CN105296634A - VIII type beta-tubulin gene and kit for detecting primary infertility of females - Google Patents

Abstract

The invention belongs to the technical field of gene detection, and particularly discloses a VIII type beta-tubulin gene and kit for detecting primary infertility of females. The human tubulin gene-VIII type tubulin gene, namely the TUBB8 gene, is the reason for female sterility because of immature ova during mutation. By detecting the mutation of the TUBB8 gene, the TUBB8 gene can be used as a market gene for judging female sterility because of immature ova. By the adoption of the TUBB8 gene, the TUBB8 gene can be used for evaluating or preparing a screening kit for female sterility because of immature ova. The provided TUBB8 gene can be used for guiding an operational method for clinically corresponding patients during test-tube baby operations. The TUBB8 gene can be used for evaluating or preparing the screening kit with IVF/ICSI effectiveness.

Description

For detecting VIII type 'beta '-tubulin gene and the test kit of women's primary infertility

Technical field

The invention belongs to technical field of gene detection, being specifically related to a kind of VIII type-microtubule protein gene for detecting women's primary infertility and test kit.VIII type-microtubule protein gene sudden change is the reason causing women's primary infertility.Whether undergoing mutation by detecting this gene, can be used to diagnose Infertility and judge, and carry out tube baby to patient is follow-up, select the method for IVF/ICSI or final result to instruct.

Background technology

Normal pregnancy and reproduction are the important steps maintaining and continue human population.In clinical, the micro-deleted detection of AZF gene has been widely used in (PryorJLetal, MicrodeletionsintheYchromosomeofinfertilemen.NEnglJMed.1 997Feb20 in the diagnosis of male sterility patient; 336 (8); 534-9).In research, have ZP-1 at present, the genes such as Stag3, FSHR are found (HuangHLetal, MutantZP1infamilialinfertility.NEnglJMed.2014370 (13): 1220-6 closely related with female infertility; DeRouxNetal, Afamilywithhypogonadotropichypogonadismandmutationsinthe gonadotropin-releasinghormonereceptor.NEnglJMed.1997337 (22): 1597-602; CaburetSetal, Mutantcohesioninprematureovarianfailure.NEnglJMed.201437 0 (10): 943-9).But, all not in clinical middle application.

Cause the reason of female infertility a lot, have some clinical reports to relate to description (Rudaketal, fertilityandsterility, the 199054:292-296 of the immature female infertility for feature of ovum; HumanReproduction, 199510:2343-2349; Fertilityandsterility199971:567-570; HumanReproduction200116 (10): 2136-2138; HumanReproduction200217 (6): 1604-1609; HumanReproduction200217 (10): 2556-2559).These patients, by repeatedly carrying out-transplantation of embryo (tube baby) of inseminating, all because failing to get mature egg cell, and cannot complete successful in vitro fertilization operation.If can related genes be found, then to disease clinical diagnosis and somatotype all significant.But, also do not have at present and be found with the gene of the immature female infertility caused of ovum.

VIII type-microtubule protein gene (Tubulin, beta8classVIII, TUBB8) belongs to one of coding tubulin family 9 members.Other genes of tubulin family have been found in Nervous and mental diseases and have played a significant role.But, the function of VIII type-microtubule protein gene and unknown so far with the relation of female acyesis.

Find by prior art documents, so far there are no about any report of TUBB8 gene.Its report relevant to female infertility is not found yet.

Summary of the invention

The object of the present invention is to provide a kind of easy to operate, definite effect for detecting the VIII type-microtubule protein gene of women's primary infertility and detecting the test kit of this transgenation.

The nucleotide sequence of the VIII type-microtubule protein gene (TUBB8) for detecting women's primary infertility provided by the invention is as shown in SEQIDNO.1.

Whether the present invention relates to examination causes primary infertility method because ovum is immature, being undergone mutation by detection TUBB8 gene exactly judges whether patient is the immature primary infertility caused of ovum.Extract DNA from the peripheral blood of patient after, use PCR(polymerase chain reaction) method in conjunction with DNA sequencing, detect TUBB8 gene and whether there occurs sudden change.

