CN105316360A - Upland cotton transformation event ICR24110 and specific identification method thereof - Google Patents
Upland cotton transformation event ICR24110 and specific identification method thereof Download PDFInfo
- Publication number
- CN105316360A CN105316360A CN201510885738.5A CN201510885738A CN105316360A CN 105316360 A CN105316360 A CN 105316360A CN 201510885738 A CN201510885738 A CN 201510885738A CN 105316360 A CN105316360 A CN 105316360A
- Authority
- CN
- China
- Prior art keywords
- cotton
- icr24110
- transgene
- transgene cotton
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an upland cotton transformation event ICR24110 and a specific identification method thereof. According to the upland cotton transformation event disclosed by the invention, a GhKCS6 gene is over-expressed in upland cotton CCRI24 to obtain transgenic cotton ICR24110, and the transgenic cotton ICR24110 is specifically obtained by inserting an extraneous DNA fragment into a No. D13 chromosome of a target cotton genome and between the 56149325th site and the 56149356th site to replace a base sequence of 30bp between the 56149325th site and the 56149356th site of the No. D13 chromosome. Experiments prove that the transgenic cotton ICR24110 not only has longer fiber length, higher specific strength and higher evenness degree compared with those of a recipient material, but also has higher plant height, longer leaf length, wider leaf width, longer petiole length, wider petiole width, more fruit branches and the like compared with those of the recipient material, thereby laying a foundation for researching the cultivation of transgenic cotton with excellent fiber quality.
Description
Technical field
The invention belongs to biological technical field, be specifically related to upland cotton transformation event ICR24110 and specificity identification method thereof.
Background technology
Transformation event is the molecular structure be made up of at upstream and downstream flanking region and the foreign gene of genomic insertion site foreign gene.Usually, gene transformation plant can obtain a transformant colony, and this transformant colony comprises a large amount of independently event, and wherein each event is unique.The expression of foreign gene in plant is subject to the impact of the chromosome position that foreign gene inserts.This may be derived from the impact of transcriptional regulatory element near chromatin Structure or integration site.The expression level of homologous genes in different transformation event has very large difference, and the space of expressing or temporal mode also may there are differences.And the insertion of foreign gene also may affect the expression of native gene.Therefore, the impact of each separate transformation events on recipient plant is different.Obtain energy effective expression foreign gene, the Plant Transformation event simultaneously not affecting the economical character of plant own has important using value in cultivation genetically modified crops new variety.
Cotton, as natural reproducible fibrous material, is the important source material of textile industry, and plays an important role in automotive industry, medical industries etc.The staple length improving cotton is all the research emphasis in cotton field all the time, and on the one hand because cotton fiber is the longest cell that occurring in nature has found at present, it is that research cell elongation regulatory mechanism provides best experiment material; The opposing party due to cotton fiber be unicellular convexing to form, this for research cell fate determine provide convenience.In addition, macrofiber is desired by textile industry, is also required for vast cotton, and the staple length therefore improving cotton has great importance in production.
Traditional breeding method adopts hybridization to improve the fibrous quality of cotton, to be that high-quality is long stapled represent cotton to sea island cotton, also be one of four large Cultivars, but because its output cannot be equal to mutually with upland cotton, now less in global cultivated area, allotrtraploid from genomic level sea island cotton and land Cottonopolis, therebetween species hybridization can be carried out, but existing research shows that serious trait segregation has appearred in the two hybrid generation, is difficult to polymerization Yield and Its Components in Upland Cotton and Island Cotton Fiber proterties.Cotton fiber development can be divided into four interlaced periods: the initial phase (blooming first 1 day to Post flowering 2-3 days) of Fibre Development, elongate fiber phase (Post flowering 3 days to 25 days), secondary wall thicken phase (Post flowering 15 days to 45 days) and ripening stage (Post flowering 45 days to 50 days).For the fiber in rapid elongation period, elongate fiber speed can reach 2mm/ days the soonest.The length of fiber is the primary index of the quality of fiber, and the molecule mechanism of research cotton fiber development is the basis of cotton genetic improvement.
Summary of the invention
An object of the present invention is to provide a kind of method of cultivation of transgene cotton.
The method of cultivation of transgene cotton provided by the invention is for insert object cotton gene group No. D13 chromosomal 56149325-56149356 interdigit by exogenous dna fragment, replace the base sequence of No. D13 chromosomal 56149325-56149356 interdigit 30bp, obtain transgene cotton;
The fibrous quality of described transgene cotton is higher than described object cotton;
Described exogenous dna fragment is the DNA molecular containing GhKCS6 gene.
In aforesaid method,
The nucleotides sequence of described exogenous dna fragment is classified as sequence 1 in sequence table;
To be that No. D13rd, described object cotton gene group is chromosomal at the upstream flanking fragment of described transgene cotton extend to its updrift side any one DNA fragmentation that the length obtained is 0-5Kb to described exogenous dna fragment from the 56149325th Nucleotide;
To be that No. D13rd, described object cotton gene group is chromosomal at the downstream flanking fragment of described transgene cotton extend to its downstream direction any one DNA fragmentation that the length obtained is 0-5Kb to described exogenous dna fragment from the 56149356th Nucleotide.
