CN105296634B - For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility - Google Patents
For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility Download PDFInfo
- Publication number
- CN105296634B CN105296634B CN201510755090.XA CN201510755090A CN105296634B CN 105296634 B CN105296634 B CN 105296634B CN 201510755090 A CN201510755090 A CN 201510755090A CN 105296634 B CN105296634 B CN 105296634B
- Authority
- CN
- China
- Prior art keywords
- gene
- tubb8
- seq
- kit
- ovum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 208000000509 infertility Diseases 0.000 title claims abstract description 21
- 230000036512 infertility Effects 0.000 title claims abstract description 21
- 231100000535 infertility Toxicity 0.000 title claims abstract description 19
- 108090000623 proteins and genes Proteins 0.000 title abstract description 19
- 101150073866 TUBB8 gene Proteins 0.000 claims abstract description 23
- 238000001514 detection method Methods 0.000 claims abstract description 12
- 101000891612 Homo sapiens Tubulin beta-8 chain Proteins 0.000 claims description 13
- 102100040237 Tubulin beta-8 chain Human genes 0.000 claims description 13
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 108010000912 Egg Proteins Proteins 0.000 abstract description 16
- 210000004681 ovum Anatomy 0.000 abstract description 16
- 102000002322 Egg Proteins Human genes 0.000 abstract description 15
- 230000035772 mutation Effects 0.000 abstract description 7
- 238000012216 screening Methods 0.000 abstract description 5
- 108091022875 Microtubule Proteins 0.000 abstract description 2
- 102000029749 Microtubule Human genes 0.000 abstract 1
- 239000003550 marker Substances 0.000 abstract 1
- 238000011017 operating method Methods 0.000 abstract 1
- 108020004414 DNA Proteins 0.000 description 13
- 238000000034 method Methods 0.000 description 12
- 206010064571 Gene mutation Diseases 0.000 description 9
- 201000010099 disease Diseases 0.000 description 7
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 7
- 238000012163 sequencing technique Methods 0.000 description 7
- 230000000869 mutational effect Effects 0.000 description 5
- 208000007984 Female Infertility Diseases 0.000 description 4
- 206010021928 Infertility female Diseases 0.000 description 4
- 208000021267 infertility disease Diseases 0.000 description 4
- 230000003321 amplification Effects 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 150000007523 nucleic acids Chemical group 0.000 description 3
- 239000011541 reaction mixture Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 2
- 108700024394 Exon Proteins 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 102000004243 Tubulin Human genes 0.000 description 2
- 108090000704 Tubulin Proteins 0.000 description 2
- 210000004369 blood Anatomy 0.000 description 2
- 239000008280 blood Substances 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 230000035558 fertility Effects 0.000 description 2
- 230000004927 fusion Effects 0.000 description 2
- 238000000338 in vitro Methods 0.000 description 2
- 238000007689 inspection Methods 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 210000005259 peripheral blood Anatomy 0.000 description 2
- 239000011886 peripheral blood Substances 0.000 description 2
- 230000001850 reproductive effect Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000012224 working solution Substances 0.000 description 2
- 238000001712 DNA sequencing Methods 0.000 description 1
- 102100027627 Follicle-stimulating hormone receptor Human genes 0.000 description 1
- 101000862396 Homo sapiens Follicle-stimulating hormone receptor Proteins 0.000 description 1
- 206010058359 Hypogonadism Diseases 0.000 description 1
- 206010021929 Infertility male Diseases 0.000 description 1
- 102000008238 LHRH Receptors Human genes 0.000 description 1
- 108010021290 LHRH Receptors Proteins 0.000 description 1
- 208000007466 Male Infertility Diseases 0.000 description 1
- 208000002500 Primary Ovarian Insufficiency Diseases 0.000 description 1
- 101150022118 Stag3 gene Proteins 0.000 description 1
- 210000002593 Y chromosome Anatomy 0.000 description 1
- 230000000692 anti-sense effect Effects 0.000 description 1
- 101150045446 azf gene Proteins 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 238000003759 clinical diagnosis Methods 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000002651 drug therapy Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000004720 fertilization Effects 0.000 description 1
- 239000003163 gonadal steroid hormone Substances 0.000 description 1
- 201000003368 hypogonadotropic hypogonadism Diseases 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 210000000287 oocyte Anatomy 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000002611 ovarian Effects 0.000 description 1
- 210000004508 polar body Anatomy 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 230000035935 pregnancy Effects 0.000 description 1
- 206010036601 premature menopause Diseases 0.000 description 1
- 208000017942 premature ovarian failure 1 Diseases 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 208000020016 psychiatric disease Diseases 0.000 description 1
- 210000000582 semen Anatomy 0.000 description 1
- 238000002054 transplantation Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of gene detection, particularly for the VIII type-microtubule protein gene and kit of detection women primary infertility.Mankind's microtubule protein gene-VIII type-microtubule protein gene of the present invention: TUBB8 gene, when its mutation are the reason of leading to cause female acyesis immature because of ovum.Mutation by detecting TUBB8 gene can be used as the marker gene for judging that female acyesis is caused because ovum is immature.It can be used for evaluating or preparing the kit for screening that female acyesis is caused because ovum is immature using TUBB8 gene provided by the invention.The operating method that can be used for when clinical respective patient being instructed to carry out test-tube baby's art using TUBB8 gene provided by the invention;It can be used for evaluating or preparing the kit for screening of IVF/ICSI validity using TUBB8 gene provided by the invention.
