CN105463016A - Method for inducing transgenic peanut hairy root biological reactor to produce resveratrol - Google Patents
Method for inducing transgenic peanut hairy root biological reactor to produce resveratrol Download PDFInfo
- Publication number
- CN105463016A CN105463016A CN201610025963.6A CN201610025963A CN105463016A CN 105463016 A CN105463016 A CN 105463016A CN 201610025963 A CN201610025963 A CN 201610025963A CN 105463016 A CN105463016 A CN 105463016A
- Authority
- CN
- China
- Prior art keywords
- peanut
- resveratrol
- ntr12
- hairy root
- ahress
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for inducing transgenic peanut hairy root biological reactor to produce resveratrol, and belongs to the technical field of biology. The transgenic peanut hairy roots specifically expressing AhRESS are obtained after a tobacco root specific promoter NtR12 drives the peanut genetic transformation of a carrier pBI121-NtR12-AhRESS of a peanut resveratrol synthase gene AhRESS through an agrobacterium rhizogenes mediate. The optimized production system of high-yield resveratrol is established, peanut hairy roots are cultivated till the 11th day and are processed through 20 mM natrium aceticum for 24 h, the resveratrol content in the hairy roots can be increased by 0.8 time and is 5.34 times that of non-transgenic peanut roots, the content reaches 148.62 micrograms per gram (FW), and meanwhile the resveratrol content in a culture medium is 80.86 micrograms per 100 mL and is 7 times or more that of peanut roots. The foundation is laid for making the biological reactor cultivate peanut hairy roots and then producing resveratrol.
Description
Technical field
The present invention relates to a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol, belong to biological technical field.
Technical background
Trans-resveratrol (Resveratrol is called for short Res), be a kind of important phytoalexin, be present in the plants such as giant knotweed, grape, peanut, in grape pomace and Roots of Peanut, content is particularly abundant.Peanut has the synthesis capability of trans-resveratrol, and in peanut, trans-resveratrol is mainly distributed in the root tissue of peanut.But the root of peanut and root nodule bacterium also exist the relation of mutualism, the root after peanut maturation often adheres to a large amount of root nodule, is unfavorable for the extraction purification of trans-resveratrol.In the later stage of peanut physiological maturity, often run into arid, cause the root of peanut and fruit to be subject to the pollution of flavus, therefore, this kind of Roots of Peanut can not be used for the extraction of trans-resveratrol.In addition, in peanut nature root, the content of trans-resveratrol compares giant knotweed and Pericarpium Vitis viniferae is all lower, and extraction purification efficiency is extremely low, and cost increases.
In peanut is respectively organized, trans-resveratrol is the highest with the content in root.Therefore, obtain a large amount of root fast, both obtained the trans-resveratrol material of planting source property, and then trans-resveratrol can have been extracted in a large number.And Agrobacterium rhizogenes can infect plant, form Hairy root in wound, and Hairy root is without hormonal dependent, can grow fast again, increases hundreds of times even thousands of times at short notice.Based on this, be the shortcut that rapid, high volume produces trans-resveratrol with Hairy root liquid culture.The research such as Liu Jie shows: the suitableeest basic liquid nutrient medium of peanut Hairy root is the MS substratum without hormone, adding plant hormone can the growth of suppression Hairy root in various degree, and 100 μm of ol/L Whitfield's ointments (SA) can improve the synthesis of peanut Hairy root polydatin synthesis secretion and trans-resveratrol.Fabricio etc. study discovery, peanut Hairy root efficiently can produce trans-resveratrol, and the Hairy root induction of Different growth phases produces Resveratrol content difference, and at suitable growth phase, certain density sodium-acetate induction Hairy root 24h, trans-resveratrol can be secreted in liquid nutrient medium.More than studying is all the research producing Hairy root with the direct infecting peanut of Agrobacterium rhizogenes and carry out; Drive the great expression of peanut trans-resveratrol gene in peanut Hairy root to root-specific promoter, and then the trans-resveratrol product quantifier elimination of optimizing research Hairy root has no report.Moreover the growth of Hairy root is subject to the impact of several factors, and substratum, culture temperature and mechanical pressure all can affect the growth of Hairy root.Known, the its secondary metabolites content of Hairy root is all very low, need on the basis of screening high-content of resveratrol hair-like root system, optimize the liquid culture condi of Hairy root, improve the speed of growth of Hairy root, by the induction of inductor, Resveratrol content is significantly improved, for industrial-scale utilizes peanut Hairy root fluid suspension culture to produce trans-resveratrol based theoretical in a large number.
The present invention is directed to above research background, utilize the transgenic peanuts Hairy root novel material obtained, increase Resveratrol content in peanut Hairy root through sodium-acetate induction, by Hairy root fluid suspension culture, rapid, high volume obtains Hairy root.Utilize organic solvent extraction and extraction process extract the trans-resveratrol in Hairy root and substratum respectively and carry out HPLC detection, the present invention can be and utilizes bio-reactor pilot scale culture peanut Hairy root production trans-resveratrol to lay a good foundation.
Summary of the invention
The present invention utilizes tobacco root-specific to express promoters driven peanut trans-resveratrol gene, construct pBI121-NtR12-AhRESS root specific expression carrier, adopt thawing method vector introduction Agrobacterium rhizogenes, by agriculture bacillus mediated, fusion gene NtR12:AhRESS is incorporated into Peanut genome, obtain the peanut Hairy root of simultaneously expressing Hairy root gene and AhRESS gene and produce system, , induce by adding sodium-acetate the resultant quantity greatly increasing trans-resveratrol in peanut Hairy root in the middle and later periods of Hairy root culture, by reducing concentration and the quantity of substratum, improve condition of suspension culture rapid, high volume and obtain Hairy root.Organic solvent extraction and extraction process is utilized to extract the trans-resveratrol in Hairy root and substratum respectively and carry out HPLC detection.The present invention can be and utilizes bio-reactor pilot scale culture peanut Hairy root production trans-resveratrol to lay a good foundation.
