recombination methods)

Ramie protoplast cells were prepared and diluted to 1.0X 10⁵cells/mL, adding 100. mu.L of protoplast suspension and 20. mu.L (1. mu.g/. mu.L) of plasmid DNA into a 2mL centrifuge tube, and uniformly mixing; adding 40% of PEG with the same volume4000 solution (containing 200mmol/L mannitol and 100mmol/L CaCl₂pH8.0), mixing, and standing in dark at 25 deg.C for 20 min; adding 440 μ L W5 solution, terminating the conversion, and centrifuging at 4 deg.C and 700r/min for 5 min; removing the supernatant, adding 1mL of W5 solution, suspending and precipitating, and performing dark culture at 25 ℃ for 16 h; centrifuging again for 5min under the same conditions, removing most of supernatant, and resuspending the precipitate with the rest supernatant; the transformed protoplasts were adjusted to 5X 10⁵each/mL of the cells was inoculated into a WPM medium and cultured by the liquid shallow layer method (mannitol was used as an osmotic pressure regulator in the culture medium, the initial concentration of mannitol was 0.6mol/L, and pH was 5.8). 2mL of the protoplast suspension were added to a 6cm diameter petri dish, the mouth of the dish was sealed with Parafilm and placed in a shaker at 100r/min for dark cultivation at 25 ℃. Adding fresh culture medium 1 time per week, reducing mannitol concentration from 0.6mol/L to 0.4mol/L, further reducing to 0.2mol/L, forming callus of about 2mm, and transferring to MS +0.1 mol/L2, 4-D +0.01mg/L NAA. Screening to obtain the BnWOX8 gene overexpression ramie strain. The results of the fluorescent PCR verification are shown in FIG. 4.

Test example 1

In the above example 1, the ramie plant obtained by the genetic transformation method using callus as explant and the ramie variety before modification were subjected to soil culture and seedling culture, and the ramie variety before modification was Zhongzhui No. 2. Meanwhile, unmodified medium ramie No.2 is selected for soil culture and seedling. Root biomass was measured after 45 days of cultivation.

The soil culture method comprises the following specific steps:

the ramie plant obtained by the method is topped, the apical dominance is removed, and the growth of lateral branches is promoted. Uniformly collecting and trimming the lateral branches when the lateral branches reach 12cm, and performing cutting seedling in soil by using a conventional shoot cutting method. The ramie core is inserted into a national germplasm Changsha ramie garden in the urban region of Changsha city for development. And the cultivation is carried out in 2019, 4 and 20 days, the soil temperature is stabilized to 15 ℃, the soil texture is sandy loam, the compartment is levelly manufactured, the width of the compartment is 1.2-1.4m, the length is not limited, shallow seedling transplanting grooves are transversely arranged on the compartment surface, and the distance between the grooves is about 15 cm. Before cutting, the seedbed is watered with pollution-free clear water and a small amount of carbendazim (the concentration is not more than 1000 times). And immersing the cut cuttings in 1000 times of carbendazim disinfectant for 2min, and then cutting. The depth of the skewer is 1-3 cm. After the seedlings are transplanted, clear water containing bactericide is timely poured on the seedlings until the seedlings are thoroughly wetted. Bamboo bows with the interval of about 1m are inserted on the seedbed, the film is covered, and the periphery of the film is compacted by soil to prevent water from losing. The covering height is based on the condition that the film does not contact the hemp seedlings.

In order to avoid direct exposure of the seedbed to strong light, a straw curtain or a shading net is covered on the film at 7:30 in the morning of a sunny day, and the shading objects are removed after 5:30 in the afternoon. Shade is not needed in rainy days. The temperature in the seedbed covered by the film is controlled within the range of 18-34 ℃, water can be directly sprayed on a shade or films at two ends are uncovered for cooling when the temperature is too high, and the optimal temperature is 25-30 ℃. Keeping the seedbed moist, and watering immediately if dense water drops exist on the film and the seedbed begins to turn white. After 3-5cm of white roots grow on the hemp seedlings, the thin films at the two ends are firstly uncovered to harden the seedlings, and the covering is gradually reduced. After 2-3 days the cover can be removed completely, but should remain wet. After further cultivation for about 15d (45 d total), the seedlings were pulled out. And simultaneously measuring the root quantity of the middle ramie No.2 seedlings planted at the same period, and comparing.