The present invention relates to the primer detecting TUBB8 gene and whether undergo mutation.

The method whether detection TUBB8 gene undergos mutation is as follows: TUBB8 has four exons.To wherein 1-3 exon, utilize primer pair:

5’-AGTTCCCAGAGGATGACCTTAGCA-3’（SEQIDNO.2），

5’-GCTATTTAAACGTTGGCGGAGG-3’（SEQIDNO.3），

Carry out pcr amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 57 DEG C 1 minute, 72 DEG C 3 seconds (this three step repeats 35 circulations), 72 DEG C 10 minutes), then utilize identical primer to check order, compare with the standard sequence (SEQIDNO.1) of TUBB8 in UCSC, thus find sudden change;

To wherein the 4th exon, utilize primer pair:

5’-ACCAGGAGACCATCACACAG-3’（SEQIDNO.4），

5’-CGCTCAATCTGCCTCTCCTA-3’（SEQIDNO.5），

Carry out pcr amplification (amplification condition: 92 DEG C 2 minutes, 92 DEG C 30 seconds, 61 DEG C 1 minute, 72 DEG C 3 seconds (this three step repeats 35 circulations), 72 DEG C 10 minutes; Then primer pair is utilized:

5’-AACGCAGCAGGAGATGTGAA-3’（SEQIDNO.6），

5’-CCCTGCAAGAACCTGAGCTG-3’（SEQIDNO.7），

Check order, then compare with the standard sequence (SEQIDNO.1) of TUBB8 in UCSC, thus find sudden change.By PCR and generation order-checking, and with the comparison of standard sequence, detect TUBB8 gene and whether undergo mutation.

The present invention also provides a kind of and detects the immature kit for screening causing primary infertility of ovum.This test kit can instruct doctor to the judgement of the disease cause of disease, correctly classify to disease, thus inform that patient adopts IVF method or ICSI method to carry out tube baby's operation, and whether be applicable to continuing to implement IVF-ET cycle art (IVF) or intracytoplasmic sperm injection art (ICSI) (tube baby).

Test kit provided by the invention, comprises the amplimer of the 1-4 exon of above-mentioned amplification TUBB8 and sequencing primer (SEQIDNO.2-SEQIDNO.7) and reaction mixture; Reaction mixture comprises archaeal dna polymerase, dNTP and damping fluid;

Concrete using method is: the working fluid by primer dilute with water being 10uM concentration.Reaction system is 10ul, wherein, and 1ul sample DNA, 0.5ul forward primer, 0.5ul reverse primer, the water composition of 5ul reaction mixture and 3ul.After mixing, carry out PCR reaction by above-mentioned condition, then carry out generation order-checking.

The present invention is also provided for drugs treatment immature gene repair target site (the i.e. mutational site of the actual patient detected causing primary infertility of ovum, such as list 7 mutational sites in Table 1, in actual testing process, by with standard sequence comparison, new mutational site may be there is), and by the reparation to target site, thus make TUBB8 to exercise normal function, and then this kind of disease can be treated.

The present invention also by detecting the sudden change of TUBB8 gene, instructing the clinical patient with this transgenation, which kind of operation method (IVF or ICSI) should be adopted to carry out tube baby's art.In routine clinical, when Mr. and Mrs wish to carry out tube baby, if the bridegroom's or husband's side is not serious few weak essence, the method for IVF is generally first adopted to carry out tube baby's art.But, if patient is by detecting the sudden change finding to have TUBB8, so should directly adopt ICSI to carry out tube baby's art to this patient.Because the ovum with the patient of this sudden change is jejune, so ICSI method should be adopted, In-vitro maturation trial is carried out to the ovum obtained, and should not adopt IVF.

Accompanying drawing explanation

Fig. 1 sports at TUBB8 structural point of characters show for patient.

