CN105296634B - For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility - Google Patents

Abstract

The invention belongs to technical field of gene detection, particularly for the VIII type-microtubule protein gene and kit of detection women primary infertility.Mankind's microtubule protein gene-VIII type-microtubule protein gene of the present invention: TUBB8 gene, when its mutation are the reason of leading to cause female acyesis immature because of ovum.Mutation by detecting TUBB8 gene can be used as the marker gene for judging that female acyesis is caused because ovum is immature.It can be used for evaluating or preparing the kit for screening that female acyesis is caused because ovum is immature using TUBB8 gene provided by the invention.The operating method that can be used for when clinical respective patient being instructed to carry out test-tube baby's art using TUBB8 gene provided by the invention；It can be used for evaluating or preparing the kit for screening of IVF/ICSI validity using TUBB8 gene provided by the invention.

Description

For detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility

Technical field

The invention belongs to technical field of gene detection, and in particular to a kind of for detecting the VIII type-of women primary infertility Microtubule protein gene and kit.VIII type-microtubule protein gene mutation is the reason of leading to women primary infertility.Pass through inspection It surveys whether this gene mutates, can be used to that infertility is diagnosed and judged, and to the subsequent carry out test-tube baby of patient, choosing The method or final result for selecting IVF/ICSI are instructed.

Background technique

Normal pregnancy and reproduction are to maintain and continue the important link of human population.In clinic, the micro-deleted inspection of AZF gene Survey has been widely used in the diagnosis of male sterility patient (Pryor JL et al, Microdeletions in the Y chromosome of infertile men. N Engl J Med. 1997 Feb 20;336(8);534-9).In research side , there has been a ZP-1 in face at present, the genes such as Stag3, FSHR be found with female infertility it is closely related (Huang HL et al, Mutant ZP1 in familial infertility. N Engl J Med. 2014 370(13):1220-6;de Roux N et al, A family with hypogonadotropic hypogonadism and mutations in the gonadotropin-releasing hormone receptor. N Engl J Med. 1997 337(22):1597-602; Caburet S et al, Mutant cohesion in premature ovarian failure. N Engl J Med.2014 370 (10): 943-9).But it is not applied in clinic.

There are many reason of leading to female infertility, have some clinical reports to be related to women characterized by ovum is immature not Description (Rudak et al, fertility the and sterility, 1990 54:292-296 of pregnant disease;Human Reproduction,1995 10:2343-2349; fertility and sterility 1999 71:567-570;Human Reproduction 2001 16(10):2136-2138;Human Reproduction 2002 17(6):1604-1609; Human Reproduction 2,002 17 (10): 2556-2559).These patients are by being repeated insemination-transplantation of embryo (test-tube baby) because failing to get mature egg cell, and is unable to complete successful inseminatio externalis operation.If phase can be found Disease-causing gene is closed, then is all of great significance to disease clinical diagnosis and parting.But does not have also led so that ovum is immature at present The gene of the female infertility of cause is found.

VIII type-microtubule protein gene (Tubulin, beta 8 class VIII, TUBB8) belongs to coding tubulin One of 9 members of family.Other genes of tubulin family, which have been found in Nervous and mental diseases, plays important work With.But VIII type-microtubule protein gene function and unknown so far with the relationship of female acyesis.

It finds by prior art documents, any report that so far there are no about TUBB8 gene.Also it is not found Report relevant to female infertility.

Summary of the invention

The purpose of the present invention is to provide a kind of easy to operate, definite effect for detecting the VIII of women primary infertility Type-microtubule protein gene and the kit for detecting the gene mutation.

Provided by the present invention for detecting VIII type-microtubule protein gene (TUBB8) nucleic acid sequence of women primary infertility Column are as shown in SEQ ID NO.1.

It is exactly by detection TUBB8 gene the present invention relates to the method that screening causes primary infertility because ovum is immature Whether mutation judges whether patient is primary infertility caused by ovum is immature.It is extracted from the peripheral blood of patient After DNA, with PCR(polymerase chain reaction) method combination DNA sequencing, to detect whether TUBB8 gene is mutated.

The present invention relates to the primers whether detection TUBB8 gene mutates.

