CN105349442A - Metschnikowia pulcherrima and application thereof - Google Patents
Metschnikowia pulcherrima and application thereof Download PDFInfo
- Publication number
- CN105349442A CN105349442A CN201510513101.3A CN201510513101A CN105349442A CN 105349442 A CN105349442 A CN 105349442A CN 201510513101 A CN201510513101 A CN 201510513101A CN 105349442 A CN105349442 A CN 105349442A
- Authority
- CN
- China
- Prior art keywords
- plum
- strange
- yeast
- metabolite
- qhl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Plant Substances (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses metschnikowia pulcherrima and application thereof, and belongs to the technical field of microorganism new resources and microorganism application. The strain of the metschnikowia pulcherrima is QHL-23-1, is named as Metschnikowia sp. in a classified mode, and is registered in the China General Microbiological Culture Collection Center under the number of CGMCC NO. 10461. The metschnikowia pulcherrima is obtained from surfaces of fruits in a separating and screening mode, and is a new strain of the metschnikowia pulcherrima, and the strain of the metschnikowia pulcherrima and metabolite thereof have inhibition effect on monilinia fracticola and pathogenic bacteria thereof. In selected pathogenic fungi of plants, the diameter of a monilinia fracticola inhibition zone of the metschnikowia pulcherrima is above 10 mm, so that the metschnikowia pulcherrima has stable and efficient antibacterial property and can be used for preventing and treating the pathogenic bacteria or diseases.
Description
Technical field
The invention belongs to microorganism new resources and technical field of microbe application, particularly the strange yeast of a kind of plum and application thereof.
Background technology
China's peach garden area, more than 9,000,000 mu, is peach effective cultivated area first big country in the world; Producing peach per year more than 400,000 tons, is peach output first big country in the world.Beijing peach output occupies domestic last eight, only Pinggu County, beijing one ground, and peach cultivated area just reaches more than 220,000 mu (1.47 ten thousand hectares); Peach industry has become the pillar of the economy industry in Pinggu county, and some peaches and relevant converted products have exported to European Union, Japan and other countries.Since 2000, peach brown rot big area in Beijing increases, and increases the weight of year by year; The peach garden that wherein morbidity in 2005 is heavier, peach fruit is injured, and comes off in a large number, has no the fruit of aobvious disease during harvesting, and after harvesting 2-3 days, the fruit of more than 50% rots because brown heart infects, and causes serious financial loss to orchard worker.Beijing plant protection unit peach brown rot investigation result display in 2012, each suburban county peach producing region, Beijing all has peach brown rot to occur, and the transport of peach after adopting and duration of storage sickness rate are all more than 30%; This greatly reduces edibleness and the marketable value of fruit, has had a strong impact on the development of Beijing peach industry.
Applying bactericidal agent control post-harvest diseases is the important means reducing fruit loss, and the chemical agent that current domestic application is prevented and treated in postharvest diseases of fruit is mainly SO
2with Top Form Wormer (Thiabendazole).SO
2widely use and usually can bring environmental pollution, and in normal distance transport and long-term fruit storage, its sterilization effect can be lost in time and rapidly; Although Top Form Wormer has good prevention effect to fungal disease after Fruit, effect be there is no to pathogenetic bacteria, and it uses the rear longevity of residure longer, not easily degrades, can affect the export abroad of high-end fruit; The more important thing is, the widespread adoption of Top Form Wormer easily makes some pathogenic bacterias develop immunity to drugs.Biological bactericide has inherent advantage for chemical pesticide, avoid the problems such as pesticide residue, environmental pollution, resistance, and low toxicity, environmental protection, holding effect, nature ecological compatibility is better, is one of the most promising alternative means of chemical pesticide reagent application.