Embodiment

Below in conjunction with specific embodiment, to further illustrate the present invention.Should be understood that following examples are only not used in for illustration of the present invention to limit the scope of the invention.

embodiment 1:the collection of sample and the extracting of peripheral blood DNA

Ovum is immature to be caused primary infertility patient and comes from attached red house hospital of Chinese Shanghai Fudan University Shanghai collection and like heredity and sterile diagnosis and treatment center, the attached 9th the People's Hospital's reproductive center of Chinese Shanghai university of communications.Case definition is by the people such as RudakE (RudakE.; DorJ., KimchiM., GoldmanB.; LevranDandMashiachS, Anomaliesofhumanoocytesfrominfertilewomenundergoingtreat mentbyinvitrofertilization.FertilSteril.1990Aug; 54 (2): 292-6) propose.Bridegroom's or husband's side semen efamination is normal, and wife's side patient female reproductive organ, ovarian function, sexual hormoue are all normal, and more than 2 times decorporation cycles get more than 5 ovums at every turn, all do not have visible first polar body form.Under the prerequisite of informed consent, participate in the research of this problem, gather blood, and sign Informed Consent Form.Allly enter to organize patient and all get rid of other Procreation model by medical history.The contrast crowd of this experiment is 1000 normal women of reproductive function, gets sample blood 300ul, extracts DNA by test kit specification sheets, detects DNA concentration and purity with UV detector.

embodiment 2:detect the sudden change of TUBB8 gene

The present invention adopts PCR to combine and checks order and carries out the searching of TUBB8 transgenation.Its principle first carries out design of primers (specifically can provide primer sequence) and amplification to four exons of TUBB8 gene, carries out the searching of TUBB8 transgenation.(mix after mixing by DNA sample and reaction working fluid (archaeal dna polymerase, dNTP, water and damping fluid), increase according to PCR program.Products therefrom, through purifying and further sequencing reaction, ABI3730 order-checking is checked order.Interpretation of result is undertaken by HLAFusion software (Onelambda, CA, USA, HLAFusion3.0).The PCR primer of amplification 1-3 exon is:

5’-AGTTCCCAGAGGATGACCTTAGCA-3’（SEQIDNO.2）

5’-GCTATTTAAACGTTGGCGGAGG-3’（SEQIDNO.3）

Sequencing primer is identical with PCR primer;

The PCR primer of the 4th exon of increasing is:

5’-ACCAGGAGACCATCACACAG-3’（SEQIDNO.4）

5’-CGCTCAATCTGCCTCTCCTA-3’（SEQIDNO.5）

Sequencing primer is:

5’-AACGCAGCAGGAGATGTGAA-3’（SEQIDNO.6）

5’-CCCTGCAAGAACCTGAGCTG-3’（SEQIDNO.7）。

embodiment 3:tUBB8 transgenation with cause primary infertility because ovum is immature

Result: we collected altogether TUBB8 transgenation institute reason ovum immature and cause primary infertility patient 7 example.Corresponding mutational site information sees the following form (table 1).Mutational site distribution structurally as shown in Figure 1.

Table 1 patient TUBB8 transgenation information

In sum, of the present invention have following important practical usage:

(1) the TUBB8 gene that the present invention can be utilized to propose causes the marker gene of female acyesis because ovum is immature as prediction;

(2) TUBB8 gene provided by the invention is utilized to can be used for evaluating or preparing the kit for screening causing female acyesis because ovum is immature;

(3) utilize TUBB8 gene provided by the invention to can be used for instructing the clinical patient with this transgenation, which kind of operation method (IVF or ICSI) should be adopted to carry out tube baby's art.