The results are shown in Table 1:

TABLE 1 Ramie root biomass determination (dry weight)

Note: represents that the dry weight of the root systems of different ramie varieties has obvious difference under the same culture condition (a is 0.05).

The result shows that the root system of the obtained Boehmeria nivea plant with the BnWOX8 gene over-expression has rapid growth and development, can quickly form a developed carpet-shaped root layer, improves the yield of the root system, and has no obvious influence on the content of target substances such as flavone and the like.

Test example 2

In example 2, the water culture seedling of the ramie plant obtained by the genetic transformation method using the callus as the explant and the ramie variety before modification are performed, and the ramie variety before modification is medium ramie No. 2. And simultaneously selecting unmodified Zhongzhui No.2 for water culture seedling raising. Root biomass was measured after 45 days of cultivation.

The water culture method comprises the following specific steps:

the ramie plant obtained by the method and the common medium ramie No.2 ramie plant are topped, the apical dominance is removed, and the growth of lateral branches is promoted. When the lateral branches reach 12cm, uniformly collecting, trimming, and culturing by using a ramie water culture seedling method disclosed in a patent ramie factory seedling method (CN 105052528B). Root biomass was measured after 45 days of cultivation.

TABLE 2 Ramie root biomass determination (dry weight)

Note: represents that the dry weight of the root systems of different ramie varieties has obvious difference under the same culture condition (a is 0.05).

The result shows that the obtained BnWOX8 gene overexpression ramie plant is suitable for water culture, the root system grows and develops quickly, a developed carpet-shaped root layer can be formed quickly, the ramie can adapt to the water culture environment more effectively, the yield of the root system is improved, and the content of target objects such as flavone is not obviously influenced.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of hemp, national academy of agricultural sciences

<120> DNA molecule, application thereof and method for obtaining high-root-quantity ramie plant

<130> MP1934389

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2396

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attttatgaa tgatctgttg atatgtttta gacatgttga taagtggtgc gtttttttcg 60