The invention provides a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol.Object is to set up a kind of induction transgenic peanuts Hairy root bio-reactor, and utilizes this reactor to produce the technology of trans-resveratrol in a large number.To utilize bio-reactor pilot scale culture peanut Hairy root and then to produce trans-resveratrol in a large number.
Technical scheme
Induce transgenic peanuts Hairy root bio-reactor to produce a method for trans-resveratrol, comprise the following steps:
(1) tobacco root-specific promoter NtR12 and peanut AhRESS gene is cloned;
(2) tobacco root-specific promoter NtR12 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR12-AhRESS;
(3) pBI121-NtR12-AhRESS is through Agrobacterium rhizogenes mediated transformation peanut;
(4) pBI121-NtR12-AhRESS peanut Hairy root fluid suspension culture is turned;
(5) sodium-acetate induction peanut Hairy root makes its Resveratrol content increase;
(6) isolation and determination of peanut Hairy root trans-resveratrol;
(7) isolation and determination of trans-resveratrol in liquid nutrient medium.
Specifically comprise the following steps:
1. tobacco root-specific promoter NtR12 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR12-AhRESS.
(1) clone tobacco root-specific promoter NtR12, and be connected in pMD18-T carrier, obtain pMD18-NtR12 carrier;
(2) pBI121-NtR12-GUSA vector construction: pBI121 carrier is carried out enzyme and cuts, excises the GUSA gene on this carrier, clones GUSA gene and be connected on pBI121 carrier from pCAMBIA-1301 carrier, builds pBI121-GUSA; PBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR12 carrier, NtR12 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR12-GUSA carrier;
(3) structure of pBI121-NtR12-AhRESS carrier: clone's peanut RS gene AhRESS gene, and be connected in pBI121-NtR12-GUSA carrier, obtain pBI121-NtR2-AhRESS carrier.
2. tobacco root-specific promoter NtR12 drives peanut RS gene AhRESS expression vector pBI121-NtR12-AhRESS through Agrobacterium rhizogenes mediated transformation peanut.
Produce at Agrobacterium rhizogenes inducing plant on the basis of Hairy root, utilize pBI121-NtR12-AhRESS vector Agrobacterium rhizogenes, by its mediation genetic transformation peanut, obtain transgenic peanuts Hairy root.Extract the DNA of the Hairy root of transgenic peanuts and contrast with CTAB method, carry out PCR with the upstream and downstream primer of AhRESS gene (AhRESS-F:5 ' ATGGTGTCTGTGAGTGGAATTC3 ' and AhRESS-R:5 ' TTATATGGCCACACTGCGGAGAAC3 ') and rolB gene (rolB-F:5 ' GTCCTTGCAGTGCTAGATTT3 ' and rolB-R:5 ' GAAGGTGCAAGCTACCTCTC3 ') respectively; The RNA of the Hairy root of transgenic peanuts and contrast is extracted with CTAB method, after PrimeScript reversed transcriptive enzyme specification sheets reverse transcription, carrying out RT-PCR, PCR reaction conditions with AhRESS gene specific primer (AhRESS-F:5 ' ATGGTGTCTGTGAGTGGAATTC3 ' and AhRESS-R:5 ' TTATATGGCCACACTGCGGAGAAC3 ') is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.。Screen positive Hairy root and carry out next step experiment.
3. turn pBI121-NtR12-AhRESS peanut Hairy root fluid suspension culture.
Use 1/2MS substratum, culture system is: 100mL1/2MS liquid nutrient medium, inoculation 2-3 root; Culture condition is 28 DEG C, and with dark culturing 14d in the concussion shaking table of 120rpm, Hairy root output is more than 100 times of inoculum size.After the transgenic peanuts Hairy root liquid culture that can grow fast of screening gained, results Hairy root.
4. sodium-acetate induction peanut Hairy root makes its Resveratrol content increase.
Sodium-acetate induction time be peanut Hairy root culture to the 11st day time, add sodium acetate soln, the concentration of sodium-acetate is 20mM, and induction time is 24h.
Sodium-acetate induction can improve peanut Hairy root liquid culture system trans-resveratrol output, specifically sodium-acetate is from 0-30mM increase process, and in peanut Hairy root, Resveratrol content first increases rear reduction, when sodium-acetate is 20mM, its content is up to 148.62 μ g/g, is about 2 times that do not induce; Sodium-acetate is from 0-30mM increase process, and in substratum, Resveratrol content first increases rear reduction, and when sodium-acetate is 20mM, its content is up to 40.43 μ g/50mL, is about 11.7% of content in Hairy root.With the sodium-acetate of 20mM induction process peanut Hairy root, Resveratrol content is increased to greatest extent, meanwhile, the hair-like root system subculture after process, after fresh culture, can recover quick energy for growth very soon.
5. the isolation and determination of peanut Hairy root trans-resveratrol.
The extraction of peanut Hairy root trans-resveratrol adopts extraction, and detection HPLC method is carried out, and detection HPLC method is carried out, wherein chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
6. the isolation and determination of trans-resveratrol in liquid nutrient medium.