Described SEQIDNO.1:

(a) sequence signature:

Length: 1335 base pairs

Type: nucleic acid

Chain: double-strand

Topological framework: linear

(b) molecule type: cDNA

C () is supposed: no

(d) antisense: no

E () is originated at first: people

F () SEQIDNO.1 nucleotide sequence is as follows:

ATGAGGGAGATCGTGCTCACGCAGATCGGGCAGTGCGGGAATCAGATCGGCGCCAAGTTCTGGGAGGTGATCTCTGATGAACATGCCATCGACTCCGCTGGCACCTACCACGGGGACAGCCACCTGCAGCTGGAGCGCATCAACGTGTACTACAACGAGGCCAGCGGTGGCAGGTACGTGCCCCGCGCTGTGCTCGTGGATCTGGAGCCGGGCACCATGGACTCTGTGCGCTCGGGGCCCTTCGGGCAGGTCTTCAGGCCAGACAACTTCATCTTCGGTCAGTGTGGGGCCGGAAACAACTGGGCCAAGGGACACTACACCGAAGGCGCGGAGCTGATGGAGTCAGTGATGGACGTTGTCAGAAAGGAGGCTGAGAGCTGTGACTGCCTGCAGGGTTTCC

AGCTGACCCACTCCCTGGGTGGGGGGACTGGGTCTGGGATGGGTACCCTTCTGCTCAGTAAGATCCGGGAGGAGTACCCAGACAGGATCATAAACACATTCAGCATCCTGCCCTCGCCCAAGGTGTCGGACACCGTGGTGGAGCCCTACAACGCCACCCTCTCAGTCCACCAGCTCATAGAAAACGCAGATGAGACCTTTTGCATAGATAACGAAGCTCTGTATGACATATGTTCCAAGACCCTAAAACTGCCCACACCCACCTATGGTGACCTGAACCACCTGGTGTCTGCTACCATGAGTGGGGTCACCACGTGCCTGCGCTTCCCGGGCCAGCTGAATGCTGACCTGCGGAAGCTGGCCGTGAACATGGTCCCGTTTCCCCGGCTGCATTTCTTCAT

GCCCGGCTTTGCCCCACTGACCAGCCGGGGCAGCCAGCAGTACCGGGCCTTGACTGTGGCTGAGCTTACCCAGCAGATGTTTGATGCTAAGAACATGATGGCTGCCTGTGACCCCCGTCACGGCCGCTACCTAACGGCGGCTGCCATTTTCAGGGGTCGCATGCCCATGAGGGAGGTGGATGAACAAATGTTCAACATTCAAGATAAGAACAGCAGTTACTTTGCTGACTGGCTCCCCAACAACGTAAAAACAGCCGTCTGTGACATCCCACCCCGGGGGCTAAAAATGTCAGCCACCTTCATTGGGAATAATACGGCCATCCAGGAACTCTTCAAGCGTGTCTCAGAGCAGTTTACAGCAATGTTCAGGCGCAAGGCCTTCCTCCACTGGTACACGGGC

GAGGGCATGGATGAGATGGAATTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCTGAATATCAGCAATATCAGGATGCCACGGCCGAGGAGGAGGAGGATGAGGAGTATGCCGAGGAGGAGGTGGCCTAG

SEQUENCELISTING

<110> Fudan University

<120> is for detecting VIII type 'beta '-tubulin gene and the test kit of women's primary infertility