The strange Saccharomycodes yeast of plum ubiquity in physical environment, be mainly present in sugar degree compared with horn of plenty fruit surface and take, be one of superior microorganism population in plant microecosystem.This bacteria growing speed is fast, and nutrition is simple, and growing ability is strong.As biocontrol microorganisms application aspect, it has the advantage of oneself uniqueness: of reduced contamination 1) to environment, does not produce toxin; 2) microbiotic is not produced, relatively safe to the mankind; 3) for other fungies, sensitization spore is not produced; 4) desired nutritional is fairly simple; 5) commercialization scale operation is applicable to.Therefore, it has good application prospect.
The present invention have successfully been obtained a strain suppress peach the to be adopted strange yeast of plum that rear brown rot germ and peach adopt rear brown heart, through verification experimental verification, the antibacterial circle diameter of this yeast to Monilinia fructicola is more than 10mm, illustrates that the strange yeast of described plum has stable, efficient anti-microbial property.
Summary of the invention
The object of the present invention is to provide the strange yeast of a novel species plum (Metschnikowiasp.).
Object of the present invention is also to provide a kind of pathogenic bacteria inhibitor, and its activeconstituents is the strange yeast of above-mentioned plum and/or its metabolite.
Object of the present invention is also to provide a kind of disease suppression agent, and its activeconstituents is the strange yeast of above-mentioned plum and/or its metabolite.
The strange yeast of described plum (Metschnikowiasp.), bacterial strain number is QHL-23-1, and it is numbered CGMCCNo.10461 in registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
5.8SrDNA, ITS1/ITS2 gene order of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1,26SrDNA gene order is respectively as shown in SEQIDNo.1 and No.2.
The 26SrDNA gene order phylogenetic analysis of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 as shown in Figure 1.
The strange yeast of described plum (Metschnikowiasp.) QHL-23-1, is separated from fruit surface and obtains.
The morphological feature of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 is: thalline vegetative cell is spherical in shape, avette or subsphaeroidal, monolateral or polygon gemmation; At 20 DEG C, YPD substratum and PDA substratum grew after 48 hours, bacterium colony is that butteriness, oyster white are opaque, flat or circular, neat in edge, bacterium colony corrugationless, as shown in Figures 2 and 3.
The physiological and biochemical property of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1: can carry out glucose fermentation, can not carry out the fermentation of raffinose, lactose, maltose, sucrose, semi-lactosi and trehalose; Carbon assimilation aspect: glucose, semi-lactosi, sorbose, sucrose, maltose, trehalose, cellobiose, wood sugar, ribose, melizitose, ethanol, sorbitol, glycerol, N.F,USP MANNITOL, ribitol, Whitfield's ointment, glucosamine, citric acid, lactic acid, n-Hexadecane and Zulkovsky starch are positive, bacterium powder, methyl alcohol, inositol, melibiose, lactose, D-R, L-arabinose, rhamnosyl, melampyrum, erythritol, glucuronic acid are negative.The strange yeast of described plum (Metschnikowiasp.) QHL-23-1 all can normal growth in the substratum of pH4.0-5.5, and at envrionment temperature is 4 DEG C, growth potential is weak, can not grow more than 40 DEG C; Best suitable growth temperature is 16-20 DEG C, and can not grow containing on the substratum of VITAMIN, growth does not form kind of starch material.The strange yeast of described plum (Metschnikowiasp.) QHL-23-1 produces organic acid, and these are all the key biological and ecological methods to prevent plant disease, pests, and erosion indexs of biocontrol microorganisms.
The present invention also aims to provide the strange yeast of above-mentioned plum and/or its metabolite at suppression pathogenic bacteria, preparation pathogenic bacteria inhibitor, suppress disease, the application prepared in disease suppression agent.
In the application of the strange yeast of above-mentioned plum (Metschnikowiasp.) QHL-23-1, described pathogenic bacteria is that peach adopts rear brown rot germ; Described disease is that peach adopts rear brown heart.
Wherein, described peach adopts rear brown rot germ is Moniliniafructicola, Monilinialaxa or Moniliniafructigena.
The metabolite of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 can obtain from the fermented liquid of the strange yeast of plum (Metschnikowiasp.) QHL-23-1.