The method whether detection TUBB8 gene mutates is as follows: there are four exons by TUBB8.It is aobvious to wherein 1-3 extra Son utilizes primer pair:

5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),

5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),

Carry out PCR amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 57 DEG C 1 minute, 72 DEG C of 3 seconds (this three steps Repeat 35 circulation), 72 DEG C 10 minutes), be then sequenced using identical primer, the standard sequence with TUBB8 in UCSC Column (SEQ ID NO.1) are compared, to find to be mutated；

To wherein the 4th exon, primer pair is utilized:

5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),

5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),

Carry out PCR amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 61 DEG C 1 minute, 72 DEG C of 3 seconds (this three steps Repeat 35 circulation), 72 DEG C 10 minutes；Then primer pair is utilized:

5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),

5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),

It is sequenced, then is compared with the standard sequence (SEQ ID NO.1) of TUBB8 in UCSC, to find to be mutated. It is sequenced by PCR and a generation, and the comparison with standard sequence, to detect whether TUBB8 gene mutates.

The present invention also provides a kind of immature kit for screening for causing primary infertility of detection ovum.This kit can refer to Guiding doctor gives birth to the judgement of the disease cause of disease, is correctly classified to disease, to inform that patient is carried out using IVF method or ICSI method Test-tube baby's operation, and if appropriate for continuing to implement IVF-ET cycle art (IVF) or intracytoplasmic sperm injection art (ICSI) (test-tube baby).

Kit provided by the invention, the amplimer and sequencing primer of the 1-4 exon including above-mentioned amplification TUBB8 (SEQ ID NO.2-SEQ ID NO.7) and reaction mixture；Reaction mixture includes archaeal dna polymerase, dNTP and buffer；

Specifically used method are as follows: primer is diluted with water as the working solution of 10uM concentration.Reaction system is 10ul, wherein The water of 1ul sample DNA, 0.5ul forward primer, 0.5ul reverse primer, 5ul reaction mixture and 3ul form.After mixing, press Above-mentioned condition carries out PCR reaction, then carries out generation sequencing.

The present invention also provides for studying the immature gene repair target site for causing primary infertility of drug therapy ovum (i.e. It is actually detected go out patient mutational site, for example 7 mutational sites are listed in table 1, during actually detected, by with Standard sequence compares, and may have new mutational site), and by the reparation to target site, so that TUBB8 can go Make normal function, and then can treat such disease.

The present invention can also pass through the mutation of detection TUBB8 gene, the clinical patient with this gene mutation of guidance, Ying Caiyong Which kind of operation method (IVF or ICSI) carries out test-tube baby's art.In routine clinical, when Mr. and Mrs are desired with test-tube baby, if The bridegroom's or husband's side is not that seriously few weak essence, the method for generally using IVF first carry out test-tube baby's art.But if patient passes through detection It is found to have the mutation of TUBB8, then should directly adopt ICSI to this patient carries out test-tube baby's art.Because prominent with this The ovum of the patient of change is jejune, so ICSI method should be used, carries out In-vitro maturation trial to the ovum of acquisition, Without IVF should be used.

Detailed description of the invention

Fig. 1 is that patient sports the displaying of the distribution in TUBB8 structure.

Specific embodiment

Below in conjunction with specific embodiment, to further illustrate the present invention.It should be understood that following embodiment is merely to illustrate this hair It is bright rather than limit the scope of the invention.

Embodiment 1: the collection of sample and the extracting of peripheral blood DNA

The immature cause primary infertility patient of ovum is from the attached red house hospital Shang Haiji of Chinese Shanghai Fudan University Love heredity and sterile diagnosis and treatment center, the attached 9th the People's Hospital's reproductive center of Chinese Shanghai university of communications.Diagnostic criteria is by Rudak E et al. (Rudak E., DorJ., KimchiM., Goldman B., Levran D and Mashiach S, Anomalies of human oocytes from infertile women undergoing treatment by in vitro fertilization. FertilSteril. 1990 Aug;54 (2): 292-6) it proposes.Bridegroom's or husband's side semen efamination is normal, the wife's side Patient female reproductive organ, ovarian function, sex hormone are normal, and 2 times or more decorporation periods get 5 or more ovums every time, There is not visible first polar body form.The research of this project is participated under the premise of informed consent, acquires blood, and sign and know together Meaning book.All patients in group pass through medical history and exclude other Procreation models.The control crowd of this experiment is 1000 lifes Normally functioning women is educated, sample blood 300ul is taken, DNA is extracted by kit specification, is detected with UV detector DNA concentration and purity.