Description
Technical field
The invention belongs to technical field of gene detection, and in particular to a kind of for detecting the VIII type-of women primary infertility
Microtubule protein gene and kit.VIII type-microtubule protein gene mutation is the reason of leading to women primary infertility.Pass through inspection
It surveys whether this gene mutates, can be used to that infertility is diagnosed and judged, and to the subsequent carry out test-tube baby of patient, choosing
The method or final result for selecting IVF/ICSI are instructed.
Background technique
Normal pregnancy and reproduction are to maintain and continue the important link of human population.In clinic, the micro-deleted inspection of AZF gene
Survey has been widely used in the diagnosis of male sterility patient (Pryor JL et al, Microdeletions in the Y
chromosome of infertile men. N Engl J Med. 1997 Feb 20;336(8);534-9).In research side
, there has been a ZP-1 in face at present, the genes such as Stag3, FSHR be found with female infertility it is closely related (Huang HL et al,
Mutant ZP1 in familial infertility. N Engl J Med. 2014 370(13):1220-6;de Roux
N et al, A family with hypogonadotropic hypogonadism and mutations in the
gonadotropin-releasing hormone receptor. N Engl J Med. 1997 337(22):1597-602;
Caburet S et al, Mutant cohesion in premature ovarian failure. N Engl J
Med.2014 370 (10): 943-9).But it is not applied in clinic.
There are many reason of leading to female infertility, have some clinical reports to be related to women characterized by ovum is immature not
Description (Rudak et al, fertility the and sterility, 1990 54:292-296 of pregnant disease;Human
Reproduction,1995 10:2343-2349; fertility and sterility 1999 71:567-570;Human
Reproduction 2001 16(10):2136-2138;Human Reproduction 2002 17(6):1604-1609;
Human Reproduction 2,002 17 (10): 2556-2559).These patients are by being repeated insemination-transplantation of embryo
(test-tube baby) because failing to get mature egg cell, and is unable to complete successful inseminatio externalis operation.If phase can be found
Disease-causing gene is closed, then is all of great significance to disease clinical diagnosis and parting.But does not have also led so that ovum is immature at present
The gene of the female infertility of cause is found.
VIII type-microtubule protein gene (Tubulin, beta 8 class VIII, TUBB8) belongs to coding tubulin
One of 9 members of family.Other genes of tubulin family, which have been found in Nervous and mental diseases, plays important work
With.But VIII type-microtubule protein gene function and unknown so far with the relationship of female acyesis.
It finds by prior art documents, any report that so far there are no about TUBB8 gene.Also it is not found
Report relevant to female infertility.
Summary of the invention
The purpose of the present invention is to provide a kind of easy to operate, definite effect for detecting the VIII of women primary infertility
Type-microtubule protein gene and the kit for detecting the gene mutation.
Provided by the present invention for detecting VIII type-microtubule protein gene (TUBB8) nucleic acid sequence of women primary infertility
Column are as shown in SEQ ID NO.1.
It is exactly by detection TUBB8 gene the present invention relates to the method that screening causes primary infertility because ovum is immature
Whether mutation judges whether patient is primary infertility caused by ovum is immature.It is extracted from the peripheral blood of patient
After DNA, with PCR(polymerase chain reaction) method combination DNA sequencing, to detect whether TUBB8 gene is mutated.
The present invention relates to the primers whether detection TUBB8 gene mutates.
The method whether detection TUBB8 gene mutates is as follows: there are four exons by TUBB8.It is aobvious to wherein 1-3 extra
Son utilizes primer pair:
5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),
5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),
Carry out PCR amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 57 DEG C 1 minute, 72 DEG C of 3 seconds (this three steps
Repeat 35 circulation), 72 DEG C 10 minutes), be then sequenced using identical primer, the standard sequence with TUBB8 in UCSC
Column (SEQ ID NO.1) are compared, to find to be mutated;
To wherein the 4th exon, primer pair is utilized:
5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),
5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),
Carry out PCR amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 61 DEG C 1 minute, 72 DEG C of 3 seconds (this three steps
Repeat 35 circulation), 72 DEG C 10 minutes;Then primer pair is utilized:
5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),
5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),
It is sequenced, then is compared with the standard sequence (SEQ ID NO.1) of TUBB8 in UCSC, to find to be mutated.
It is sequenced by PCR and a generation, and the comparison with standard sequence, to detect whether TUBB8 gene mutates.
The present invention also provides a kind of immature kit for screening for causing primary infertility of detection ovum.This kit can refer to
Guiding doctor gives birth to the judgement of the disease cause of disease, is correctly classified to disease, to inform that patient is carried out using IVF method or ICSI method
Test-tube baby's operation, and if appropriate for continuing to implement IVF-ET cycle art (IVF) or intracytoplasmic sperm injection art (ICSI)
(test-tube baby).
Kit provided by the invention, the amplimer and sequencing primer of the 1-4 exon including above-mentioned amplification TUBB8
(SEQ ID NO.2-SEQ ID NO.7) and reaction mixture;Reaction mixture includes archaeal dna polymerase, dNTP and buffer;
Specifically used method are as follows: primer is diluted with water as the working solution of 10uM concentration.Reaction system is 10ul, wherein
The water of 1ul sample DNA, 0.5ul forward primer, 0.5ul reverse primer, 5ul reaction mixture and 3ul form.After mixing, press
Above-mentioned condition carries out PCR reaction, then carries out generation sequencing.
The present invention also provides for studying the immature gene repair target site for causing primary infertility of drug therapy ovum (i.e.
It is actually detected go out patient mutational site, for example 7 mutational sites are listed in table 1, during actually detected, by with
Standard sequence compares, and may have new mutational site), and by the reparation to target site, so that TUBB8 can go
Make normal function, and then can treat such disease.
The present invention can also pass through the mutation of detection TUBB8 gene, the clinical patient with this gene mutation of guidance, Ying Caiyong
Which kind of operation method (IVF or ICSI) carries out test-tube baby's art.In routine clinical, when Mr. and Mrs are desired with test-tube baby, if
The bridegroom's or husband's side is not that seriously few weak essence, the method for generally using IVF first carry out test-tube baby's art.But if patient passes through detection
It is found to have the mutation of TUBB8, then should directly adopt ICSI to this patient carries out test-tube baby's art.Because prominent with this
The ovum of the patient of change is jejune, so ICSI method should be used, carries out In-vitro maturation trial to the ovum of acquisition,
Without IVF should be used.
Detailed description of the invention
Fig. 1 is that patient sports the displaying of the distribution in TUBB8 structure.
Specific embodiment
Below in conjunction with specific embodiment, to further illustrate the present invention.It should be understood that following embodiment is merely to illustrate this hair
It is bright rather than limit the scope of the invention.
Embodiment 1: the collection of sample and the extracting of peripheral blood DNA
The immature cause primary infertility patient of ovum is from the attached red house hospital Shang Haiji of Chinese Shanghai Fudan University
Love heredity and sterile diagnosis and treatment center, the attached 9th the People's Hospital's reproductive center of Chinese Shanghai university of communications.Diagnostic criteria is by Rudak
E et al. (Rudak E., DorJ., KimchiM., Goldman B., Levran D and Mashiach S, Anomalies
of human oocytes from infertile women undergoing treatment by in vitro
fertilization. FertilSteril. 1990 Aug;54 (2): 292-6) it proposes.Bridegroom's or husband's side semen efamination is normal, the wife's side
Patient female reproductive organ, ovarian function, sex hormone are normal, and 2 times or more decorporation periods get 5 or more ovums every time,
There is not visible first polar body form.The research of this project is participated under the premise of informed consent, acquires blood, and sign and know together
Meaning book.All patients in group pass through medical history and exclude other Procreation models.The control crowd of this experiment is 1000 lifes
Normally functioning women is educated, sample blood 300ul is taken, DNA is extracted by kit specification, is detected with UV detector
DNA concentration and purity.
Embodiment 2: the mutation of detection TUBB8 gene
The present invention combines the searching of sequencing progress TUBB8 gene mutation using PCR.Its principle is first to TUBB8 gene
Four exons carry out design of primers (can specifically give primer sequence) and expand, and carry out the searching of TUBB8 gene mutation.(i.e.
By DNA sample with react working solution (archaeal dna polymerase, dNTP, water and buffer) mix after mix, expanded according to PCR program
Increase.Products therefrom is sequenced in ABI3730 sequencing by purifying and further sequencing reaction.Interpretation of result passes through HLA
Fusion software (One lambda, CA, USA, HLA Fusion 3.0) carries out.Expand the PCR primer of 1-3 exon
Are as follows:
5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2)
5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3)
Sequencing primer is identical as PCR primer;
Expand the PCR primer of the 4th exon are as follows:
5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4)
5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5)
Sequencing primer are as follows:
5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6)
5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7).
Embodiment 3:TUBB8 gene mutation with because ovum is immature cause primary infertility
As a result: it is immature and cause primary infertility patient 7 that we collected TUBB8 gene mutation institute reason ovum altogether.Phase
Mutational site information is answered to see the table below (table 1).Distribution of the mutational site in structure is as shown in Figure 1.
1 patient's TUBB8 gene mutation information of table
In conclusion of the invention has following important practical usage:
(1) it can use label of the TUBB8 gene proposed by the present invention as prediction because of the immature cause female acyesis of ovum
Gene;
(2) it can be used for evaluating or preparing using TUBB8 gene provided by the invention and cause female acyesis because ovum is immature
Kit for screening;
(3) can be used for instructing the clinical patient with this gene mutation, Ying Caiyong using TUBB8 gene provided by the invention
Which kind of operation method (IVF or ICSI) carries out test-tube baby's art.
The SEQ ID NO.1:
(a) sequence signature:
Length: 1335 base-pairs
Type: nucleic acid
Chain: double-strand
Topological structure: linear
(b) molecule type: cDNA
(c) assume: no
(d) antisense: no
(e) initial source: people
(f) SEQ ID NO.1 nucleic acid sequence is as follows:
ATGAGGGAGATCGTGCTCACGCAGATCGGGCAGTGCGGGAATCAGATCGGCGCCAAGTTCTGGGAGGTG
ATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGACAGCCACCTGCAGCTGGAGCGCATCAACGT
GTACTACAACGAGGCCAGCGGTGGCAGGTACGTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACT
CTGTGCGCTCGGGGCCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAACAAC
TGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTTGTCAGAAAGGAGGCTGAGAG
CTGTGACTGCCTGCAGGGTTTCC
AGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGG
AGGAGTACCCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCC
TACAACGCCACCCTCTCAGTCCACCAGCTCATAGAAAACGCAGATGAGACCTTTTGCATAGATAACGAAGCTCTGTA
TGACATATGTTCCAAGACCCTAAAACTGCCCACACCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGA
GTGGGGTCACCACGTGCCTGCGCTTCCCGGGCCAGCTGAATGCTGACCTGCGGAAGCTGGCCGTGAACATGGTCCCG
TTTCCCCGGCTGCATTTCTTCAT
GCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCCTTGACTGTGGCTGAGCTTAC
CCAGCAGATGTTTGATGCTAAGAACATGATGGCTGCCTGTGACCCCCGTCACGGCCGCTACCTAACGGCGGCTGCCA
TTTTCAGGGGTCGCATGCCCATGAGGGAGGTGGATGAACAAATGTTCAACATTCAAGATAAGAACAGCAGTTACTTT
GCTGACTGGCTCCCCAACAACGTAAAAACAGCCGTCTGTGACATCCCACCCCGGGGGCTAAAAATGTCAGCCACCTT
CATTGGGAATAATACGGCCATCCAGGAACTCTTCAAGCGTGTCTCAGAGCAGTTTACAGCAATGTTCAGGCGCAAGG
CCTTCCTCCACTGGTACACGGGC
GAGGGCATGGATGAGATGGAATTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCTGAATATCAG
CAATATCAGGATGCCACGGCCGAGGAGGAGGAGGATGAGGAGTATGCCGAGGAGGAGGTGGCCTAG
SEQUENCE LISTING
<110>Fudan University
<120>for detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility
<130> 001
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 1335
<212> DNA
<213>
<400> 1
atgagggaga tcgtgctcac gcagatcggg cagtgcggga atcagatcgg cgccaagttc 60
tgggaggtga tctctgatga acatgccatc gactccgctg gcacctacca cggggacagc 120
cacctgcagc tggagcgcat caacgtgtac tacaacgagg ccagcggtgg caggtacgtg 180
ccccgcgctg tgctcgtgga tctggagccg ggcaccatgg actctgtgcg ctcggggccc 240
ttcgggcagg tcttcaggcc agacaacttc atcttcggtc agtgtggggc cggaaacaac 300
tgggccaagg gacactacac cgaaggcgcg gagctgatgg agtcagtgat ggacgttgtc 360
agaaaggagg ctgagagctg tgactgcctg cagggtttcc agctgaccca ctccctgggt 420
ggggggactg ggtctgggat gggtaccctt ctgctcagta agatccggga ggagtaccca 480
gacaggatca taaacacatt cagcatcctg ccctcgccca aggtgtcgga caccgtggtg 540
gagccctaca acgccaccct ctcagtccac cagctcatag aaaacgcaga tgagaccttt 600
tgcatagata acgaagctct gtatgacata tgttccaaga ccctaaaact gcccacaccc 660
acctatggtg acctgaacca cctggtgtct gctaccatga gtggggtcac cacgtgcctg 720
cgcttcccgg gccagctgaa tgctgacctg cggaagctgg ccgtgaacat ggtcccgttt 780
ccccggctgc atttcttcat gcccggcttt gccccactga ccagccgggg cagccagcag 840
taccgggcct tgactgtggc tgagcttacc cagcagatgt ttgatgctaa gaacatgatg 900
gctgcctgtg acccccgtca cggccgctac ctaacggcgg ctgccatttt caggggtcgc 960
atgcccatga gggaggtgga tgaacaaatg ttcaacattc aagataagaa cagcagttac 1020
tttgctgact ggctccccaa caacgtaaaa acagccgtct gtgacatccc accccggggg 1080
ctaaaaatgt cagccacctt cattgggaat aatacggcca tccaggaact cttcaagcgt 1140
gtctcagagc agtttacagc aatgttcagg cgcaaggcct tcctccactg gtacacgggc 1200
gagggcatgg atgagatgga attcaccgag gccgagagca acatgaacga cctggtgtct 1260
gaatatcagc aatatcagga tgccacggcc gaggaggagg aggatgagga gtatgccgag 1320
gaggaggtgg cctag 1335
<210> 2
<211> 24
<212> DNA
<213>
<400> 2
agttcccaga ggatgacctt agca 24
<210> 3
<211> 22
<212> DNA
<213>
<400> 3
gctatttaaa cgttggcgga gg 22
<210> 4
<211> 20
<212> DNA
<213>
<400> 4
accaggagac catcacacag 20
<210> 5
<211> 20
<212> DNA
<213>
<400> 5
cgctcaatct gcctctccta 20
<210> 6
<211> 20
<212> DNA
<213>
<400> 6
aacgcagcag gagatgtgaa 20
<210> 7
<211> 20
<212> DNA
<213>
<400> 7
ccctgcaaga acctgagctg 20
Claims (1)
1. the primer pair whether detection TUBB8 gene mutates is used to prepare the purposes of detection women primary infertility kit,
It is characterized in that, the primer pair is for example following:
5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),
5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),
5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),
5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),
5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),
5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),
When being used for women primary infertility:
TUBB8 utilizes primer pair to wherein 1-3 exon there are four exon:
5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),
5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),
PCR amplification is carried out, is then sequenced using identical primer, the standard sequence SEQ ID NO.1 with TUBB8 in UCSC
It is compared, to find to be mutated;
To wherein the 4th exon, primer pair is utilized:
5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),
5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),
Carry out PCR amplification;Then primer pair is utilized:
5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),
5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),
It is sequenced, then is compared with the standard sequence SEQ ID NO.1 of TUBB8 in UCSC, to find to be mutated.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510755090.XA CN105296634B (en) | 2015-11-09 | 2015-11-09 | For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510755090.XA CN105296634B (en) | 2015-11-09 | 2015-11-09 | For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105296634A CN105296634A (en) | 2016-02-03 |
CN105296634B true CN105296634B (en) | 2019-07-23 |
Family
ID=55194453