The preparation method of the metabolite of the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 is: strange for the plum of preservation yeast (Metschnikowiasp.) is inoculated 2 rings to the YPD liquid nutrient medium of 200ml from PDA solid slope, in 20 DEG C-25 DEG C, under 150-200rpm condition, constant-temperature shaking culture 24h-48h, obtains the fermented liquid of the strange yeast of plum (Metschnikowiasp.) QHL-23-1; By cultured fermented liquid, be sub-packed in the centrifuge tube of 50ml, under 4 DEG C and 5000rpm condition, centrifugal 5-10min, supernatant liquor and the strange metabolism of yeasts thing of plum;
The main component of PDA solid medium: potato: 20%, glucose: 2%, agar: 2%, distilled water;
The main component of YPD liquid nutrient medium is: yeast extract: 1%, glucose: 2%, Tryptones: 2%, distilled water.
Beneficial effect of the present invention is: the strange yeast of plum (Metschnikowiasp.) QHL-23-1 of acquisition is the new strange yeast strain of plum of a strain, and it adopts rear brown rot germ and peach to peach, and to adopt rear brown heart all inhibited.In selected plant pathogenic fungi, more than 10mm is reached to the antibacterial circle diameter of Monilinia fructicola, illustrate that the strange yeast of described plum has stable, efficient anti-microbial property.The strange yeast of described plum and metabolite thereof can at suppression Monilinia fructicola, preparation peach brown rot bacteria preparations; Suppress peach brown rot evil, apply in preparation peach brown rot evil preparation.
Biomaterial preservation explanation
Classification And Nomenclature: the strange yeast of plum (Metschnikowiasp.); Strain number: QHL-23-1
Preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism is called for short: CGMCC
Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preservation date: on January 30th, 2015
Register on the books numbering: CGMCCNo.10461. at preservation center
Accompanying drawing explanation
Fig. 1. based on the evolutionary tree that 26SrDNA gene order builds, phylogenetic analysis result shows that the kind that the strange yeast QHL-23-1 of plum represents is an individual branches, and the strange yeast QHL-23-1 of plum is a novel species.
Fig. 2. the strange yeast of plum (Metschnikowiasp.) QHL-23-1 grows the Photomicrograph after 3 days on YPD substratum.
Fig. 3. the strange yeast of plum (Metschnikowiasp.) QHL-23-1 grows the Photomicrograph after 3 days on PDA substratum.
Fig. 4. the strange yeast of plum (Metschnikowiasp.) QHL-23-1 on PDA substratum to the inhibition of Monilinia fructicola (Moniliniafructicola).
Fig. 5. the strange yeast of plum (Metschnikowiasp.) QHL-23-1 on Peach fruits to the inhibition of peach brown rot spot.
Fig. 6. the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 metabolite on Peach fruits to the inhibition of peach brown rot spot.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Pathogenic bacteria used in following embodiment, the public from field acquisition, also can obtain from Beijing City Agriculture and Forestry Institute, to repeat the application's experiment:
Monilinia fructicola---chain sclerotinia sclerotiorum (Moniliniafructicola (wint.) Rehm) (Wang Fei etc. the occurrence and control of peach brown rot. fruit tree flowers .2012 the 5th phase p58).
The separation of embodiment 1, the strange yeast of plum (Metschnikowiasp.) QHL-23-1 and identification of strains
1, sample collecting
From Qinghai Province, gather wild fruit.
2, the separation screening of bacterial strain and antagonism screening
Isolated strains from organic fruits, conventional gradients dilution spread is adopted to be separated, cultivate under 25 DEG C of conditions respectively with PDA (composite containing streptomycin sulphate) and YPD Agar (composite containing streptomycin sulphate) 2 kinds of substratum, picking colony morphological differences is comparatively large and can the bacterial strain of pure culture, purification storage on YPD Agar substratum, and be that target pathogens carries out the primary dcreening operation of Antagonistic Fungi and repeatedly sieves again with Monilinia fructicola, finally obtain the yeast-like fungi bacterial strain that a strain bacteriostatic activity is strong, name it to be QHL-23-1.