Embodiment 2: the mutation of detection TUBB8 gene

The present invention combines the searching of sequencing progress TUBB8 gene mutation using PCR.Its principle is first to TUBB8 gene Four exons carry out design of primers (can specifically give primer sequence) and expand, and carry out the searching of TUBB8 gene mutation.(i.e. By DNA sample with react working solution (archaeal dna polymerase, dNTP, water and buffer) mix after mix, expanded according to PCR program Increase.Products therefrom is sequenced in ABI3730 sequencing by purifying and further sequencing reaction.Interpretation of result passes through HLA Fusion software (One lambda, CA, USA, HLA Fusion 3.0) carries out.Expand the PCR primer of 1-3 exon Are as follows:

5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2)

5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3)

Sequencing primer is identical as PCR primer；

Expand the PCR primer of the 4th exon are as follows:

5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4)

5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5)

Sequencing primer are as follows:

5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6)

5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7).

Embodiment 3:TUBB8 gene mutation with because ovum is immature cause primary infertility

As a result: it is immature and cause primary infertility patient 7 that we collected TUBB8 gene mutation institute reason ovum altogether.Phase Mutational site information is answered to see the table below (table 1).Distribution of the mutational site in structure is as shown in Figure 1.

1 patient's TUBB8 gene mutation information of table

In conclusion of the invention has following important practical usage:

(1) it can use label of the TUBB8 gene proposed by the present invention as prediction because of the immature cause female acyesis of ovum Gene；

(2) it can be used for evaluating or preparing using TUBB8 gene provided by the invention and cause female acyesis because ovum is immature Kit for screening；

(3) can be used for instructing the clinical patient with this gene mutation, Ying Caiyong using TUBB8 gene provided by the invention Which kind of operation method (IVF or ICSI) carries out test-tube baby's art.

The SEQ ID NO.1:

(a) sequence signature:

Length: 1335 base-pairs

Type: nucleic acid

Chain: double-strand

Topological structure: linear

(b) molecule type: cDNA

(c) assume: no

(d) antisense: no

(e) initial source: people

(f) SEQ ID NO.1 nucleic acid sequence is as follows:

ATGAGGGAGATCGTGCTCACGCAGATCGGGCAGTGCGGGAATCAGATCGGCGCCAAGTTCTGGGAGGTG ATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGACAGCCACCTGCAGCTGGAGCGCATCAACGT GTACTACAACGAGGCCAGCGGTGGCAGGTACGTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACT CTGTGCGCTCGGGGCCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAACAAC TGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTTGTCAGAAAGGAGGCTGAGAG CTGTGACTGCCTGCAGGGTTTCC

AGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGG AGGAGTACCCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCC TACAACGCCACCCTCTCAGTCCACCAGCTCATAGAAAACGCAGATGAGACCTTTTGCATAGATAACGAAGCTCTGTA TGACATATGTTCCAAGACCCTAAAACTGCCCACACCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGA GTGGGGTCACCACGTGCCTGCGCTTCCCGGGCCAGCTGAATGCTGACCTGCGGAAGCTGGCCGTGAACATGGTCCCG TTTCCCCGGCTGCATTTCTTCAT

GCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCCTTGACTGTGGCTGAGCTTAC CCAGCAGATGTTTGATGCTAAGAACATGATGGCTGCCTGTGACCCCCGTCACGGCCGCTACCTAACGGCGGCTGCCA TTTTCAGGGGTCGCATGCCCATGAGGGAGGTGGATGAACAAATGTTCAACATTCAAGATAAGAACAGCAGTTACTTT GCTGACTGGCTCCCCAACAACGTAAAAACAGCCGTCTGTGACATCCCACCCCGGGGGCTAAAAATGTCAGCCACCTT CATTGGGAATAATACGGCCATCCAGGAACTCTTCAAGCGTGTCTCAGAGCAGTTTACAGCAATGTTCAGGCGCAAGG CCTTCCTCCACTGGTACACGGGC

GAGGGCATGGATGAGATGGAATTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCTGAATATCAG CAATATCAGGATGCCACGGCCGAGGAGGAGGAGGATGAGGAGTATGCCGAGGAGGAGGTGGCCTAG

SEQUENCE LISTING

<110>Fudan University

<120>for detecting the VIII type 'beta '-tubulin gene and kit of women primary infertility