In liquid nutrient medium, the extraction employing of trans-resveratrol take ethyl acetate as the extraction process acquisition of extraction agent, and by simple extracting operation, trans-resveratrol is dissolved in ethyl acetate, with the method concentrated extract of concentrating under reduced pressure, can obtain trans-resveratrol crude extract.Detection HPLC method is carried out.Wherein chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
The invention has the advantages that: the present invention utilizes tobacco root-specific promoter NtR12 to drive AhRESS gene specifically expressing in Tobacco Root, plant expression vector is converted in peanut through Agrobacterium rhizogenes, make AhRESS gene specifically expressing in peanut Hairy root, cultivated based on 28 DEG C by 1/2MS, can realize Hairy root with dark culturing 14d in the concussion shaking table of 120rpm expands numerous in a large number, realizes the great expression of trans-resveratrol.In the Hairy root obtained, Resveratrol content can improve 0.8 times, and content reaches 148.62 μ g/g(FW), in substratum, trans-resveratrol is 80.86 μ g/100mL simultaneously, is more than 7 times of the root system Resveratrol content of peanut own.The present invention lays a good foundation for utilizing bioreactor culture peanut Hairy root and then producing trans-resveratrol.
Accompanying drawing explanation
Fig. 1 peanut Hairy root growth curve.
Fig. 2 different culture media cultivates Hairy root Yield mapping.
Hair-like Root yield figure under Fig. 3 differing temps.
Resveratrol content in Fig. 4 different concns sodium-acetate process peanut Hairy root; P12, P2: different transgenosis hair-like root system, CK: negative hair-like root system contrast.
Resveratrol content in Fig. 5 different concns sodium-acetate process substratum.P12, P2: different transgenosis hair-like root system, CK: negative hair-like root system contrast.
Embodiment
The structure of [embodiment 1] pBI121-NtR12-AhRESS carrier
1. the clone of tobacco root-specific promoter NtR12
Take about 0.1g tobacco leaf, be placed in mortar frozen-thawed, be ground into powder rapidly; Utilize the DNA in CTAB method extraction tobacco, dissolve with the RNase sterilized water of 40 μ L10ng/ μ L, be placed in 37 DEG C and dissolve about 1h.Get the tobacco DNA point sample that 1 μ L extracts, carry out electrophoresis detection, deposition condition: electrophoretic buffer 1 × TAE, the sepharose of 1.0%, voltage 120V, electrophoresis time is about 20min; Get 1 μ L ultraviolet spectrophotometer simultaneously and measure its concentration.
According to the splicing sequence of the NtR12 promotor of this laboratory clone in early stage acquisition, design primer NtR12-Xho I-primer-F(5 ' GCGCCGCTCGAGTAATACTACAATAATAATTAAG3 '), NtR12-Xba I-primer-R(5 ' CGCTCTAGAGTTGTTGATATGTTTATGTTACTC3 '), increase according to following PCR system.This system comprises 32.5 μ LddH
2o, 10 μ L10 × PrimeSTARPCRBuffer(Mg
2+plus), the each 2.5mmol of 4 μ LdNTPMixture(), 1 μ LNtR12-Xho I-primer-F(10 μm ol), 1 μ LNtR12-Xba I-primer-R(10 μm ol), 1 μ L tobacco cDNA, 0.5 μ LPrimeSTARHSDNApolymerase(2.5U/ μ L), system cumulative volume is 50 μ L.
The PCR reaction system of 50 μ L is mixed, is divided into 2 pipes, often manages each 25 μ L.PCR reaction conditions is: 98 DEG C of 5min → (98 DEG C of 10s → 53 DEG C 15s → 72 DEG C 2min) 5cycles → (98 DEG C of 10s → 60 DEG C 15s → 72 DEG C 2min) DEG C 10min → 4,23cycles → 72 DEG C are preserved.
PCR primer reclaims after purifying through agarose gel electrophoresis, and be connected in pMD18-TVector, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 16-24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 12-16h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects, and sequencing result is as SEQIDNO.1.The correct recombinant plasmid of sequencing result is pMD18-NtR12.
2. the clone of peanut RS gene AhRESS
CTAB method is utilized to extract peanut leaf genomic dna, with peanut RS gene special primer AhRESS-BamH I-primer-F(5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGGAATTC3 '), AhRESS-Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCGGAGAACG3 ') carry out PCR detection.It reclaims product and is peanut AhRESS genes encoding frame DNA sequence dna.Be structured in pMD18-T carrier by ligase enzyme, proceed in competent escherichia coli cell DH5 α, select positive colony and carry out order-checking qualification, sequencing result is as SEQIDNO.2.
The structure of 3.pBI121-NtR12-AhRESS carrier
With pCAMBIA-1301 vector plasmid for template, carry out PCR with the special primer (GUSAF-BamH-Spe:5 ' agga-GGATCC-ACTAGTaccatggtagatctgagggtaaatttc3 ' and GUSAR-Sac1-ASC1-Swa1:5 ' agga-gagctc-GGCGCGCCTAAATTTA-GAAATTCGAGCTGGTCACCTGT3 ') with restriction enzyme site, it reclaims product and is the GUSA gene of cloning and obtaining.Utilized by pBI121 carrier BamH I and Sac I to carry out enzyme to cut, excise the GUSA gene on this carrier, reclaim enzyme cut after carrier ribbon; GUSA gene is connected to enzyme cut after pBI121 carrier on, obtain pBI121-GUSA carrier.
Utilized by pMD18-NtR12 carrier restriction enzyme Sac I and BamH I to carry out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 10-12h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains NtR12 promotor.
Utilize restriction enzyme Sac I and BamH I that pBI121-GUSA carrier is carried out enzyme to cut, excision 35S promoter, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
NtR12 promotor be connected in the pBI121-GUSA carrier of excision 35S promoter, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, and PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LNtR12-Xho I-primer-F, 0.5 μ LNtR12-Xba I-primer-R, 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 53 DEG C 30s → 72 DEG C 2min) 5cycles → (94 DEG C of 30s → 60 DEG C 30s → 72 DEG C 2min) DEG C 10min → 4,30cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR12-GUSA carrier.