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510755090.XA Expired - Fee Related CN105296634B (en) | 2015-11-09 | 2015-11-09 | For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105296634B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109504761A (en) * | 2018-12-12 | 2019-03-22 | 复旦大学 | It detects the PANX1 gene of women primary infertility and detects the kit of the gene mutation |
CN112877415A (en) * | 2019-12-01 | 2021-06-01 | 复旦大学 | Marker TRIP13 gene for judging female primary infertility and detection kit thereof |
CN113846156A (en) * | 2021-10-22 | 2021-12-28 | 浙江大学 | MOS gene, primer and kit for judging female primary infertility and/or test tube infant fate and application |
-
2015
- 2015-11-09 CN CN201510755090.XA patent/CN105296634B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
Mutations analysis of the TUBB8 gene in primary infertile women with arrest in oocyte maturation;Wang AC等;《Gynecol Endocrinol》;20180419;第34卷(第10期);第900-904页 |
Mutations in TUBB8 and human oocyte Meiotic Arrest;Ruizhi Feng等;《The new England Journal of Medicine》;20160121;第223-232页 |
NM_177987.2;Gonzales PA等;《Genbank》;20150315;第1页 |
Also Published As
Publication number | Publication date |
---|---|
CN105296634A (en) | 2016-02-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Rosenbluth et al. | Human embryos secrete microRNAs into culture media—a potential biomarker for implantation | |
US20050255482A1 (en) | Method of analysing a marker nucleic acid molecule | |
Garrido et al. | Assessment of sperm using mRNA microarray technology | |
CN105296634B (en) | For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility | |
Khorshid et al. | Early fetal gender determination using real-time PCR analysis of cell-free fetal DNA during 6th-10th weeks of gestation | |
CN107475378B (en) | PATL2 gene for detecting female primary infertility and kit for detecting gene mutation | |
Weizman et al. | Triggering method in assisted reproduction alters the cumulus cell transcriptome | |
CN109504761A (en) | It detects the PANX1 gene of women primary infertility and detects the kit of the gene mutation | |
CN111549036A (en) | Marker BTG4 gene for judging female primary infertility and detection kit thereof | |
Ivanovna et al. | Polymorphism G-105A SEPS1 gene and mens’ infertility | |
CN112877414A (en) | Marker CDC20 gene for judging female primary infertility and detection kit thereof | |
Song et al. | Genome-wide screening of severe male factor infertile patients using BAC-array comparative genomic hybridization (CGH) | |
CN112877415A (en) | Marker TRIP13 gene for judging female primary infertility and detection kit thereof | |
TW201311908A (en) | Method and kit for diagnosis of canine glaucoma | |
Wang et al. | De novo paternal FBN1 mutation detected in embryos before implantation | |
CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
CN115927584A (en) | TACC3 gene for detecting female primary infertility and kit for detecting mutation of gene | |
CN116042798A (en) | TUBA4A gene for detecting female primary infertility and kit for detecting mutation of gene | |
CN117004702A (en) | LHX8 gene for detecting female primary infertility and kit for detecting mutation of gene | |
CN115896269A (en) | PABPC1L gene and kit for detecting primary infertility caused by ovum maturation disorder | |
CN113166810A (en) | SNP marker for diagnosing cerebral aneurysm including single base polymorphism of GBA gene | |
CN117004703A (en) | KPNA7 gene for detecting female primary infertility and kit for detecting mutation of KPNA7 gene | |
Van Hoeck et al. | Gene expression profiling by high throughput sequencing to determine signatures for the bovine receptive uterus at early gestation | |
CN113322311A (en) | MEI1 gene for detecting female primary infertility and kit for detecting mutation of gene | |
CN114606311B (en) | Application of SLC39A13 gene rs755555 locus, detection primer and probe combination thereof and kit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190723 |