In aforesaid method,
Described upstream flanking fragment is the Nucleotide shown in sequence in sequence table 2;
Described downstream flanking fragment is the Nucleotide shown in sequence in sequence table 3;
The fibrous quality of described transgene cotton is embodied in following B1 higher than described object cotton)-B13):
B1) length of transgene cotton fiber is higher than described object cotton;
B2) mic value of transgene cotton fiber is lower than described object cotton;
B3) reguarity of transgene cotton fiber is higher than described object cotton;
B4) specific tenacity of transgene cotton fiber is higher than described object cotton;
B5) seed cotton yield of transgene cotton fiber is higher than described object cotton;
B6) plant height of transgene cotton is higher than described object cotton;
B7) blade length of transgene cotton is higher than described object cotton;
B8) width of blade of transgene cotton is higher than described object cotton;
B9) the petiole length of transgene cotton is higher than described object cotton;
B10) the petiole width of transgene cotton is higher than described object cotton.
B11) Single boll weight of transgene cotton is higher than described object cotton;
B12) the one-tenth bell number of transgene cotton is higher than described object cotton;
B13) ginning outturn of transgene cotton is higher than described object cotton;
Described exogenous dna fragment imports described object cotton by the recombinant vectors containing described exogenous dna fragment;
Described object cotton is upland cotton.
In aforesaid method,
Described transgene cotton is transgene cotton ICR24110.
Another object of the present invention is to provide for detect or whether auxiliary detection plant sample derives from the method for above-mentioned transgene cotton ICR24110 or its offspring.
Provided by the inventionly to comprise the steps: for the method detected or whether auxiliary detection plant sample derives from above-mentioned transgene cotton ICR24110 or its offspring
Detect whether containing DNA fragmentation A in the genomic dna of described plant sample,
Described DNA fragmentation A is made up of at the upstream flanking fragment of described transgene cotton ICR24110, above-mentioned exogenous dna fragment and the above-mentioned exogenous dna fragment downstream flanking fragment at described transgene cotton ICR24110 above-mentioned exogenous dna fragment;
If the genomic dna of described plant sample contains described DNA fragmentation A, then described plant sample is or candidate is described transgene cotton ICR24110 or its offspring;
If the genomic dna of described plant sample is not containing described DNA fragmentation A, then described plant sample be or candidate is not described transgene cotton ICR24110 or its offspring.
In aforesaid method, described method is following 1) or 2) or 3):
1) direct Sequencing;
2) carry out pcr amplification with the genomic dna of primer pair 1 and/or primer pair 2 pairs of plant samples, if there is object amplified production, then described plant sample derives from described transgene cotton ICR24110 or its offspring;
Described primer pair 1 is the primer pair of DNA molecular first that the part or all of fragment of described upstream flanking sequence of holding and be close to it by described exogenous dna fragment 5 ' forms of can increasing; The object amplified production of its correspondence is described DNA molecular first;
Described primer pair 2 is the primer pair of the DNA molecular second holding and be close to the part or all of composition of its described downstream flanking sequence containing described exogenous dna fragment 3 ' of can increasing; The object amplified production of its correspondence is described DNA molecular second;
3) with the probe of DNA molecular first described in energy specific combination or its DNA molecular second, Southern hybridization is carried out to described plant sample DNA to be measured, if can hybridize and obtain hybridized fragment, then described plant sample derives from described transgene cotton ICR24110 or its offspring.
In aforesaid method,
2), in, described primer pair 1 is made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;
Described primer pair 2 is made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table.
Of the present invention also have an object to be to provide the test kit whether deriving from described transgene cotton ICR24110 or its offspring for detecting sample.
Provided by the invention for detect sample whether derive from described transgene cotton ICR24110 or its offspring test kit it comprise above-mentioned primer pair 1 and/or above-mentioned primer pair 2.
The application of above-mentioned transgene cotton ICR24110 in breeding also belongs to protection scope of the present invention.
A further object of the invention is to provide a kind of method obtaining the cotton that fibrous quality improves.
The method of the cotton that acquisition fibrous quality provided by the invention improves comprises the steps:
(1) transgene cotton is obtained according to the method described above;
(2) by described transgene cotton selfing or hybridization, obtain breeding offspring, breed offspring described in qualification according to the method described above, obtain target plant;
The deposit number of described transgene cotton is CCTCCNo.P201518.
Last object of the present invention is to provide the product of the cultivation for transgene cotton.
The product of the cultivation for transgene cotton provided by the invention is following a)-c):
A) above-mentioned upstream flanking fragment and above-mentioned downstream flanking fragment;
B) above-mentioned exogenous dna fragment;
C) relevant to above-mentioned exogenous dna fragment biomaterial;
Described biomaterial is following A 1) to A11) in any one:
A1) expression cassette containing above-mentioned exogenous dna fragment;
A2) recombinant vectors containing above-mentioned exogenous dna fragment;
A3) containing A1) recombinant vectors of described expression cassette;
A4) recombinant microorganism containing above-mentioned exogenous dna fragment;
A5) containing A1) recombinant microorganism of described expression cassette;
A6) containing A2) recombinant microorganism of described recombinant vectors;
A7) containing A3) recombinant microorganism of described recombinant vectors;
A8) the transgenic plant cells system containing above-mentioned exogenous dna fragment;
A9) containing A1) the transgenic plant cells system of described expression cassette;
A10) containing A2) the transgenic plant cells system of described recombinant vectors;
A11) containing A3) the transgenic plant cells system of described recombinant vectors;
The application of the said products in the length of regulating plant fiber and/or mic value and/or specific tenacity and/or reguarity also belongs to protection scope of the present invention.
The said products is at regulating plant plant height and/or blade length and/or width of blade and/or petiole length and/or petiole width and/or fruit branch number and/or single bell number and/or become the application in bell number and/or in ginning outturn also to belong to protection scope of the present invention.
The present invention is by GhKCS6 channel genes upland cotton CCRI24, make GhKCS6 gene process LAN in upland cotton CCRI24, obtain transgene cotton ICR24110, transgene cotton ICR24110 is for insert object cotton gene group No. D13 chromosomal 56149325-56149356 interdigit by exogenous dna fragment, replace the base sequence of No. D13 chromosomal 56149325-56149356 interdigit 30bp, the cotton obtained.Proved by test: transgene cotton ICR24110 not only the length of fiber, specific tenacity and reguarity higher than acceptor material, and plant height, blade length, width of blade, petiole length, petiole width, fruit branch number etc. are also all higher than acceptor material, lay the foundation for cultivating the research with the transgene cotton of fine fiber quality.
Accompanying drawing explanation
Fig. 1 is the graphic representation of transformation event ICR24110; [A]: 5 ' engaging zones; [B] 3 ' engaging zones; [C] corresponds to the 5 ' end of the transgenosis DNA inserted and coupled flanking genomic region; [D]: correspond to the 3 ' end of the transgenosis DNA inserted and coupled flanking genomic region; [E]: transgene expression cassette; [F]: the continuous sequence of upland cotton genomic flanking sequence and transgene expression cassette.
Fig. 2 is that the staple length of transgene cotton ICR24110 and acceptor material CCR124 compares.
Fig. 3 is that the seed cotton yield of transgene cotton ICR24110 and acceptor material CCR124 compares.
Fig. 4 is the transgene cotton ICR24110 of Post flowering different number of days and the comparing of the cotton boll of acceptor material CCR124.
Fig. 5 is that the seed cotton yield of breeding offspring and acceptor material CCR124 of transgene cotton ICR24110 compares.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Upland cotton CCRI24 in following embodiment is disclosed in document " PAG1, acottonbrassinosteroidcatabolismgene, modulatesfiberelongation ", and the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.
Agrobacterium LBA4404 in following embodiment is disclosed in document " Constitutiveexpressionofthevirulencegenesimprovestheeffi ciencyofplanttransformationbyAgrobacterium ", and the public can obtain from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.
Embodiment 1, the acquisition turning GhKCS6 cotton and Analysis of agronomic characters
One, the acquisition of GhKCS6 cotton is turned
1, the structure of recombinant vectors
Expression cassette A is inserted pCambia2300 carrier, and (this plasmid is purchased from the BioVector plasmid vector bacterium cell gene preservation center of NTCC Type Tissue Collection subordinate, article No. is: Biovectorpcambia2300) EcoRI and HindIII restriction enzyme site between, and keep other sequences of pCambia2300 carrier constant, obtain recombinant vectors (sequence 4).The nucleotide sequence of above-mentioned expression cassette A is as shown in the 2144-4175 position Nucleotide in sequence table 1.Expression cassette A comprises the promotor of the CAMV35S from cauliflower mosaic virus, GhKCS6 gene and NOS terminator successively from upstream; Wherein, the nucleotide sequence of CAMV35S promotor is as shown in the 3838-4175 position Nucleotide in sequence table 1; The nucleotide sequence of GhKCS6 gene is as shown in the 2413-3816 position Nucleotide in sequence table 1; The nucleotide sequence of NOS terminator is as shown in the 2144-2368 position Nucleotide in sequence table 1.
PCambia2300 carrier self comprises expression cassette B, and expression cassette B comprises the promotor of the CAMV35S of cauliflower mosaic virus, neomycin phosphotransferase (NPTII) and PloyA terminator successively from upstream.
2, the acquisition of recombinant bacterium
Recombinant vectors step 1 obtained imports in Agrobacterium LBA4404, obtains recombinant bacterium.
3, the acquisition of GhKCS6 cotton is turned
The recombinant bacterium adopting agriculture bacillus mediated method step 2 to be obtained transforms the explant (2000) of upland cotton CCRI24, induced synthesis callus is being cultivated containing on the substratum of sulphuric acid kanamycin, select the callus transformed, callus forms embryo callus in sulphuric acid kanamycin screening culture medium, the embryo callus subculture selecting survival transforms and forms regeneration cotton, finally obtain 80 T0 altogether for turning GhKCS6 cotton, and use it for screening.
4, the qualification of GhKCS6 cotton is turned
(1) GhKCS6 cotton seeds is turned at chamber planting to the T1 generation of results, carry out greenhouse efficiency analysis and analysis of molecules.Extract the DNA that T1 generation turns GhKCS6 cotton leaf, primer: CAGTCTCAGAAGACCAAAGGGCA and GCCACCCGAACGAAACAAACAAT is adopted to carry out pcr amplification, whether testing goal gene exists, and the segregation ratio of statistical material, according to mendel's law, in the T1 generation obtaining 21 single copies, turns GhKCS6 cotton;
(2) adopt the T1 generation of TaqmanPCR and Southernblot to 21 single copies that above-mentioned steps (1) obtains to turn GhKCS6 cotton to verify further.Concrete steps are as follows: turn in the T1 generation of flowering and boll-setting period to 21 that obtain single copies the mensuration that GhKCS6 cotton carries out GhKCS6 gene expression analysis, respectively Post flowering 0 day (same day of blooming is designated as 0 day), 5 days, 15 days, the GhKCS6 expression amount being turned to GhKCS6 cotton and acceptor material CCRI24 the T1 generation of 21 single copies is analyzed, show the T1 generation of 21 single copies turn in GhKCS6 cotton have 10 T1 generations to turn GhKCS6 cotton expression amount comparatively acceptor material CCRI24 significantly improve;
(3) measure in the wadding phase fibrous quality that 10 T1 generation that above-mentioned steps (2) obtains turns GhKCS6 cotton: result show 10 T1 generations to turn in GhKCS6 cotton cotton fiber length that 8 T1 generations turn GhKCS6 cotton comparatively acceptor material CCRI24 improve or extend.
(4) assess in the paired plot of same position in the field experiment of First Year field 8 T2 generation turn GhKCS6 cotton Agronomic character (fibrous quality, Single boll weight, ginning outturn, seed refer to, plant height, beginning are high, fruit branch number, breeding time, wherein fibrous quality comprises length, specific tenacity, mic value, elongation, reguarity) and the impact of transgenosis insertion on Developmental of Cotton, output of cotton.Result shows: 8 T2 generation turns in GhKCS6 cotton and has the Agronomic character that 2 T2 generations turn GhKCS6 cotton and be better than acceptor material CCRI24.
(5) assess in the paired plot of same position in the field experiment of Second Year field 2 T2 generations that above-mentioned steps (4) obtains turn GhKCS6 cotton Agronomic character (fibrous quality, Single boll weight, ginning outturn, seed refer to, plant height, beginning are high, fruit branch number, breeding time, wherein fibrous quality comprises length, specific tenacity, mic value, elongation, reguarity) and the impact of transgenosis insertion on Developmental of Cotton, output of cotton.Result shows: 2 T2 generation turns in GhKCS6 cotton and has the Agronomic character that 1 T2 generation turns GhKCS6 cotton and be better than acceptor material CCRI24, is turned the seed called after ICR24110 of GhKCS6 cotton this T2 generation, and on November 4th, 2015, T2 is preserved in China typical culture collection center for turning GhKCS6 cotton seeds (GossypiumhirsutumL.) ICR24110, preservation address is Wuhan, China Wuhan University, Classification And Nomenclature is cotton seeds (GossypiumhirsutumL.), and deposit number is CCTCCNO:P201518.
In T2 generation, is turned GhKCS6 cotton ICR24110 and carries out selfing, until obtain T5 generation to turn GhKCS6 cotton homozygous lines ICR24110.
Two, the Analysis of agronomic characters of GhKCS6 cotton is turned
1, fibrous quality and seed cotton yield
In T5 generation, is turned GhKCS6 cotton homozygous lines ICR24110 and acceptor material CCRI24 carries out field yield test.In Earthquake of Anyang station in Henan design plot experiment, arrange 3 communities, 3 communities arrange identical, the long 8m of cell row, often capable plantation 30 strain, and line space 80cm, 3 row planted by each material, and community is totally 6 row.Adopt Students ' test to turn the staple length of GhKCS6 cotton homozygous lines ICR24110 and acceptor material CCRI24 fiber, mic value, reguarity and specific tenacity to T5 generation and carry out statistical study.
Statistics is as table 1 and Fig. 3: compared with acceptor material CCRI24, in T5 generation, turns the staple length of GhKCS6 cotton homozygous lines ICR24110, reguarity, specific tenacity and seed cotton yield and is improved, and mic value reduces, explanation fiber attenuates, be more suitable for the needs produced, wherein, between staple length and acceptor material CCRI24 be pole salient pole work sex differernce.Fig. 2 is that the mature fibers length of transgene cotton ICR24110 and acceptor material CCR124 compares.
The fiber quality data of table 1, transgene cotton ICR24110 and acceptor material CCR124
2, otherwise impact
Because promotor is not just expressed in the fibre, its hetero-organization also can be affected, in order to study except fibres modified quality especially staple length, whether its hetero-organization of GhKCS6 gene pairs has an impact, to T5 for turning blade length, width of blade, petiole length, petiole width, plant height, the fruit branch number of GhKCS6 cotton homozygous lines ICR24110 with acceptor material CCRI24, becoming bell number, bell weight and ginning outturn to detect.
Result is as shown in table 2-table 4: as can be seen from the table, and T5 generation turns the plant height of GhKCS6 cotton homozygous lines ICR24110, blade length, width of blade, petiole length, petiole width all higher than acceptor material CCRI24.Illustrate that the plant height of expression on plant of GhKCS6 gene, blade length, width of blade, petiole length, petiole width create impact to a certain degree.The Single boll weight that T5 generation turns GhKCS6 cotton homozygous lines ICR24110 is significantly higher than acceptor material CCRI24, ginning outturn with become bell number also all higher than acceptor material CCRI24.Fig. 4 is the profile of bell turning GhKCS6 cotton homozygous lines ICR24110 and acceptor material CCRI24 in T5 generation of Post flowering different number of days.
The cotton of table 2, transgene cotton ICR24110 and the blade length of acceptor material CCR124 and wide, petiole length and width data
The cotton of table 3, transgene cotton ICR24110 and the plant height comparative data of acceptor material CCR124
The cotton of table 4, transgene cotton ICR24110 and the fruit branch number of acceptor material CCR124, become that bell number, bell are heavy, ginning outturn
Three, the phenetic analysis of the DNA sequence dna of ICR24110
Adopt the genomic inset of molecular biological methods analyst ICR24110 and genome sequence that the flank that is connected with inset is connected.Concrete steps are as follows:
1, the genome of cotton is extracted.Under greenhouse or field condition, the young tender leaf agreement that contracts a film or TV play to an actor or actress 100mg getting the cotton of ICR24110 is placed in the EP pipe of 2.0ml, adopt liquid nitrogen freezing EP pipe, then adopt the grinding of freeze grinding instrument, adopt the scheme provided in Qiagen company DNeasyPlantMiniKit (50) (article No. 69104) to extract genomic dna.The method can be improved through those skilled in the art to extract DNA from any tissue (including but not limited to seed).
2, according to the UniversalGenomeWalker of Clontech company
tM(specification sheets in Cat.No.634923 adopts 4 kinds of different restriction enzymes (DraI, EcoRV, PvuII, StuI) to carry out genomic digestion, digested overnight, obtains digestion product 2.0UserManual test kit.Adopt the built-in NucleoSpinGelandPCRClean-Upkit box of test kit to reclaim digestion product, then adopt T4DNA ligase enzyme to add the joint that test kit is built-in at recovery product two ends, so far 4 DNA library adding joint build complete.
3, according to known transgenic insertions sequence, (5 ' two nested primers held are as shown in sequence 9 and sequence 10 to design two nested primers respectively at its 5 ' end and 3 ' end, 3 ' two nested primers held are as shown in sequence 11 and sequence 12), then adopt the scheme provided in test kit to increase.Agarose gel electrophoresis is utilized to be separated the amplicon produced from reaction, use QIAGEN gel purification kit (Qiagen subsequently, Valencia, CA) purifying is carried out, the amplicons cloned of gel-purified enters in T cloning vector by the scheme provided in pMD-19T-Simple (article No.: the D104A) test kit according to the precious biological life Science and Technology Ltd. in Dalian, and in transformation of E. coli DH5 α, the flat board of ammonia benzyl resistance screens transformant, and carrying out bacterium colony PCR, positive colony carries out mono-clonal order-checking.
Sequencing result shows: transgene cotton ICR24110 is for inserting upland cotton CCRI24 genome No. D13 chromosomal 56139325-56149356 interdigit by the exogenous DNA molecule shown in sequence in sequence table 5, replace the base sequence of No. D13 chromosomal 56139325-56149356 interdigit 30bp, the transgene cotton obtained, and from the 56149325th upstream and the nucleotides sequence of upstream flanking fragment of next-door neighbour's the 56149325th Nucleotide is classified as sequence 2, from the 56149356th downstream and the nucleotides sequence of downstream flanking fragment of next-door neighbour's the 56149356th Nucleotide is classified as sequence 3 (Fig. 1).
Embodiment 2, ICR24110 breed the acquisition of characters of progenies and qualification and Analysis of agronomic characters thereof
One, ICR24110 breeds the acquisition of characters of progenies
1, hybridize
The pollen of 1 afternoon manual or artificial action removing first cotton by people before flowering, and adopt ceratuba to entangle colored column cap, prevent foreign pollen from contacting with column cap, the next morning is when the pollen loose powder of the second cotton, the pollen of the second cotton is collected by hand by people, and the style of this pollen and the first plant or column cap are contacted, namely complete crossover process.Wherein, when the first cotton is the ICR24110 in embodiment, the second cotton is other cottons, or the second cotton is ICR24110, and the first cotton is other cottons.
Results hybridization in term of opening bolls bell, and cotton is dried naturally, cotton ginning, and adopt the vitriol oil to drag suede, namely obtain cenospecies.Plantation, obtains hybrid generation, is ICR24110 and breeds offspring.
2, selfing
1 day before flowering, adopt Grafting clip directly clamp the bud of ICR24110 or adopt fine rule binding bud, when preventing from blooming, foreign pollen contacted with the column cap of ICR24110; Or by mesh bag, whole cotton plants is entangled, can effectively prevent by pollination such as insects, the self-pollination of cotton can be realized.Selfing can be completed by above-mentioned steps.
Results hybridization in term of opening bolls bell, and cotton is dried naturally, cotton ginning, and adopt the vitriol oil to drag suede, namely obtain selfed seed, plantation, obtains self progeny, is ICR24110 and breeds offspring.
Two, ICR24110 breeds qualification and the Analysis of agronomic characters thereof of characters of progenies
(1) ICR24110 breeds the authentication method of characters of progenies
The genomic dna of offspring is bred for template with ICR24110, Auele Specific Primer is adopted to carry out pcr amplification, if pcr amplification product contains the amplicon (amplicon refers to one or the one section DNA molecular adopting the synthesis of pcr amplification technology) of ICR24110, illustrate that ICR24110 breeds offspring and has the proterties identical with ICR24110, if pcr amplification product containing the amplicon of ICR24110, does not illustrate that ICR24110 breeds offspring and do not have the proterties identical with ICR24110.Concrete authentication method is as follows:
1, authentication method 1
(1) design of primer
The present embodiment designs following primers designed based on upstream flanking sequence and exogenous DNA molecule:
GSP1:TAAAAAAGTTGAACTCCTCTCTGTA (sequence 5);
GSP2:GCTCATGTGTTGAGCATATAAGAAAC (sequence 6).
(2) breed the genomic dna of offspring with ICR24110 for template, the primer adopting step (1) to design carries out pcr amplification, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTREPCRMIX10 μ l, upstream primer GSP1 (10 μMs) 0.5 μ l, downstream primer GSP1 (10 μMs) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, ultrapure water 8 μ l, cumulative volume 20 μ l.
PCR reaction conditions is as follows: 94 DEG C of 5min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations; 72 DEG C of 5min.
(3) pcr amplification product that step (2) obtains is carried out agarose gel electrophoresis, and it is checked order.If the size of pcr amplification product is 581bp, then explanation ICR24110 breeds the amplicon that offspring contains ICR24110, and ICR24110 breeds offspring and has ICR24110 proterties, otherwise does not have ICR24110 proterties.
2, authentication method 2
(1) design of primer
The present embodiment designs following primers designed based on downstream flanking sequence and exogenous DNA molecule:
GSP3:GGATCAGATTGTCGTTTCCCGCC (sequence 7);
GSP4:CAAGCCACACAGAAGAGACAAAGAAA (sequence 8).
(2) breed the genomic dna of offspring with ICR24110 for template, the primer adopting step (1) to design carries out pcr amplification, obtains pcr amplification product.
PCR amplification system is as follows: 2 × MASTREPCRMIX10 μ l, upstream primer GSP3 (10 μMs) 0.5 μ l, downstream primer GSP4 (10 μMs) 0.5 μ l, template DNA (50ng/ μ l) 1 μ l, ultrapure water 8 μ l, cumulative volume 20 μ l.
PCR reaction conditions is as follows: 94 DEG C of 5min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 45s, 32 circulations; 72 DEG C of 5min.
(3) pcr amplification product that step (2) obtains is carried out agarose gel electrophoresis, and it is checked order.If the size of pcr amplification product is 674bp, then explanation ICR24110 breeds the amplicon that offspring contains ICR24110, and ICR24110 breeds offspring and has ICR24110 proterties, otherwise does not have ICR24110 proterties.
(2) ICR24110 breeds the Analysis of agronomic characters of characters of progenies
Fibrous quality and the seed cotton yield that the ICR24110 with ICR24110 amplicon obtained in above-mentioned steps () breeds offspring (ICR24110) and acceptor material CCRI24 is detected according to the method in the step 2 in embodiment 1.
1, ICR24110 breeds the seed cotton yield of characters of progenies
ICR24110 breeds the detected result of the seed cotton yield of offspring (ICR24110) as shown in Figure 5: as can be seen from the figure, compared with the seed cotton yield of acceptor material CCRI24, the seed cotton yield that ICR24110 breeds offspring (ICR24110) improves 116.47%, illustrates that ICR24110 breeds offspring (ICR24110) and has high seed cotton yield.
2, ICR24110 breeds the fibrous quality of characters of progenies
The detected result that ICR24110 breeds the seed cotton yield of offspring (ICR24110) is as shown in table 5: as can be seen from the table, compared with acceptor material CCRI24, ICR24110 breeds the staple length of offspring (ICR24110), specific tenacity and mic value and all increases, and illustrates that the cotton fiber quality that ICR24110 breeds offspring (ICR24110) increases.
Table 5, ICR24110 breed the detected result of the fibrous quality of offspring (ICR24110)
Therefore can to detect as follows or whether auxiliary detection plant sample derives from transgene cotton ICR24110 or its offspring:
Carry out pcr amplification with the genomic dna of primer pair 1 or primer pair 2 pairs of plant samples, obtain pcr amplification product, detect whether containing DNA fragmentation A in pcr amplification product,
If containing DNA fragmentation A, then plant sample is or candidate is transgene cotton ICR24110 or its offspring;
If not containing DNA fragmentation A, then plant sample be or candidate is not transgene cotton ICR24110 or its offspring.
Primer pair 1 is made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;
Primer pair 2 is made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table;
DNA fragmentation A is made up of upstream flanking fragment (sequence 2), exogenous dna fragment (sequence 1) and downstream flanking fragment (sequence 3).
Claims (10)
1. the method for cultivation of a transgene cotton, for exogenous dna fragment being inserted object cotton gene group No. D13 chromosomal 56149325-56149356 interdigit, replace the base sequence of No. D13 chromosomal 56149325-56149356 interdigit 30bp, obtain transgene cotton;
The fibrous quality of described transgene cotton is higher than described object cotton;
Described exogenous dna fragment is the DNA molecular containing GhKCS6 gene.
2. method according to claim 1, is characterized in that:
The nucleotides sequence of described exogenous dna fragment is classified as sequence 1 in sequence table;
To be that No. D13rd, described object cotton gene group is chromosomal at the upstream flanking fragment of described transgene cotton extend to its updrift side any one DNA fragmentation that the length obtained is 0-5Kb to described exogenous dna fragment from the 56149325th Nucleotide;
To be that No. D13rd, described object cotton gene group is chromosomal at the downstream flanking fragment of described transgene cotton extend to its downstream direction any one DNA fragmentation that the length obtained is 0-5Kb to described exogenous dna fragment from the 56149356th Nucleotide.
3. method according to claim 1 or 2, is characterized in that:
Described upstream flanking fragment is the Nucleotide shown in sequence in sequence table 2;
Described downstream flanking fragment is the Nucleotide shown in sequence in sequence table 3;
The fibrous quality of described transgene cotton is embodied in following B1 higher than described object cotton)-B13):
B1) length of transgene cotton fiber is higher than described object cotton;
B2) mic value of transgene cotton fiber is lower than described object cotton;
B3) reguarity of transgene cotton fiber is higher than described object cotton;
B4) specific tenacity of transgene cotton fiber is higher than described object cotton;
B5) seed cotton yield of transgene cotton fiber is higher than described object cotton;
B6) plant height of transgene cotton is higher than described object cotton;
B7) blade length of transgene cotton is higher than described object cotton;
B8) width of blade of transgene cotton is higher than described object cotton;
B9) the petiole length of transgene cotton is higher than described object cotton;
B10) the petiole width of transgene cotton is higher than described object cotton.
B11) Single boll weight of transgene cotton is higher than described object cotton;
B12) the one-tenth bell number of transgene cotton is higher than described object cotton;
B13) ginning outturn of transgene cotton is higher than described object cotton;
Described exogenous dna fragment imports described object cotton by the recombinant vectors containing described exogenous dna fragment;
Described object cotton is upland cotton.
4. according to described method arbitrary in claim 1-3, it is characterized in that: described transgene cotton is transgene cotton ICR24110.
5., for detect or whether auxiliary detection plant sample derives from the method for the ICR24110 of transgene cotton described in claim 4 or its offspring, comprise the steps:
Detect whether containing DNA fragmentation A in the genomic dna of described plant sample,
Described DNA fragmentation A is made up of at the downstream flanking fragment of described transgene cotton ICR24110 the described exogenous dna fragment of the described exogenous dna fragment in claim 2 in the upstream flanking fragment, claim 2 of described transgene cotton ICR24110 and the described exogenous dna fragment in claim 2;
If the genomic dna of described plant sample contains described DNA fragmentation A, then described plant sample is or candidate is described transgene cotton ICR24110 or its offspring;
If the genomic dna of described plant sample is not containing described DNA fragmentation A, then described plant sample be or candidate is not described transgene cotton ICR24110 or its offspring.
6. method according to claim 5, is characterized in that:
Described method is following 1) or 2) or 3):
1) direct Sequencing;
2) carry out pcr amplification with the genomic dna of primer pair 1 and/or primer pair 2 pairs of plant samples, if there is object amplified production, then described plant sample derives from described transgene cotton ICR24110 or its offspring;
Described primer pair 1 is the primer pair of DNA molecular first that the part or all of fragment of described upstream flanking sequence of holding and be close to it by described exogenous dna fragment 5 ' forms of can increasing; The object amplified production of its correspondence is described DNA molecular first;
Described primer pair 2 is the primer pair of the DNA molecular second holding and be close to the part or all of composition of its described downstream flanking sequence containing described exogenous dna fragment 3 ' of can increasing; The object amplified production of its correspondence is described DNA molecular second;
Described primer pair 1 is specifically made up of the single strand dna shown in sequence 6 in the single strand dna shown in sequence in sequence table 5 and sequence table;
Described primer pair 2 is specifically made up of the single strand dna shown in sequence 8 in the single strand dna shown in sequence in sequence table 7 and sequence table;
3) with the probe of DNA molecular first described in energy specific combination or its DNA molecular second, Southern hybridization is carried out to described plant sample DNA to be measured, if can hybridize and obtain hybridized fragment, then described plant sample derives from described transgene cotton ICR24110 or its offspring.
7. whether derive from the test kit of described transgene cotton ICR24110 or its offspring for detecting sample, it comprises: the described primer pair 1 in claim 6 and/or the described primer pair 2 in claim 6.
8. the application of transgene cotton ICR24110 in breeding described in claim 4.
9. obtain a method for the cotton that fibrous quality improves, comprise the steps:
(1) transgene cotton is obtained according to described method arbitrary in claim 1-4;
(2) by described transgene cotton selfing or hybridization, obtain breeding offspring, described in the method qualification described in claim 5 or 6, breed offspring, obtain target plant;
The deposit number of described transgene cotton is CCTCCNo.P201518.
10., for the product of the cultivation of transgene cotton, it is following a)-c):
A) the upstream flanking fragment described in claim 2 and the downstream flanking fragment described in claim 2;
B) exogenous dna fragment described in claim 2;
C) relevant to the exogenous dna fragment described in claim 2 biomaterial;
Described biomaterial is following A 1) to A11) in any one:
A1) expression cassette containing the described exogenous dna fragment in claim 2;
A2) recombinant vectors containing the described exogenous dna fragment in claim 2;
A3) containing A1) recombinant vectors of described expression cassette;
A4) recombinant microorganism containing the described exogenous dna fragment in claim 2;
A5) containing A1) recombinant microorganism of described expression cassette;
A6) containing A2) recombinant microorganism of described recombinant vectors;
A7) containing A3) recombinant microorganism of described recombinant vectors;
A8) the transgenic plant cells system containing the described exogenous dna fragment in claim 2;
A9) containing A1) the transgenic plant cells system of described expression cassette;
A10) containing A2) the transgenic plant cells system of described recombinant vectors;
A11) containing A3) the transgenic plant cells system of described recombinant vectors;
Or, the application of the said products in the length of regulating plant fiber and/or mic value and/or specific tenacity and/or reguarity;
Or the said products is at regulating plant plant height and/or blade length and/or width of blade and/or petiole length and/or petiole width and/or fruit branch number and/or single bell number and/or become application in bell number and/or in ginning outturn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510885738.5A CN105316360B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event ICR24110 and its specificity identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510885738.5A CN105316360B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event ICR24110 and its specificity identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105316360A true CN105316360A (en) | 2016-02-10 |
| CN105316360B CN105316360B (en) | 2019-04-30 |
Family
ID=55244678
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510885738.5A Expired - Fee Related CN105316360B (en) | 2015-12-03 | 2015-12-03 | Upland cotton transformation event ICR24110 and its specificity identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105316360B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007009181A1 (en) * | 2005-07-20 | 2007-01-25 | Agriculture Victoria Services Pty Ltd | Modification of flavonoid biosynthesis in plants |
| CN101962658A (en) * | 2010-10-21 | 2011-02-02 | 中国农业大学 | High-efficiency transgenic cotton expression vector and application thereof |
-
2015
- 2015-12-03 CN CN201510885738.5A patent/CN105316360B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007009181A1 (en) * | 2005-07-20 | 2007-01-25 | Agriculture Victoria Services Pty Ltd | Modification of flavonoid biosynthesis in plants |
| CN101962658A (en) * | 2010-10-21 | 2011-02-02 | 中国农业大学 | High-efficiency transgenic cotton expression vector and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| QIN YM ET AL: "How cotton fibers elongate :a tale of linear cell-growth mode", 《CURR OPIN PLANT BIOL》 * |
| ZHU,Y.X ET AL: "Genbank：EF688566.1", 《GENBANK》 * |
| 杜雪琼: "棉花纤维发育相关基因GhKcs13的克隆与功能验证", 《中国优秀硕士论文全文数据库》 * |
| 郭琪: "两个棉花逆境相关锌指蛋白基因的转基因材料创制", 《中国优秀硕士论文全文数据库》 * |
| 钱玉源: "超长链脂肪酸合成相关基因的转基因功能验证", 《中国优秀硕士学位论文全文数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105316360B (en) | 2019-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191107A (en) | A kind of molecular improvement method reducing rice grain seed holding | |
| CN103993018B (en) | Control Plant Height of Rice, improve lodging tolerance, increase available tillering and the gene of yield and application thereof | |
| WO2020248971A1 (en) | Maize gene zmravl1 and functional site and use thereof | |
| CN103183732B (en) | Cotton Gh FPP1 protein as well as coding gene and application thereof | |
| WO2020108032A1 (en) | Upland cotton transformation event icr24-397 and specificity identification method therefor | |
| WO2020156367A1 (en) | Method for improving oryza sativa yield and/or blast resistance and protein used thereby | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN101812451B (en) | Rice glume development gene promoter p-TRI1 and application thereof | |
| CN106191104B (en) | Upland cotton transformation event ICR24001 and its specificity identification method | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN105368868B (en) | Upland cotton transformation event LF-ICR22 and its specificity identification method | |
| CN105368869B (en) | Upland cotton transformation event ICR201501 and its specificity identification method | |
| CN108795944A (en) | Cotton long-chain non-coding RNA-lnc973 and its application in plant salt endurance | |
| CN108715854A (en) | Applications of the cotton AINTEGUMENTA genes GhANT in cotton breeding | |
| CN111518181B (en) | Method for increasing rice yield and protein used by same | |
| CN105316360B (en) | Upland cotton transformation event ICR24110 and its specificity identification method | |
| CN104341494A (en) | Protein ZmWAK with high resistance of sporisorium reilianum, as well as coding gene and application of protein ZmWAK | |
| BR112014022649B1 (en) | METHODS OF PRODUCTION OF A TRANSGENIC PLANT, METHODS OF IDENTIFICATION OF A WEAK ALLELE OF FEA3, METHODS OF PRODUCTION OF A PLANT AND METHOD OF IDENTIFICATION OF A FIRST CORN PLANT | |
| US8039687B2 (en) | Method for screening genomic DNA fragments | |
| CN117285610A (en) | Parthenogenesis haploid induction gene NtDMP and application thereof | |
| WO2020107816A1 (en) | Upland cotton transformation event 18c006-10-13 and specific identification method therefor | |
| CN102367452B (en) | Method for cultivating disease-resistant PgPGIP1 transgenic wheat | |
| CN105132428A (en) | ZmLRT gene related to plant root system characters as well as relevant biological material and application thereof | |
| CN114134155B (en) | MLO gene mutant and preparation method and application thereof | |
| CN117660523B (en) | Application of GhTSD7 gene in improving drought stress tolerance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190430 Termination date: 20211203 |