ttcgatgtgc gttgtctttt tgagaaactg ccaagttggg aatttgatgg cgtagatatc 120

tgagactttt gttgcctgat gtgctcgttt ccatgctttt gttgtttggg taatactttt 180

ggcatgttga tatttgattg gctattgatt tactaaacaa tgtttttatt gggttttatt 240

ttgaaaaatt atccccaaag tttcaagtta atgtcaaatg aacatttttt attgactttt 300

ctagacgagg tgaggggtca gtataacttg cgagttagat acaagataca agggttttct 360

tgatattgtt tatccttttg gggcctaatt ttacggttta ggccgtatat aatatttcaa 420

aattgtcctt aaaagctaaa ataaattaaa ttttcaatgt ttctgtgtct ttattttcat 480

tggtcattgt taagcgaaga tgatttggag atcagccgcg aacgtatcgt atcggttcgg 540

ttactaaaaa cacccctctt cgtcggctta tggtctttgt gtctcaattg tctctgtctc 600

aatgtctcat gtctcatgtc tcatgtctca tgtctcatgt ctcagtcact tgtctcatgt 660

ctcatattgt tgttgatggg ttagttcctt taggttttgt tccattctgg gtctctgtgt 720

gtctcagtgc tttaactgcg agttctgcct cattataagc tgagggaatg agatgagaga 780

ttgatgtacg gggggagagg agaattttgt ttcgcttttt ggtttattaa atgttgatgc 840

caaaaatact ttattatttt ttgaataaag gtaaattgtc gatttaaaaa aaaagtcgac 900

aaaagttgga tataggatat aggaaggggc attgttctat gatatataat ttcttatgat 960

ttaccaatag gaagttttat tacgattttt tagaaactta atatgtttta agggataatt 1020

ttatataatt ttctcttggg ttatatgttg gttcaacaat agctgtgata tgtcattgct 1080

tggctgggtt attatgtatt ttgttgagtt ctacttttat ttcacatgct gtctcatttt 1140

aagtttcatt tgatacagaa gttcggctat gaaataattc aatttaatgt accattcttt 1200

tagttggcaa ataatccgct cgaatgttaa agcgtataaa ttaatattat cattggtacg 1260

gtatacagta taatgtccgt tgaagttcgc atgttatgta taaagggaac gacattatgg 1320

ctaattgact gtctcatgaa ttccattttt ccctattgca tttgctggtg ggttttgatc 1380

ttattataaa gccctagcct aactcaatcg attgccaatt tgattaatta gcaagacaag 1440

tgcgaaagga taaccgaaag ctgatgtgat ttattggaaa taaggataag catgctttta 1500

tgtgaatcga aatccgagct tatagtaaaa tgtacggacg gttttgaaac aattacataa 1560

ttatggaggg ttttgaaaga gcttccactt atagtggttt tgtcaacttg ttgcaaaatg 1620

atgggttgtg tgggacagtc ttcttaatct aattatgtta ggtggttaag caaattagtg 1680

aaacttgccg taagttgcac tacatgtaca gacaagtctg ggtctttcag ccaaaatgtc 1740

tcaaaaacta aagctaccca acccaacatg ctttgtgtcc gccaaaacca gcaagagccc 1800

ctttattttt atgcttgttt tactttctag gcttttgttt tgtttgtttt tttgttttaa 1860

ccttgtgtaa tttattattt ggcgtaaaaa ctcgaaaaca tgtcacatga ggattctaca 1920

ttatgtctca atttgagagg gaagaaggaa ttaatacgcg acaccatagt ttagcagtaa 1980

cgtagtgaaa gtggtaatta ttaataacaa taataattag ctgtaacgta gtgaaaatgg 2040

taattttttg cgcaattagc gacgctgaat gctacaacac cgcgctgacc ttctgagcca 2100

gcctctatat ttggaactct tattttattt ttgggtcata acttgttatt tcctcaaacc 2160

caaaaagaaa aagaaaaatt cattcgctcg ctctctcact ccacgcaggt tggaccacta 2220

atcttttgct cgaggaactc cagagtccac agtatctgtg tcagaggtat tcgctttatt 2280

ctatatatat atatatatat atatatatat gttaatgggt ttggtcgttg gttgacaaaa 2340

ttcaagggtt ttgtttatga aatttgaagg aagagacgag agcgtagaag aagaag 2396

<210> 2

<211> 702

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgttgttgg aagcggaaaa agaggtagag aatttgagtc caaatgcaaa tacaaaccaa 60

aaagaagaag aagggtttgg aggtttgttt gtgaaagtga tgactgacga acaattggag 120

cttctgagat atcagatctc tgtctacgcc accatctctg agcaacttgc tgacttacac 180

aagtccttca cttcccaaca acatctttct ggaatgaagt tggggaatct taactatgat 240

ccactaatgg catatggcgg ccacaagatc acttcaaggc agaggtggtc tccatcgcct 300

gcgcagcttc aagtgcttga gcgaattttt gacgaaggta atgggactcc gagcaagcag 360

aagatcaagg agataaccac cgaactctct caacacggcc aaatttctga aaccaatgtg 420

tacaactggt tccagaacag gagggctcgt tcaaaacgga agcagtcagt cgcaacacca 480

aacaatgcgg aaccggaagc agagtctgaa actcatgatt tccttaagga aaatgcgaaa 540

ccagaagacg ccgaattcta tgacaactcc gcaaaaccaa gcaatgatca tgtgtacttt 600

ccgagccctg aggagttgat aagttggtcg gaaaatgaaa gcgtgatcga gctacaacac 660

gccttgccag cctggacagg atttggcgtt gaagagctgt ag 702

<210> 3

<211> 3098

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

attttatgaa tgatctgttg atatgtttta gacatgttga taagtggtgc gtttttttcg 60

ttcgatgtgc gttgtctttt tgagaaactg ccaagttggg aatttgatgg cgtagatatc 120

tgagactttt gttgcctgat gtgctcgttt ccatgctttt gttgtttggg taatactttt 180

ggcatgttga tatttgattg gctattgatt tactaaacaa tgtttttatt gggttttatt 240

ttgaaaaatt atccccaaag tttcaagtta atgtcaaatg aacatttttt attgactttt 300

ctagacgagg tgaggggtca gtataacttg cgagttagat acaagataca agggttttct 360

tgatattgtt tatccttttg gggcctaatt ttacggttta ggccgtatat aatatttcaa 420

aattgtcctt aaaagctaaa ataaattaaa ttttcaatgt ttctgtgtct ttattttcat 480

tggtcattgt taagcgaaga tgatttggag atcagccgcg aacgtatcgt atcggttcgg 540

ttactaaaaa cacccctctt cgtcggctta tggtctttgt gtctcaattg tctctgtctc 600

aatgtctcat gtctcatgtc tcatgtctca tgtctcatgt ctcagtcact tgtctcatgt 660

ctcatattgt tgttgatggg ttagttcctt taggttttgt tccattctgg gtctctgtgt 720

gtctcagtgc tttaactgcg agttctgcct cattataagc tgagggaatg agatgagaga 780

ttgatgtacg gggggagagg agaattttgt ttcgcttttt ggtttattaa atgttgatgc 840

caaaaatact ttattatttt ttgaataaag gtaaattgtc gatttaaaaa aaaagtcgac 900

aaaagttgga tataggatat aggaaggggc attgttctat gatatataat ttcttatgat 960

ttaccaatag gaagttttat tacgattttt tagaaactta atatgtttta agggataatt 1020

ttatataatt ttctcttggg ttatatgttg gttcaacaat agctgtgata tgtcattgct 1080

tggctgggtt attatgtatt ttgttgagtt ctacttttat ttcacatgct gtctcatttt 1140

aagtttcatt tgatacagaa gttcggctat gaaataattc aatttaatgt accattcttt 1200

tagttggcaa ataatccgct cgaatgttaa agcgtataaa ttaatattat cattggtacg 1260

gtatacagta taatgtccgt tgaagttcgc atgttatgta taaagggaac gacattatgg 1320

ctaattgact gtctcatgaa ttccattttt ccctattgca tttgctggtg ggttttgatc 1380

ttattataaa gccctagcct aactcaatcg attgccaatt tgattaatta gcaagacaag 1440

tgcgaaagga taaccgaaag ctgatgtgat ttattggaaa taaggataag catgctttta 1500

tgtgaatcga aatccgagct tatagtaaaa tgtacggacg gttttgaaac aattacataa 1560

ttatggaggg ttttgaaaga gcttccactt atagtggttt tgtcaacttg ttgcaaaatg 1620

atgggttgtg tgggacagtc ttcttaatct aattatgtta ggtggttaag caaattagtg 1680

aaacttgccg taagttgcac tacatgtaca gacaagtctg ggtctttcag ccaaaatgtc 1740

tcaaaaacta aagctaccca acccaacatg ctttgtgtcc gccaaaacca gcaagagccc 1800

ctttattttt atgcttgttt tactttctag gcttttgttt tgtttgtttt tttgttttaa 1860

ccttgtgtaa tttattattt ggcgtaaaaa ctcgaaaaca tgtcacatga ggattctaca 1920

ttatgtctca atttgagagg gaagaaggaa ttaatacgcg acaccatagt ttagcagtaa 1980

cgtagtgaaa gtggtaatta ttaataacaa taataattag ctgtaacgta gtgaaaatgg 2040

taattttttg cgcaattagc gacgctgaat gctacaacac cgcgctgacc ttctgagcca 2100

gcctctatat ttggaactct tattttattt ttgggtcata acttgttatt tcctcaaacc 2160

caaaaagaaa aagaaaaatt cattcgctcg ctctctcact ccacgcaggt tggaccacta 2220

atcttttgct cgaggaactc cagagtccac agtatctgtg tcagaggtat tcgctttatt 2280

ctatatatat atatatatat atatatatat gttaatgggt ttggtcgttg gttgacaaaa 2340

ttcaagggtt ttgtttatga aatttgaagg aagagacgag agcgtagaag aagaagatgt 2400