3, the qualification of bacterial strain
Bacterial strain QHL-23-1 is carried out to the analysis of morphology, physio-biochemical characteristics and part conserved sequence.With reference to " TheYeasts, aTaxonomicStudy " (Kurtzman, C.P. (1998a) .WilliopsisZender.InTheYeasts, aTaxonomicStudy, 4thedn, pp.529-920.EditedbyC.P.Kurtzman & J.W.Fell.Amsterdam:Elsevier.) in described method carry out physiological and biochemical test and molecular biology identification.
Result shows, the morphological feature of QHL-23-1: thalline vegetative cell is avette, or subsphaeroidal, mostly is monolateral gemmation or less for polygon gemmation; On PDA and YPD Agar substratum, grow 48 hours at 20 DEG C, bacterium colony is that butteriness, oyster white are opaque, flat or circular, neat in edge, bacterium colony corrugationless, as shown in Figures 2 and 3.The physiological and biochemical property of QHL-23-1: can carry out glucose fermentation, can not carry out the fermentation of raffinose, lactose, maltose, sucrose, semi-lactosi and trehalose; Carbon assimilation aspect: glucose, semi-lactosi, sorbose, sucrose, maltose, trehalose, cellobiose, wood sugar, ribose, melizitose, ethanol, sorbitol, glycerol, N.F,USP MANNITOL, ribitol, Whitfield's ointment, glucosamine, citric acid, lactic acid, n-Hexadecane and Zulkovsky starch are positive, bacterium powder, methyl alcohol, inositol, melibiose, lactose, D-R, L-arabinose, rhamnosyl, melampyrum, erythritol, glucuronic acid are negative.The strange yeast of described plum (Metschnikowiasp.) QHL-23-1 all can normal growth in the substratum of pH4.0-5.5, and at envrionment temperature is 4 DEG C, growth potential is weak, can not grow more than 40 DEG C; Best suitable growth temperature is 16-20 DEG C, and can not grow containing on the substratum of VITAMIN, growth does not form kind of starch material.5.8SrDNA, ITS1/ITS2 gene order of bacterial strain QHL-23-1 and 26SrDNAD1/D2 gene order are as shown in SEQIDNo.1 and No.2.By carrying out gene comparison and phylogenetic analysis with the type strain not of the same race of the strange Saccharomycodes of existing plum, result shows that the 26SrDNAD1/D2 sequence of QHL-23-1 and the highest similarity of 26SrDNAD1/D2 sequence of the strange barms of known plum are 90%.According to Yeast taxonomy standard, when the 26SrDNAD1/D2 sequence of newfound yeast strain and the 26SrDNAD1/D2 sequence alignment of known barms, the highest similarity just can be decided to be a novel species lower than 97%.Phylogenetic analysis result also shows that QHL-23-1 is placed into an independent branch (see Fig. 1).Therefore, bacterial strain QHL-23-1 is a novel species.
Embodiment 2, the strange yeast of invention plum (Metschnikowiasp.) QHL-23-1 measure the inhibition of Monilinia fructicola
For examination pathogenic bacteria:
Monilinia fructicola---chain sclerotinia sclerotiorum (Moniliniafructicola (wint.) Rehm);
Select peach to adopt rear brown heart germ for instruction fungi, adopt dull and stereotyped opposite culture method.
Concrete operations are as follows: the strange yeast of plum (Metschnikowiasp.) QHL-23-1 bacterial strain 28 DEG C of constant temperature culture 48h on PDA substratum.Plant pathogenic fungi is 25 DEG C of constant temperature culture 3-4 days on PDA flat board, make from the aseptic stainless steel punch tool of colony edge diameter 0.7cm the agar block that carries disease germs; With aseptic inoculation pin picking pathogenic bacteria bacterium sheet, mycelia faces down and is inoculated in PDA plate center place, simultaneously at plum strange yeast (Metschnikowiasp.) QHL-23-1 that rules apart from all about 3.00cm place, pathogenic fungi bacterium sheet both sides aseptic inoculation ring, only to connect the flat board of pathogenic bacteria for contrast, each process repeats for three times, 25 DEG C of constant temperature culture 5-7 days, measure the antibacterial bandwidth between pathogenic fungi edge and the bacterium colony bandwidth center of the strange yeast of plum (Metschnikowiasp.) QHL-23-1.