Be connected in pMD18-T carrier by peanut RS gene AhRESS, system is as follows: 5 μ LSolutionI, and 4.5 μ LDNA reclaim product, 0.5 μ LpMD18-TVector(50ng/ μ L), this system cumulative volume 10 μ L.Each composition is added respectively in the PCR pipe of 200 μ L, mixing, 16 DEG C of spend the night connection, about 24h.To connect in product conversion competent escherichia coli cell DH5 α, and be applied to after shaking bacterium on the LB flat board containing microbiotic Amp, in 37 DEG C of constant incubators, cultivate 14h.Picking mono-clonal is sent to Hua Da gene and checks order after PCR detects.The correct recombinant plasmid of sequencing result is pMD18-AhRESS.
Utilize restriction enzyme Sac I and BamH I that pMD18-AhRESS carrier is carried out enzyme to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect, reclaims object band, obtains the AhRESS gene with Sac I and BamH I site.
Carry out enzyme with restriction enzyme Sac I and BamH I pair of pBI121-NtR12-GUSA carrier to cut, it is as follows that enzyme cuts system: 2.0 μ g plasmid DNA, 5.0 μ L10 × Kbuffer, 2.0 μ LSac I, 2.0 μ LBamH I, ddH
2o mends to 50 μ L, and mixing, cuts 11h in 37 DEG C of digestive ferments, and reaction terminates rear agarose gel electrophoresis detection enzyme and cuts effect.
Be connected to by AhRESS gene in pBI121-NtR12-GUSA carrier, ligation system is as follows: 1.0 μ L10 × T
4ligasebuffer, 4.0 μ L gene DNA fragments, 4.0 μ L vector DNA fragment, 1.0 μ LT4DNAligase, mixing, in 16 DEG C of connections of spending the night.To connect product conversion bacillus coli DH 5 alpha competent cell, bacterium liquid is coated on the LB flat board containing microbiotic Kan, in 37 DEG C of constant incubators, cultivate 14h.
Picking mono-clonal carries out bacterium liquid PCR and detects, PCR reaction system is as follows: 1.0 μ L templates, 2.0 μ L10 × PCRbuffer, 1.5 μ L2.5mMdNTP, 0.1 μ L general T aq enzyme, 0.5 μ LAhRESS-BamH I-primer-F(5 ' TCGTGGATCCGCCACCATGGTGTCTGTGAGTGGAATTC3 '), 0.5 μ LAhRESS--Sac I-primer-R(5 ' TCCTGAGCTCTTATATGGCCACACTGCGGAGAACG3 '), 14.4 μ LddH
2o.PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 69 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.It is numerous that the part bacterium liquid be positive to bacterium liquid PCR carries out expansion, uses alkaline lysis method of extracting plasmid, then carry out enzyme and cut single, double detection, 37 DEG C of digestions 4h, and reaction terminates rear agarose gel electrophoresis and detects enzyme and cut effect.Detected result is correct, is sent to Hua Da gene and checks order.The correct recombinant plasmid of sequencing result is pBI121-NtR12-AhRESS carrier.
[embodiment 2] pBI121-NtR12-AhRESS vector Agrobacterium rhizogenes
The plasmid DNA of getting 2 μ about g (volume is less than 20 μ l) joins in 200 μ L Agrobacterium rhizogenes competent cells, blows and beats mixing gently with liquid-transfering gun; Ice bath 30min, then places 5min in liquid nitrogen, then in 42 DEG C of thermostat water baths water-bath 1min, repeat 3 times; Then in placing 5min on ice, add 800 μ LYEB liquid nutrient mediums, shaking culture in 28 DEG C of constant temperature oscillators, after 175rpm, 8h, the centrifugal 3min of 3000rpm, abandon 800 μ l supernatants, the mixing of bacterium liquid will be remained, coat on the YEB flat board containing 50mg/lKan, cultivate in 28 DEG C of constant incubators and form single bacterium colony, about 48-72h; Picking mono-clonal in the substratum of 400 μ lYEB+50mg/l, 220rpm28 DEG C of shaking culture 12-16h; , bacterium liquid PCR verifies, empirical tests is positive colony, gets 600 μ l bacterium liquid and 600 μ l50% glycerine (sterilizing) mix in aseptic Eppendorf pipe, is stored in-70 DEG C of refrigerators in liquid nitrogen after quick-frozen.Bacterium liquid PCR verifies that system is as follows:
PCR reaction system:
PBI121-NtR12-AhRESS the primer is: AhRESS-F(5 ' ATGGTGTCTGTGAGTGGAATTC3) and AhRESS-R(5 ' TTATATGGCCACACTGCGGAGAAC3 '); PCR reaction conditions is: 94 DEG C of 5min → (94 DEG C of 30s → 57 DEG C 30s → 72 DEG C 1.5min) DEG C 10min → 4,35cycles → 72 DEG C are preserved.
Result shows, the PCR primer of expression vector plasmid DNA is special object band, and successful conversion is in Agrobacterium rhizogenes for plasmid, and the plasmid vector that the method can realize foreign gene-carrying proceeds to Agrobacterium rhizogenes.
The induction of [embodiment 3] peanut Hairy root
Prepare aseptic seedling and the engineering bacteria of newly meeting granule peanut varieties respectively, utilize Agrobacterium rhizogenes genetic transformation peanut.
(1) preparation of peanut aseptic seedling: configure 0.1% mercury chloride, 1% mercury chloride getting respective amount, according to dilution proportion, is stored in brown bottle, lucifuge, sealing; Get peanut seed 60 in tissue culture bottle, 75% alcohol immersion 1min, acutely shakes, and 0.1% mercury chloride soaks 10min, and acutely shake, sterilized water washes 5 times, each 5min, and sterilized water soaks 2h, and remove seed coat, radicle inserts MS substratum downwards, 3 every bottle; 28 DEG C, light culture 48h, is then moved to the photoperiod of 16h, is cultured to and grows 2 true leaves (about 8-10d) under 8h dark condition.