tgttggaagc ggaaaaagag gtagagaatt tgagtccaaa tgcaaataca aaccaaaaag 2460

aagaagaagg gtttggaggt ttgtttgtga aagtgatgac tgacgaacaa ttggagcttc 2520

tgagatatca gatctctgtc tacgccacca tctctgagca acttgctgac ttacacaagt 2580

ccttcacttc ccaacaacat ctttctggaa tgaagttggg gaatcttaac tatgatccac 2640

taatggcata tggcggccac aagatcactt caaggcagag gtggtctcca tcgcctgcgc 2700

agcttcaagt gcttgagcga atttttgacg aaggtaatgg gactccgagc aagcagaaga 2760

tcaaggagat aaccaccgaa ctctctcaac acggccaaat ttctgaaacc aatgtgtaca 2820

actggttcca gaacaggagg gctcgttcaa aacggaagca gtcagtcgca acaccaaaca 2880

atgcggaacc ggaagcagag tctgaaactc atgatttcct taaggaaaat gcgaaaccag 2940

aagacgccga attctatgac aactccgcaa aaccaagcaa tgatcatgtg tactttccga 3000

gccctgagga gttgataagt tggtcggaaa atgaaagcgt gatcgagcta caacacgcct 3060

tgccagcctg gacaggattt ggcgttgaag agctgtag 3098

Claims (10)

1. A DNA molecule, wherein the base sequence of said DNA molecule is as set forth in SEQ ID NO: 3, replacing a 2000-2500 bp sequence at the upstream of a 5' untranslated region translation initiation site of the ramie BnWOX8 gene with a sequence shown in SEQ ID NO: 1.

2. The DNA molecule of claim 1, wherein the Boehmeria nivea BnWOX8 gene has a coding sequence as set forth in SEQ ID NO: 2, respectively.

3. Use of the DNA molecule according to claim 1 or 2 for the preparation of a high-root ramie plant.

4. A recombinant expression vector comprising the DNA molecule of claim 1 or 2.

5. A recombinant Agrobacterium strain comprising the recombinant expression vector of claim 4.

6. A method for obtaining a ramie plant with high root content is characterized by comprising the following steps:

replacing 2000-2500 bp sequences at the upstream of the 5' untranslated region translation initiation site of the ramie BnWOX8 gene with SEQ ID NO: 1 to obtain a modified DNA molecule; the coding sequence of the ramie BnWOX8 gene is shown as SEQ ID NO: 2 is shown in the specification;

connecting the modified DNA molecules with an expression vector to obtain a recombinant expression vector;

transforming the recombinant expression vector into agrobacterium to obtain a recombinant agrobacterium strain;

preparing ramie callus, transforming the recombinant agrobacterium strain into the ramie callus, and performing differentiation culture and rooting culture to obtain a high-root ramie plant.

7. The method of claim 6, wherein the callus differentiation medium for preparing ramie callus is: MS + 0.1-1.0 mg/L TDZ + 0.01-0.1 mg/L2, 4-D + 0.005-0.015 mg/L IAA.

8. The method according to claim 6, wherein the callus differentiation medium used for differentiation culture is: MS + 0.1-1.0 mg/L TDZ + 0.01-0.1 mg/L2, 4-D + 0.005-0.015 mg/L IAA + 100-1000 mg/L carbenicillin + 10-100 mg/L kanamycin.

9. The method according to any one of claims 6 to 8, wherein the rooting medium used for the rooting culture is: MS + 0.005-0.015 mg/LNAA.

10. A method for obtaining a ramie plant with high root content is characterized by comprising the following steps:

replacing 2000-2500 bp sequences at the upstream of the 5' untranslated region translation initiation site of the ramie BnWOX8 gene with SEQ ID NO: 1 to obtain a modified DNA molecule; the coding sequence of the ramie BnWOX8 gene is shown as SEQ ID NO: 2 is shown in the specification;

connecting the modified DNA molecules with an expression vector to obtain a recombinant expression vector;

preparing ramie protoplast cells, transferring the recombinant expression vector into the protoplast cells by a PEG (polyethylene glycol) mediated transformation method, and culturing to obtain callus;

and performing differentiation culture on the callus, and screening to obtain a high-root ramie plant.

Images