<130> 001

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 1335

<212> DNA

<213>

<400> 1

atgagggaga tcgtgctcac gcagatcggg cagtgcggga atcagatcgg cgccaagttc 60

tgggaggtga tctctgatga acatgccatc gactccgctg gcacctacca cggggacagc 120

cacctgcagc tggagcgcat caacgtgtac tacaacgagg ccagcggtgg caggtacgtg 180

ccccgcgctg tgctcgtgga tctggagccg ggcaccatgg actctgtgcg ctcggggccc 240

ttcgggcagg tcttcaggcc agacaacttc atcttcggtc agtgtggggc cggaaacaac 300

tgggccaagg gacactacac cgaaggcgcg gagctgatgg agtcagtgat ggacgttgtc 360

agaaaggagg ctgagagctg tgactgcctg cagggtttcc agctgaccca ctccctgggt 420

ggggggactg ggtctgggat gggtaccctt ctgctcagta agatccggga ggagtaccca 480

gacaggatca taaacacatt cagcatcctg ccctcgccca aggtgtcgga caccgtggtg 540

gagccctaca acgccaccct ctcagtccac cagctcatag aaaacgcaga tgagaccttt 600

tgcatagata acgaagctct gtatgacata tgttccaaga ccctaaaact gcccacaccc 660

acctatggtg acctgaacca cctggtgtct gctaccatga gtggggtcac cacgtgcctg 720

cgcttcccgg gccagctgaa tgctgacctg cggaagctgg ccgtgaacat ggtcccgttt 780

ccccggctgc atttcttcat gcccggcttt gccccactga ccagccgggg cagccagcag 840

taccgggcct tgactgtggc tgagcttacc cagcagatgt ttgatgctaa gaacatgatg 900

gctgcctgtg acccccgtca cggccgctac ctaacggcgg ctgccatttt caggggtcgc 960

atgcccatga gggaggtgga tgaacaaatg ttcaacattc aagataagaa cagcagttac 1020

tttgctgact ggctccccaa caacgtaaaa acagccgtct gtgacatccc accccggggg 1080

ctaaaaatgt cagccacctt cattgggaat aatacggcca tccaggaact cttcaagcgt 1140

gtctcagagc agtttacagc aatgttcagg cgcaaggcct tcctccactg gtacacgggc 1200

gagggcatgg atgagatgga attcaccgag gccgagagca acatgaacga cctggtgtct 1260

gaatatcagc aatatcagga tgccacggcc gaggaggagg aggatgagga gtatgccgag 1320

gaggaggtgg cctag 1335

<210> 2

<211> 24

<212> DNA

<213>

<400> 2

agttcccaga ggatgacctt agca 24

<210> 3

<211> 22

<212> DNA

<213>

<400> 3

gctatttaaa cgttggcgga gg 22

<210> 4

<211> 20

<212> DNA

<213>

<400> 4

accaggagac catcacacag 20

<210> 5

<211> 20

<212> DNA

<213>

<400> 5

cgctcaatct gcctctccta 20

<210> 6

<211> 20

<212> DNA

<213>

<400> 6

aacgcagcag gagatgtgaa 20

<210> 7

<211> 20

<212> DNA

<213>

<400> 7

ccctgcaaga acctgagctg 20

Claims (1)

1. the primer pair whether detection TUBB8 gene mutates is used to prepare the purposes of detection women primary infertility kit, It is characterized in that, the primer pair is for example following:

5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),

5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),

5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),

5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),

5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),

5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),

When being used for women primary infertility:

TUBB8 utilizes primer pair to wherein 1-3 exon there are four exon:

5 '-AGTTCCCAGAGGATGACCTTAGCA-3 ' (SEQ ID NO.2),

5 '-GCTATTTAAACGTTGGCGGAGG-3 ' (SEQ ID NO.3),

PCR amplification is carried out, is then sequenced using identical primer, the standard sequence SEQ ID NO.1 with TUBB8 in UCSC It is compared, to find to be mutated；

To wherein the 4th exon, primer pair is utilized:

5 '-ACCAGGAGACCATCACACAG-3 ' (SEQ ID NO.4),

5 '-CGCTCAATCTGCCTCTCCTA-3 ' (SEQ ID NO.5),

Carry out PCR amplification；Then primer pair is utilized:

5 '-AACGCAGCAGGAGATGTGAA-3 ' (SEQ ID NO.6),

5 '-CCCTGCAAGAACCTGAGCTG-3 ' (SEQ ID NO.7),

It is sequenced, then is compared with the standard sequence SEQ ID NO.1 of TUBB8 in UCSC, to find to be mutated.