(2) preparation of engineering bacteria: the bacterium liquid taking out the corresponding recombinant plasmid previously preserved from-80 DEG C of Ultralow Temperature Freezers, carry out drawing plate (YEB containing 50mg/Lkan is dull and stereotyped), picking mono-clonal, shake bacterium, bacterium liquid PCR verifies, empirical tests is the bacterium liquid of positive colony, get part bacterium liquid and shake bacterium in a large number, generally shake 50mL bacterium liquid, 250rpm, 28 DEG C of incubated overnight are to OD
600=0.5(notes having caking to produce, or used time vortex makes in unicellular); Get 45mL bacterium liquid centrifugal in 50mL centrifuge tube, the centrifugal 10min of 4100rpm; Outwell supernatant liquor, precipitation is resuspended in 50mL1/2MS minimum medium, adds Syringylethanone (AS) the 50 μ L of 100mM; The engineering bacteria liquid prepared is preserved 2h, for Dual culture (infecting of explant) in 4 DEG C.
(3) Agrobacterium rhizogenes genetic transformation peanut: take out peanut aseptic seedling seedling, obtain blade, cotyledon, epicotyl and Hypocotyl Explants respectively, explant surface is done and is scratched process, be placed in aseptic tissue culture bottle respectively, the engineering bacteria liquid prepared is poured into respectively, constantly rock bottle gently, continue to infect 15min; Outwell engineering bacteria bacterium liquid, blot unnecessary bacterium liquid with aseptic filter paper, various for the peanut infected explant is placed in Dual culture substratum (MS+75 μM of As) Dual culture, 28 DEG C of light culture 2-4d, depending on the growing way of bacterium; Explant after Dual culture is taken out and is placed in aseptic tissue culture bottle, then in sterilized tissue culture bottle, add the Cef aqueous solution that 50mL final concentration is 500mg/L, constantly rock bottle gently, continue 5min, then blade is taken out, repeat once, then blade is put into the bottle containing 50mL sterilized water, constantly rock bottle gently, continue about 5min; This uncured tobacco blade of washed bacterium is proceeded to Hairy root inducing culture (B respectively
5+ 500mg/LCef) in carry out Hairy root induction, every 7d switching once, add up the quantity of the hairly root induced after three weeks, the explant of 10 contrasts and 10 explants infected through Agrobacterium rhizogenes are as one group, in order to statistics, add up the hair shape of each group of explant with inductivity.
[embodiment 4] peanut Hairy root growth curve
Get fresh flowers hair tonic shape root system, be inoculated in the tissue culture bottle of 100mL liquid 1/2MS substratum respectively, every bottle graft kind 2-3 root, 28 DEG C, 120rpm dark culturing, within every two days, take out 3 bottles of Hairy root, Aspirate medium, measures Hairy root fresh weight, gets 3 groups of data mean numbers as measurement result, be taken to the 18th day, statistical survey result also draws growth curve (Fig. 1).
[embodiment 5] substratum is on the impact of Hairy root liquid culture
Get fresh flowers hair tonic shape root system, be inoculated in the tissue culture bottle of 100mL liquid nutrient medium respectively, MS, 1/2MS, B
5each three bottles of substratum, every bottle graft kind 2-3 root, 28 DEG C, 120rpm dark culturing, when Hairy root covers with tissue culture bottle, take out Hairy root, Aspirate medium, measure fresh weight, and record growth time, get 3 groups of data mean numbers as measurement result, statistical survey result (Fig. 2).
[embodiment 6] culture temperature is on the impact of Hairy root liquid culture
Get fresh flowers hair tonic shape root system, be inoculated in the tissue culture bottle of 100mL liquid 1/2MS substratum respectively, every bottle graft kind 2-3 root, 120rpm dark culturing, design temperature gradient 22/24/26/28/30 DEG C, each Temperature Treatment 3 bottles, take out Hairy root after 2 weeks, Aspirate medium, measure fresh weight, get 3 groups of data mean numbers as measurement result, statistical survey result (Fig. 3).
[embodiment 7] sodium-acetate inducing action
Get the higher transgenic peanuts hair-like root system of Resveratrol content and negative control hair-like root system, be inoculated in the tissue culture bottle of 100mL liquid 1/2MS substratum respectively, every bottle graft kind 2-3 root, 28 DEG C, 120rpm dark culturing is to 11d, Hairy root is taken out whole subculture respectively and contain 0/10/20/30mM sodium-acetate fresh liquid 1/2MS substratum in 100mL, 3 repetitions are done in each process, 28 DEG C, 120rpm dark culturing 24h, collect Hairy root and substratum, Hairy root weigh after quick-frozen in liquid nitrogen, then-80 DEG C of refrigerators are stored in for subsequent use, liquid 1/2MS substratum is stored in-20 DEG C of refrigerators (Fig. 4) for subsequent use.
The extraction of [embodiment 8] peanut Hairy root trans-resveratrol
Get the Hairy root of-80 DEG C of preservations, correct amount 0.5g, in liquid nitrogen, grinding fully, be placed in centrifuge tube respectively, add 5mL methyl alcohol, ultrasonic (300W in 60 DEG C of water-baths, 45kHz) extract 1h, the centrifugal 10min of 6000rpm, collect supernatant, in triplicate, merge supernatant liquor, in 45 DEG C of rotary evaporations near dry after filtration, by methanol constant volume to 2mL, with 0.22 μm of membrane filtration, obtain pretreated sample solution, for subsequent use.
The extraction of trans-resveratrol in [embodiment 9] liquid 1/2MS substratum
Get the liquid 1/2MS substratum 20mL cultivating Hairy root, in 125mL pear shape separatory funnel, extract 5min by 30mL ethyl acetate, collect upper organic phase, repeat twice, merge and collect liquid, 45 DEG C are evaporated to about 1mL, 2mL is settled to by ethyl acetate, for subsequent use.