The strange yeast of plum (Metschnikowiasp.) QHL-23-1 is more than 10mm to Monilinia fructicola antibacterial circle diameter, as shown in Figure 4.Illustrate that the strange yeast of described plum (Metschnikowiasp.) QHL-23-1 has stable, efficient anti-microbial property.
The strange yeast of embodiment 3 plum (Metschnikowiasp.) QHL-23-1 is to the suppression of the microbial canker of peach brown rot for examination
After peach is plucked, through QHL-23-1 bacterium liquid, (bacterial concentration is respectively 10
7cfu/ml, 10
8cfu/ml, 10
9cfu/ml) immersion treatment 30-60 second, then under room temperature condition, air-dry, being finally placed in temperature is 1 DEG C, and relative humidity is under 95% condition, dark storage.Preserve after 21 days, compared with control group, when bacterial concentration is 10
7cfu/ml, its preventive effect is 45%, when bacterial concentration reaches 10
8during cfu/ml, its preventive effect is 65%, when bacterial concentration reaches 10
9during cfu/ml, its preventive effect reaches 70%.
The metabolite of the strange yeast of embodiment 4 plum (Metschnikowiasp.) QHL-12-3 is to the suppression of the microbial canker of peach brown rot for examination
After peach is plucked, through QHL-12-3 metabolite immersion treatment 30-60 second, then under room temperature condition, air-dry, being finally placed in temperature is 1 DEG C, and relative humidity is under 95% condition, dark storage.Preserve after 21 days, compared with control group, its preventive effect reaches 25%.
Claims (10)
1. the strange yeast of plum, is characterized in that, the strange yeast strain of described plum is QHL-23-1, and Classification And Nomenclature is Metschnikowiasp., is numbered CGMCCNo.10461 registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
2. the strange yeast of plum according to claim 1, is characterized in that, strange saccharomycetic 5.8SrDNA, ITS1/ITS2 gene order of described plum, and 26SrDNA gene order is respectively:
5.8SrDNA, ITS1/ITS2 gene order is as follows:
GGGCTAATATATACTCACTTCTAGGATATTAAACACTAAATCTAAATCTCAATAACTATTAAAAAAAAAACAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAAAACGCAGCGAATTGCGATACGTAATATGACTTGCAAACGTGAATCATTGAATTTTTGAACGCACATTGCGCCTTAAGGTATTCCTCAAGGCATGCGTGAATGAGCGATATTTTCTCTCAAACCTCAGGGTTTGGTCCTGGCCTTTTGCCAAAATATCAACTGATTTTAAAATAAGTTTTAATCTCATCCCCCCTACTTCCTCATTTTCGTAAAACTACCCGCTGAACTTAAGCATATCAATAAGGCGGGAGGAA;
26SrDNA gene order is as follows:
ATTCGCAGCATCCTTGAGATCGCAGGCCTCGGGATGAGATGGAAGTGGTAGGACAAAGACTGTAAAGCTCCCGAGGGAGTTATATTTCTTGACTTTTTTACTTCCCCTCGCCCCGATGCTGGCCCAACACGAGGTTGTGTCTGCTTGCAAGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTGCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTTGGAGAACAGAGGGATAAGATGGATTTGGGTTCTTTACGGGGCTATCACCCTCTATGGCGTCATTTTCCAATGAACTTAAGAAGAATCCTTCAATCTCTGTTAACCTTCAAATTACAATTCCCTGAGGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGA。
3. a pathogenic bacteria inhibitor, its activeconstituents is the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1.
4. pathogenic bacteria inhibitor according to claim 3, is characterized in that, described pathogenic bacteria inhibitor adopts rear brown rot germ to peach restraining effect.
5. a disease suppression agent, its activeconstituents is the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1.
6. disease suppression agent according to claim 5, is characterized in that, described disease suppression agent adopts rear brown heart to peach restraining effect.
7. pathogenic bacteria inhibitor according to claim 3 or disease suppression agent according to claim 5, is characterized in that, described metabolite obtains from plum strange yeast QHL-23-1 fermented liquid, and concrete preparation method is:
Be seeded to YPD liquid nutrient medium by strange for the plum of preservation yeast QHL-23-1 from PDA solid slope, in 25 DEG C-30 DEG C, under 150-200rpm condition, constant-temperature shaking culture 24h-48h, obtains the fermented liquid of the strange yeast QHL-23-1 of plum; By cultured fermented liquid, be sub-packed in centrifuge tube, centrifugal 5-10min, supernatant liquor and the strange saccharomycetic metabolite of plum.
8. following arbitrary application of the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1:
1) the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1 is suppressing the application in pathogenic bacteria;
2) the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1 is suppressing the application in disease;
3) the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1 suppresses the application in pathogenic bacteria preparation in preparation;
4) the strange saccharomycetic metabolite of plum described in the strange yeast of plum described in claim 1 and/or claim 1 suppresses the application in disease preparation in preparation.
9. application according to claim 8, is characterized in that, described pathogenic bacteria is that peach adopts rear brown rot germ, and described disease is that peach adopts rear brown heart;
The concrete steps suppressing peach to adopt rear brown rot germ are: after peach is plucked, and through the metabolite immersion treatment 30-60 second of QHL-12-3 bacterium liquid or QHL-12-3, air-dry under room temperature condition, being placed in temperature is 1-4 DEG C, and relative humidity is under 95% condition, dark storage.
10. application according to claim 9, is characterized in that, it is Moniliniafructicola, Monilinialaxa or Moniliniafructigena that described peach adopts rear brown rot germ.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510513101.3A CN105349442B (en) | 2015-08-20 | 2015-08-20 | A kind of plum surprise saccharomycete and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510513101.3A CN105349442B (en) | 2015-08-20 | 2015-08-20 | A kind of plum surprise saccharomycete and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105349442A true CN105349442A (en) | 2016-02-24 |
CN105349442B CN105349442B (en) | 2019-03-15 |
Family
ID=55325507
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510513101.3A Expired - Fee Related CN105349442B (en) | 2015-08-20 | 2015-08-20 | A kind of plum surprise saccharomycete and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105349442B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107173393A (en) * | 2017-04-17 | 2017-09-19 | 山西省农业科学院农产品贮藏保鲜研究所 | Postharvest disease and somatotrophic microbial inoculum, preparation method and application before preventing and treating strawberry is adopted |
CN108077319A (en) * | 2018-01-16 | 2018-05-29 | 河北省农林科学院石家庄果树研究所 | A kind of biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing fruit tree putrefaction disease and preparation method thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6991930B1 (en) * | 2002-05-09 | 2006-01-31 | The United States Of America As Represented By The Secretary Of Agriculture | Biological control of postharvest decay of fruit using strains of Metschnikowia species |
WO2009040862A1 (en) * | 2007-09-19 | 2009-04-02 | Universita Degli Studi Di Torino | Novel strain of metschnikowia pulcherrima and uses thereof |
CN101946805A (en) * | 2010-09-28 | 2011-01-19 | 薛梦林 | Biological prevention and control bacterial agent |
CN103642705A (en) * | 2013-12-02 | 2014-03-19 | 北京市农林科学院 | Metschnikowia pulcherrima inhibiting fungi and application thereof |
-
2015
- 2015-08-20 CN CN201510513101.3A patent/CN105349442B/en not_active Expired - Fee Related
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6991930B1 (en) * | 2002-05-09 | 2006-01-31 | The United States Of America As Represented By The Secretary Of Agriculture | Biological control of postharvest decay of fruit using strains of Metschnikowia species |
WO2009040862A1 (en) * | 2007-09-19 | 2009-04-02 | Universita Degli Studi Di Torino | Novel strain of metschnikowia pulcherrima and uses thereof |
CN101946805A (en) * | 2010-09-28 | 2011-01-19 | 薛梦林 | Biological prevention and control bacterial agent |
CN103642705A (en) * | 2013-12-02 | 2014-03-19 | 北京市农林科学院 | Metschnikowia pulcherrima inhibiting fungi and application thereof |
Non-Patent Citations (2)
Title |
---|
DIANPENG ZHANG ET AL.: "Selection and evaluation of new antagonists for their efficacy against postharvest brown rot of peaches", 《POSTHARVEST BIOLOGY AND TECHNOLOGY》 * |
罗朝喜: "果树褐腐病的研究现状及其展望", 《植物病理学报》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107173393A (en) * | 2017-04-17 | 2017-09-19 | 山西省农业科学院农产品贮藏保鲜研究所 | Postharvest disease and somatotrophic microbial inoculum, preparation method and application before preventing and treating strawberry is adopted |
CN107173393B (en) * | 2017-04-17 | 2020-05-19 | 山西省农业科学院农产品贮藏保鲜研究所 | Microbial inoculum for preventing and treating diseases before and after strawberry harvest and promoting growth, preparation method and application |
CN108077319A (en) * | 2018-01-16 | 2018-05-29 | 河北省农林科学院石家庄果树研究所 | A kind of biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing fruit tree putrefaction disease and preparation method thereof |
Also Published As
Publication number | Publication date |
---|---|
CN105349442B (en) | 2019-03-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103642705B (en) | The strange yeast of plum of one strain Antifungi and application thereof | |
CN104164394A (en) | Antagonistic phytopathogen strain and application thereof | |
CN102485880A (en) | Bacillus amyloliquefaciens and application thereof | |
CN103642727A (en) | Bacillus amyloliquefaciens inhibiting fungi and application thereof | |
CN104988082B (en) | The inferior Dbaly yeast bacterial strain of one plant of Chinese and its application | |
CN112458011B (en) | Bacillus amyloliquefaciens ZJK1 and application thereof | |
CN112812971B (en) | Agrocybe aegerita symbiotic fungus M2-1, and microbial inoculum and fermentation broth extract thereof | |
CN106434445A (en) | Bacillus substilis BS01 and inoculant thereof, as well as application of bacillus substilis BS01 to inhibition of picked fruit pathogenic bacteria | |
CN107267412A (en) | Methylotrophic bacillus and its application | |
CN102827790A (en) | Bacillus subtilis strain A97, fungicide, and preparation method and application thereof | |
CN103740603B (en) | A kind of Abnormal pichia anomala and application thereof | |
CN101928688B (en) | Abamectin pesticide residue degrading bacteria and bactericide thereof | |
CN105543116B (en) | Yeast and application thereof in disease control after fresh fruit picking | |
CN105385611B (en) | A kind of plum surprise saccharomycete and its application | |
CN105349442A (en) | Metschnikowia pulcherrima and application thereof | |
CN114085788B (en) | Pseudomonas amazonensis strain and application thereof | |
CN105087428A (en) | Pseudomonas aeruginosa and application thereof | |
CN103937689B (en) | A kind of yeast-like fungus suppressing fresh fruit postharvest disease and application thereof | |
CN109182216A (en) | One plant of marine streptomyces SCFJ-05 inhibited to succulent stem rot | |
CN104593284A (en) | Walnut endophyte and use thereof | |
CN108004271A (en) | A kind of streptomycete and its application with alga-lysing activity | |
CN103710269A (en) | Coniothyrium minitans strain JN-CM for preventing and controlling stalk break | |
CN108546651B (en) | Mangrove plant Kandelia candel endophytic fungus 2cpe-1 and fermentation liquor and application thereof | |
CN107779403A (en) | A kind of biocontrol fungi epicoccum nigrum H5 and its application | |
CN107523525B (en) | Bacillus belgii and application thereof in prevention and treatment of walnut canker |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190315 Termination date: 20210820 |
|
CF01 | Termination of patent right due to non-payment of annual fee |