<130>001

<160>7

<170>PatentInversion3.3

<210>1

<211>1335

<212>DNA

<213>

<400>1

atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc60

tgggaggtgatctctgatgaacatgccatcgactccgctggcacctaccacggggacagc120

cacctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtg180

ccccgcgctgtgctcgtggatctggagccgggcaccatggactctgtgcgctcggggccc240

ttcgggcaggtcttcaggccagacaacttcatcttcggtcagtgtggggccggaaacaac300

tgggccaagggacactacaccgaaggcgcggagctgatggagtcagtgatggacgttgtc360

agaaaggaggctgagagctgtgactgcctgcagggtttccagctgacccactccctgggt420

ggggggactgggtctgggatgggtacccttctgctcagtaagatccgggaggagtaccca480

gacaggatcataaacacattcagcatcctgccctcgcccaaggtgtcggacaccgtggtg540

gagccctacaacgccaccctctcagtccaccagctcatagaaaacgcagatgagaccttt600

tgcatagataacgaagctctgtatgacatatgttccaagaccctaaaactgcccacaccc660

acctatggtgacctgaaccacctggtgtctgctaccatgagtggggtcaccacgtgcctg720

cgcttcccgggccagctgaatgctgacctgcggaagctggccgtgaacatggtcccgttt780

ccccggctgcatttcttcatgcccggctttgccccactgaccagccggggcagccagcag840

taccgggccttgactgtggctgagcttacccagcagatgtttgatgctaagaacatgatg900

gctgcctgtgacccccgtcacggccgctacctaacggcggctgccattttcaggggtcgc960

atgcccatgagggaggtggatgaacaaatgttcaacattcaagataagaacagcagttac1020

tttgctgactggctccccaacaacgtaaaaacagccgtctgtgacatcccaccccggggg1080

ctaaaaatgtcagccaccttcattgggaataatacggccatccaggaactcttcaagcgt1140

gtctcagagcagtttacagcaatgttcaggcgcaaggccttcctccactggtacacgggc1200

gagggcatggatgagatggaattcaccgaggccgagagcaacatgaacgacctggtgtct1260

gaatatcagcaatatcaggatgccacggccgaggaggaggaggatgaggagtatgccgag1320

gaggaggtggcctag1335

<210>2

<211>24

<212>DNA

<213>

<400>2

agttcccagaggatgaccttagca24

<210>3

<211>22

<212>DNA

<213>

<400>3

gctatttaaacgttggcggagg22

<210>4

<211>20

<212>DNA

<213>

<400>4

accaggagaccatcacacag20

<210>5

<211>20

<212>DNA

<213>

<400>5

cgctcaatctgcctctccta20

<210>6

<211>20

<212>DNA

<213>

<400>6

aacgcagcaggagatgtgaa20

<210>7

<211>20

<212>DNA

<213>

<400>7

ccctgcaagaacctgagctg20

Claims (4)

1., for detecting the VIII type-microtubule protein gene (TUBB8) of women's primary infertility, its nucleotide sequence is as shown in SEQIDNO.1.

2. for detecting the primer whether TUBB8 gene undergos mutation, it is characterized in that, for four exons of TUBB8 gene, for detecting the pcr amplification primer pair of 1-3 exon being:

5’-AGTTCCCAGAGGATGACCTTAGCA-3’，

5’-GCTATTTAAACGTTGGCGGAGG-3’，

Sequencing primer is to the same;

For detecting the pcr amplification primer pair of the 4th exon be:

5’-ACCAGGAGACCATCACACAG-3’，

5’-CGCTCAATCTGCCTCTCCTA-3’，

Sequencing primer to for:

5’-AACGCAGCAGGAGATGTGAA-3’

5’-CCCTGCAAGAACCTGAGCTG-3’。

3., for detecting the method whether TUBB8 gene undergos mutation, it is characterized in that concrete steps are as follows:

TUBB8 has four exons, to wherein 1-3 exon, utilizes primer pair:

5’-AGTTCCCAGAGGATGACCTTAGCA-3’，

5’-GCTATTTAAACGTTGGCGGAGG-3’，

Carry out pcr amplification, then utilize identical primer to check order, compare with the standard sequence SEQIDNO.1 of TUBB8 in UCSC, thus find sudden change;

To wherein the 4th exon, utilize primer pair:

5’-ACCAGGAGACCATCACACAG-3’，

5’-CGCTCAATCTGCCTCTCCTA-3’，

Carry out pcr amplification; Then primer pair is utilized:

5’-AACGCAGCAGGAGATGTGAA-3’，

5’-CCCTGCAAGAACCTGAGCTG-3’，

Check order, then compare with the standard sequence SEQIDNO.1 of TUBB8 in UCSC, thus find sudden change.

4., for detecting the immature kit for screening causing primary infertility of ovum, it is characterized in that test kit comprises the amplimer of the 1-4 exon of above-mentioned amplification TUBB8 gene and sequencing primer: SEQIDNO.2-SEQIDNO.7 and reaction mixture; Reaction mixture comprises archaeal dna polymerase, dNTP and damping fluid.