The HPLC of [embodiment 10] transgenic peanuts Hairy root Resveratrol content measures
1. trans-resveratrol HPLC detects chromatographic condition: permaphase ODS (250mm × 4.6mm × 5 μm), moving phase acetonitrile: water (25:75), flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
2. the preparation of trans-resveratrol standard substance storing solution: accurately take trans-resveratrol standard substance 5.0mg, dissolve with methyl alcohol (chromatographically pure) and be settled to 50mL, obtain the trans-resveratrol standard substance storing solution of 100mg/L, be placed in 4 DEG C of refrigerators and keep in Dark Place, for subsequent use.
3. the preparation of trans-resveratrol standard working solution: accurately pipette trans-resveratrol standard substance storing solution 2mL, 4mL, 6mL, 8mL, 10mL methyl alcohol (chromatographically pure) respectively and dilute and be settled to 1000mL, obtain a series of trans-resveratrol standard substance working fluid, its mass concentration is respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L.
4. the drafting of typical curve: each 10 μ L of the trans-resveratrol standard solution sample introduction being respectively respectively 0.20mg/L, 0.40mg/L, 0.60mg/L, 0.80mg/L, 1.00mg/L with mass concentration, record the relation between peak area and Resveratrol content, drawing standard curve.
5. the mensuration of Resveratrol content in Hairy root and substratum: get each 10 μ L sample introductions of pretreatment sample solution, every sample does three repetitions, calculate the content of trans-resveratrol in each strain Hairy root and substratum according to typical curve, average as experimental result.Result shows that in the Hairy root obtained, Resveratrol content can improve 0.8 times, and content reaches 148.62 μ g/g(FW), in substratum, trans-resveratrol is 80.86 μ g/100mL simultaneously, is more than 7 times of the root system Resveratrol content of peanut own.The present invention lays a good foundation (Fig. 4 and Fig. 5) for utilizing bioreactor culture peanut Hairy root and then producing trans-resveratrol.
The foregoing is only preferred embodiment of the present invention, all equalizations done according to the present patent application the scope of the claims change and modify, and all should belong to covering scope of the present invention.
SEQUENCELISTING
<110> University Of Agriculture and Forestry In Fujian
<120> mono-kind induces transgenic peanuts Hairy root bio-reactor to produce the method for trans-resveratrol
<130>12
<160>12
<170>PatentInversion3.3
<210>1
<211>1503
<212>DNA
<213> tobacco NTR12 specific promoter
<400>1
taatactacaataataattaagtttacggttagatatttataaatattttgtaaagttta60
taatagtatatataaatatatatatacagagtctaagcgtaagcaaccctctaaattcat120
ccctgcttggaactcataatagagcatgttggcaaaggctagctctatgggatttgatta180
ctgtgattggtgtcgccagagttcagtcatcaaaaatggaaacgcaaaaaccataaaaat240
cgtggtcaattgattagtacttatagtattatattttgaatatgcaatgattgaaaatga300
gataaaaaggaagaaactaagaaaagagggagtagctactcgtataaaggagtccaagcc360
aaaataggacgttgtcgagggccatgcatgggctgtccatattaaaaaaaaaaaagaaga420
agaaaaaaacgggagtaattcaaaaatagccatacttataagtgatcattaaaaaatatc480
cacaattttaaaagtaattgaaatttagtcacttttcatgtaaagataaatctgaacgaa540
aacaccgttcaaaatccgaaaaaatactccagtataatatactggaattccagtataata600
taccggtccagcataaaatactgtccaatctccagtatattgtactgaaactttccgcgt660
gttggagttccagcataatatgctggaagttcttacgcatgtgcaccgatctccagtata720
ttatgttggaactttccgtgttgcagcaaaatagtggctatttttcaatgacttcgcaaa780
cgctgactatttttgataaatccgaaaactgattagcccgtgctatttttaagaaacaaa840
agtgaattaaattggaattataggtgctggcccaatggtctaagctctccccacacccgc900
ttgctgcatttttagagtgatatcaaacacaaatcgtaagatgaggatatgttttgcctt960
tgggtatcctatgtcaggactcaggaccaacaccaataatttatttctccgtacgaccaa1020
gataaatataaataattttaaggaggaaagcacgccggacacctctcaatatgcgaacct1080
attgttttttggtccgttctaaaaagaataattcctttttaaatttgataacaatttaac1140
ttcaacttacaatttcatccttaacgagaaacttttataaccacacaaatactctgcact1200
tctttttgacttgtttaggaccacaaattccaaaagtgtttattttattttttcttaaac1260
tccgtgcacagtcaaacatgttcacataaattgaaaccggagggattactacttattagg1320
aatattaaaaaaaataaaaaaaatacagagagatggcacgagaaaaaaactgcatgtaat1380
ttcactgatttatcatgagatgataagatgataagggtcatttcaaactctatataaagg1440
accaaaaaacacatcaaagttacgtaccaaaaaaaaatagagtaacataaacatatcaac1500
aac1503
<210>2
<211>1170
<212>DNA
<213> peanut RS gene ahress
<400>2
atggtgtctgtgagtggaattcgcaaagttcaaagggcagaaggccctgcaactgtattg60
gcgataggcacagcaaatccaccaaattgtattgatcagagcacatatgctgattattat120
tttagagtaactaacagtgaacacatgactgatctcaagaagaagtttcagcgcatttgt180
gagagaacacaaatcaagaacagacatatgtacttaacagaagagatactgaaagagaat240
cctaacatgtgcgcatataaagcaccgtcgttggatgcaagggaagacatgatgatcagg300
gaggtaccaagggttggaaaagaggctgcaaccaaggccatcaaggaatggggtcagcca360
atgtctaagatcacacatttgatcttctgcaccaccagcggtgttgcattgcctggcgtt420
gattacgaactcatcatactcttaggactcgacccatccgtcaagaggtacatgatgtac480
caccaaggctgcttcgccggtggcactgtccttcgtttggctaaggacttggctgaaaac540
aacaaggatgctcgtgtgcttatcgtttgttctgagaataccgcagtcactttccgtggt600
cctagtgagacagacatggatagtcttgtagggcaagccttgtttgctgatggagctgct660
gcgattatcattggttctgatcctgtgccagaggttgaaaagcctatctttgaaattgtt720
tcgactgatcaaaaacttgtccctaacagccatggagccatcggtggtctccttcgtgaa780
gttgggcttacattctatcttaataagagtgttcctgatattatttcacaaaacatcaat840
gatgcgctcagtaaagcttttgatccattgggtatatctgattataactcaatattttgg900
attgcacatcctggtggacgtgcaattttagaccaggttgaacagaaagtgaacttgaaa960
ccagaaaagatgaaagccactagagacgtgcttagcaattatggtaacatgtcaagtgca1020
tgtgtgtttttcattatggatttgatgaggaagaagtctcttgaagaaggacttaaaacc1080
actggtgaaggacttgattggggtgtgcttcttggctttggtcctggtcttactattgaa1140
accgttgttctccgcagtgtggccatataa1170
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
atggtgtctgtgagtggaattc22
<210>4
<211>24
<212>DNA
<213> artificial sequence
<400>4
ttatatggccacactgcggagaac24
<210>5
<211>20
<212>DNA
<213> artificial sequence
<400>5
gtccttgcagtgctagattt20
<210>6
<211>20
<212>DNA
<213> artificial sequence
<400>6
gaaggtgcaagctacctctc20
<210>7
<211>34
<212>DNA
<213> artificial sequence
<400>7
gcgccgctcgagtaatactacaataataattaag34
<210>8
<211>33
<212>DNA
<213> artificial sequence
<400>8
cgctctagagttgttgatatgtttatgttactc33
<210>9
<211>38
<212>DNA
<213> artificial sequence
<400>9
tcgtggatccgccaccatggtgtctgtgagtggaattc38
<210>10
<211>35
<212>DNA
<213> artificial sequence
<400>10
tcctgagctcttatatggccacactgcggagaacg35
<210>11
<211>43
<212>DNA
<213> artificial sequence
<400>11
aggaggatccactagtaccatggtagatctgagggtaaatttc43
<210>12
<211>48
<212>DNA
<213> artificial sequence
<400>12
aggagagctcggcgcgcctaaatttagaaattcgagctggtcacctgt48
Claims (8)
1. induce transgenic peanuts Hairy root bio-reactor to produce a method for trans-resveratrol, it is characterized in that: comprise the following steps:
(1) tobacco root-specific promoter NtR12 and peanut RS gene AhRESS is cloned;
(2) tobacco root-specific promoter NtR12 drives the structure of peanut RS gene AhRESS expression vector pBI121-NtR12-AhRESS;
(3) pBI121-NtR12-AhRESS is through Agrobacterium rhizogenes mediated transformation peanut;
(4) pBI121-NtR12-AhRESS peanut Hairy root fluid suspension culture is turned;
(5) sodium-acetate induction peanut Hairy root makes its Resveratrol content increase;
(6) isolation and determination of peanut Hairy root trans-resveratrol;
(7) isolation and determination of trans-resveratrol in liquid nutrient medium.
2. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, it is characterized in that: in described step (1), the sequence of tobacco root-specific promoter NtR12 is SEQIDNo:1, and the sequence of peanut RS gene AhRESS is SEQIDNo:2.
3. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, is characterized in that: step (2) concrete grammar is:
1) tobacco root-specific promoter NtR12 is connected in pMD18-T carrier, obtains pMD18-NtR12 carrier;
2) pBI121-NtR12-GUSA vector construction: pBI121 carrier is carried out enzyme and cuts, excises the GUSA gene on this carrier, clones GUSA gene and be connected on pBI121 carrier from pCAMBIA-1301 carrier, builds pBI121-GUSA; PBI121-GUSA carrier is carried out endonuclease reaction, and excision 35S promoter, carries out endonuclease reaction by pMD18-NtR12 carrier, NtR12 promotor is connected in pBI121-GUSA carrier, obtain pBI121-NtR12-GUSA carrier;
3) structure of pBI121-NtR12-AhRESS carrier: peanut RS gene AhRESS gene is connected in pBI121-NtR12-GUSA carrier, obtains pBI121-NtR2-AhRESS carrier.
4. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, is characterized in that: in described step (3), the peanut genetic transformation explant of Agrobacterium rhizogenes mediation is respectively blade, cotyledon, epicotyl and Hypocotyl Explants.
5. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, it is characterized in that: described step (4) transfer pBI121-NtR12-AhRESS peanut Hairy root fluid suspension culture used medium is 1/2MS substratum, culture system is: 100mL1/2MS liquid nutrient medium, inoculation 2-3 root; Culture condition is 28 DEG C, with dark culturing 14d in the concussion shaking table of 120rpm.
6. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, it is characterized in that: in described step (5) time of sodium-acetate induction be peanut Hairy root culture to the 11st day time, the concentration of sodium-acetate is 20mM, and induction time is 24h.
7. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, it is characterized in that: in described step (6), the extraction of peanut Hairy root trans-resveratrol adopts extraction, detection HPLC method is carried out, wherein chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
8. a kind of method of inducing transgenic peanuts Hairy root bio-reactor to produce trans-resveratrol according to claim 1, in described step (7), in liquid nutrient medium, the extraction employing of trans-resveratrol take ethyl acetate as the extraction process acquisition of extraction agent, detection HPLC method is carried out, wherein chromatographic condition is: permaphase ODS, moving phase acetonitrile: water=25:75, flow velocity 1.0mL/min, determined wavelength 306nm, column temperature 25 DEG C, sample size 10 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025963.6A CN105463016B (en) | 2016-01-15 | 2016-01-15 | Method for inducing transgenic peanut hairy root bioreactor to produce resveratrol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610025963.6A CN105463016B (en) | 2016-01-15 | 2016-01-15 | Method for inducing transgenic peanut hairy root bioreactor to produce resveratrol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105463016A true CN105463016A (en) | 2016-04-06 |
| CN105463016B CN105463016B (en) | 2020-03-17 |
Family
ID=55601172
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610025963.6A Expired - Fee Related CN105463016B (en) | 2016-01-15 | 2016-01-15 | Method for inducing transgenic peanut hairy root bioreactor to produce resveratrol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105463016B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605006A (en) * | 2012-02-17 | 2012-07-25 | 天津大学 | Biological method for producing resveratrol |
| CN103773797A (en) * | 2014-02-19 | 2014-05-07 | 江苏省农业科学院 | Tissue culture method for inducing peanut hairy root |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
| CN105039370A (en) * | 2015-07-09 | 2015-11-11 | 国际竹藤中心 | Fusion gene for biosynthesis of resveratrol, expression vector thereof and resveratrol preparation method |
-
2016
- 2016-01-15 CN CN201610025963.6A patent/CN105463016B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605006A (en) * | 2012-02-17 | 2012-07-25 | 天津大学 | Biological method for producing resveratrol |
| CN103773797A (en) * | 2014-02-19 | 2014-05-07 | 江苏省农业科学院 | Tissue culture method for inducing peanut hairy root |
| CN103966218A (en) * | 2014-05-14 | 2014-08-06 | 福建农林大学 | Specific promoter NtR2 of tobacco root and application of specific promoter NtR2 to transgenic plant |
| CN105039370A (en) * | 2015-07-09 | 2015-11-11 | 国际竹藤中心 | Fusion gene for biosynthesis of resveratrol, expression vector thereof and resveratrol preparation method |
Non-Patent Citations (4)
| Title |
|---|
| CHENEY，Y ET AL.: ""Arachis hypogaea trihydroxystilbene synthase mRNA，complete cds"，Accession Number：AY170347.1", 《GENBANK》 * |
| RUDIGER HAIN ET AL.: ""Expression of a stilbene synthase gene in Nicotiana tabacum results in synthesis of the phytoalexin resveratrol"", 《PLANT MOLECULAR BIOLOGY》 * |
| 林荣华: ""花生白藜芦醇合酶基因转化烟草与番茄的初步研究"", 《中国学位论文全文数据库》 * |
| 郑世刚 等: ""白藜芦醇合成酶基因在基因工程中的应用及功能研究进展"", 《生物工程学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299700B1 (en) | 2021-02-19 | 2022-04-12 | Acequia Biotechnology, Llc | Bioreactor containers and methods of growing hairy roots using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105463016B (en) | 2020-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109679993B (en) | Construction method of agrobacterium rhizogenes-mediated transgenic plant | |
| CN104292317B (en) | Drought resistant correlative protein of plant and coding gene and application thereof | |
| CN105505990A (en) | Method for driving AhRESS to produce resveratrol in peanut capillary root systems through specific promoters NtR2 | |
| CN104086637B (en) | Tobacco strigolactones transport protein NtPDR6 and interference expression vector and application thereof | |
| CN110938617A (en) | Lilium regale LrPAL-1 gene and application thereof | |
| CN107267528A (en) | A kind of tobacco axillary bud adjusting and controlling growth gene NtMOC1 and its cloning process and application | |
| CN101875932B (en) | Specific promoter for growing point of cotton, cloning thereof and application thereof | |
| CN105463016A (en) | Method for inducing transgenic peanut hairy root biological reactor to produce resveratrol | |
| CN114703198B (en) | Cloning and application of tomato transporter SlZIF1 | |
| CN104531708B (en) | Cotton fibre specific expression promoter TB17P1 and application thereof | |
| Cao et al. | Extremely simplified cut-dip-budding method for genetic transformation and gene editing in Taraxacum kok-saghyz | |
| CN104531721A (en) | Suaeda salsa saline-alkaline tolerance gene and application thereof | |
| CN105543277A (en) | Method for increasing resveratrol produced through peanut hairy root systems in mode that AhRESS is driven by specific promoter NtR12 | |
| CN110106200B (en) | Application of corn BBM1 gene in improving genetic transformation efficiency of plants | |
| CN103966220B (en) | The root-specific promoter of synthetic and application thereof | |
| CN104450770B (en) | Applications of the larch miR166a in regulating development of plants | |
| CN105505989A (en) | Method for driving AhRESS genes to produce resveratrol in nicotiana benthamiana capillary roots through promoters NtR2 | |
| CN105505983A (en) | Method for utilizing NtR2 root promoter for driving AhRESS to generate reseratrol in nicotiana benthamiana hairy roots | |
| CN105602957B (en) | Cotton fiber specifically-expressed promoter TB7P1 and its application | |
| CN105441478A (en) | Method for producing resveratrol by driving AhRESS genes through tobacco root specific promoter NtR2 | |
| CN114657208B (en) | Method for establishing spider-flavor transgenic hairy root genetic transformation system | |
| CN108660143A (en) | Carrier and the application of a kind of cabbage type rape BnKCS1-2 genes and its structure | |
| CN108484742A (en) | Birch-leaf pear cold-resistant transcription factor PbrMYB5 and its application | |
| CN102618566B (en) | Method for constructing Platymonas subcordiformis chloroplast expression system | |
| CN116042701A (en) | Bamboo mosaic virus mediated exogenous expression system and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200317 Termination date: 20220115 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |