CN111549036A

CN111549036A - Marker BTG4 gene for judging female primary infertility and detection kit thereof

Info

Publication number: CN111549036A
Application number: CN202010373973.5A
Authority: CN
Inventors: 王磊; 桑庆; 陈标榜; 李巧丽
Original assignee: Fudan University; Zhuhai Fudan Innovation Research Institute
Current assignee: Fudan University; Zhuhai Fudan Innovation Research Institute
Priority date: 2020-05-07
Filing date: 2020-05-07
Publication date: 2020-08-18

Abstract

A marker BTG4 gene for judging female primary infertility and a detection kit thereof. The invention belongs to the technical field of gene detection, and particularly relates to a kit for detecting BTG4 gene mutation of female primary infertility. The mutation of the human BTG4 gene can cause female infertility caused by the fact that the ovum is not cracked after fertilization, so the BTG4 gene can be used as a marker gene for judging female infertility caused by the fact that the ovum is not cracked after fertilization. The invention also relates to a primer for detecting whether the BTG4 gene is mutated: SEQ ID NO.2-SEQ ID NO.11, and a screening kit for female infertility caused by non-cleavage after ovum fertilization. Whether BTG4 gene is mutated or not can also be used for guiding whether clinically relevant patients are suitable for tube infancy.

Description

Marker BTG4 gene for judging female primary infertility and detection kit thereof

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a marker for judging female primary infertility and a detection kit thereof.

Background

Normal pregnancy and reproduction are important links in maintaining and extending human populations. For female infertility, genes ZP-1, Stag3, FSHR, etc. have been found to be closely related to female infertility (Huang HL et al, Mutant ZP1 in microbial infection. N Engl J Med. 2014370 (13):1220-6; de Roux N et al, artificial with hyaluronic acid and polypeptides in the mineral-recovering hormone receiver. N Engl J. 1997337 (22):1597 and 602; cassette S et al, Mutant surgery in precursor failure. N Engl Med. 2014370 (10): 943-9). However, none have been clinically applied.

The reasons for female infertility are many, and there are some clinical reports relating to the description of female infertility characterized by egg immaturity (Rudak et al, fertility and fertility, 199054: 292-. These patients, by repeated insemination-embryo transfer (tube transfer), fail to achieve successful in vitro fertilization procedures due to the failure to obtain mature egg cells. If relevant pathogenic genes can be found, the method has important significance for clinical diagnosis and typing of diseases. Recently we found the causative genes TUBB8(N Engl J Med. 2016 Jan 21;374(3):223-32), PATL2 (Am J HumGenet. 2017 Oct 5;101(4): 609) 615) causing the human ovum maturation disorder, the causative gene WEE2 (Am J HumGenet. 2018 Apr 5;102(4): 649) 657), the early embryo diapause causative gene PADI6 (Am J Hum Genet.2016 Sep 1;99(3): 744) 752), NLRP2& NLRP5 (J Med Genet. 2019 Jul;56(7):471 Med. 480. mu. 480. REC114 (J Genet. Mar 57; 3: 194) 187) and the causative gene Mar J1 (N Engl. J HumGenet. 26: 485; 26) causing the human ovum maturation disorder, and the causative genes Mar X1 (Amj HumGenet. 26) 18: 26). However, the reasons for these several genes can only explain some of the patients, and the reasons for a considerable number of patients remain unknown.

Through the search of the prior art documents, only a few research articles surrounding the function of the BTG4 gene are found. These studies report that this gene plays an important role in the fertilization of mouse ova and early embryo development, and the homozygous knockout results in no cleavage and infertility after fertilization of female mouse ova. However, no report on the relationship between BTG4 gene mutation and human diseases is found so far, and no report on the relationship between BTG4 gene mutation and human diseases is found.

Disclosure of Invention

The invention aims to provide a marker for judging female primary infertility and a detection kit thereof, which are convenient to operate and have clear effect.

The nucleic acid sequence of the BTG4 gene for detecting female primary infertility provided by the invention is shown as SEQ ID NO. 1.

The invention relates to a method for screening primary infertility caused by no cleavage after fertilization of ova, which is to judge whether a patient is the primary infertility caused by no cleavage after fertilization of the ova by detecting whether a BTG4 gene is mutated. The patients carried BTG4 gene mutation and showed infertility that the ovum can mature, but the fertilization is not cracked and the test-tube infant fails.

Therefore, whether the BTG4 gene has mutation or not can be used as a marker for judging female infertility caused by the fact that the ovum is not cracked after fertilization.

Specifically, the method for detecting whether the BTG4 gene has a mutation can be implemented by extracting DNA from peripheral blood of a patient and then detecting whether the BTG4 gene has a mutation by a PCR (polymerase chain reaction) method in combination with DNA sequencing.

Wherein the sample to be detected is DNA, and the DNA sample is from peripheral blood of a human to be detected.

Alternatively, the sample to be tested is an RNA, protein, cell or serum sample derived from the peripheral blood of the human to be tested.

The invention relates to a primer for detecting whether BTG4 gene is mutated.

The BTG4 gene has 5 exon coding regions, and PCR amplification primer pairs for detecting the 1 st exon coding region are as follows:

5’- TGAGGAATTGCTGTTCTTGGCT -3’（SEQ ID NO.2）

5’- GGGCTTTGCTCTGTTGTTTCC -3’（SEQ ID NO.3）

the sequencing primer pair is as above;

the PCR amplification primer pair for detecting the coding region of the No.2 exon is as follows:

5’- GGGAAGCAATCACCAAGCAA -3’（SEQ ID NO.4）

5’- TATCCCTGCTGCCAACTCAA -3’（SEQ ID NO.5）

the sequencing primer pair is as above;

the PCR amplification primer pair for detecting the coding region of the No.3 exon is as follows:

5’- AGCATATTGTCTCCAGGAAAGAT -3’（SEQ ID NO.6）

5’- CCTAAAAGCTCAGCCAAGTGT -3’（SEQ ID NO.7）

the sequencing primer pair is as above;

the PCR amplification primer pair for detecting the coding region of the No.4 exon is as follows:

5’- GATTGGGTTGGCAGTGGTGA -3’（SEQ ID NO.8）

5’- TTTCATGGGCCTCTCAACCT -3’（SEQ ID NO.9）

the sequencing primer pair is as above;

the PCR amplification primer pair for detecting the coding region of the No.5 exon is as follows:

5’- CCTGGAACCTCTGGCTTTGA -3’（SEQ ID NO.10）

5’- TTCAGGCTCCAGAAATCACC -3’（SEQ ID NO.11）。

the sequencing primer pair is as above.

The invention also relates to a method for detecting whether the BTG4 gene is mutated, which comprises the following steps:

for the coding region of exon 1, a primer pair is utilized: SEQ ID NO.2 and SEQ ID NO.3, PCR-amplified (amplification conditions: 2 min at 92 ℃, 30 sec at 92 ℃,1 min at 57 ℃, 3 sec at 72 ℃ (these three steps are repeated for 35 cycles), 10 min at 72 ℃), and then sequenced using the same primers, aligned with the standard sequence of BTG4 in UCSC (SEQ ID NO. 1), to find mutations;

similar to the above conditions, the coding region of exon 2-5 of BTG4 was amplified by corresponding primers (SEQ ID NO.4-SEQ ID NO.11), sequenced, and aligned with the standard sequence of BTG4 (SEQ ID NO. 1) in UCSC to find mutations. Whether the BTG4 gene is mutated or not is detected by PCR and first-generation sequencing and comparison with a standard sequence.

The invention also provides a kit for detecting whether the BTG4 gene is mutated. The kit can guide doctors to judge the etiology of diseases, correctly classify the diseases, and inform patients whether the IVF method or the ICSI method is adopted for the operation of test-tube infants and whether the in-vitro insemination-embryo transfer (IVF) or the single sperm injection (ICSI) (test-tube infants) is suitable to be continuously performed.

The kit provided by the invention comprises the amplification primers SEQID NO.2-SEQ ID NO.11 for amplifying the coding region of the No. 1-5 exon of BTG4 and reaction mixed liquor; the reaction mixture comprises DNA polymerase, dNTP and buffer solution.

The specific using method comprises the following steps: the primers were diluted with water to a working solution of 10uM concentration. The reaction system is 10ul, wherein 1ul of sample DNA, 0.5ul of forward primer, 0.5ul of reverse primer, 5ul of reaction mixture and 3ul of water. After mixing, PCR reactions were performed according to the above conditions, followed by one-generation sequencing.

The kit can be used for detecting the primary infertility caused by the non-cleavage after the fertilization of the ovum.

The invention also provides a gene repair target site (namely actually detected mutation sites of a patient, such as 3 mutation sites listed in table 1, in the actual detection process, a new mutation site may exist by comparing with a standard sequence) for researching the primary infertility caused by no cleavage after the fertilization of the ovum by using the drug, and the BTG4 can perform normal functions by repairing the target site, so that the disease can be treated. Namely, the invention can also provide a medicine for researching and repairing the gene mutation target site, namely a medicine for treating primary infertility caused by no cleavage after the fertilization of the ovum.

The invention can also guide the clinical patients with the gene mutation whether to be suitable for the test-tube infant operation or not by detecting the mutation of the BTG4 gene. In routine clinics, infertile couples of unknown cause require test tube babies to attempt to reproduce the offspring. However, if the patient found a mutation with BTG4 by examination, the patient failed if he attempted tube infancy. Because, although the ovum can be mature, the ovum of the patient with the mutation can not start cleavage after fertilization, so that the effective embryo is difficult to obtain, and the subsequent operation of the test tube infant can not be completed. Such patients are therefore advised to donate eggs.

Drawings

FIG. 1 is a graphical representation of the distribution of patient mutations over the primary structure of BTG 4.

Detailed Description

The present invention will be further described with reference to the following specific examples. It should be understood that the following examples are only illustrative of the present invention and are not intended to limit the scope of the present invention.

Example 1: collection of samples and extraction of peripheral blood DNA

The primary infertility patients caused by no cleavage after ovum fertilization come from Shanghai love heredity and sterility diagnosis and treatment center of the affiliated Red House hospital of Shanghai Compound Dan university, China, the affiliated ninth people hospital of Shanghai transportation university, the reproductive center of the women and child health care institute of Shaanxi province, China, and the like. Diagnostic criteria are set forth by Rudak E et al (Rudak E., DorJ., Kimchim., Goldman B., Levran Dand Mashiach S., Anomalies of human society from human genome indirect diagnosis. Fertility Steril.1990 Aug; 54(2): 292-6). The semen of the male is checked normally, the female reproductive organ, the ovarian function and the sex hormone of the female are all normal, more than 5 eggs are taken each time in more than 2 ovulation promoting cycles, most of the eggs can not mature, or the mature eggs are poorly fertilized or are not cracked. The study of the subject was performed under the premise of informed consent, blood was collected, and an informed consent was signed. All patients enrolled excluded other genital endocrine diseases by medical history. The control population of the experiment is 1000 women with normal fertility, 300ul of the blood is sampled, DNA is extracted according to the kit specification, and the concentration and the purity of the DNA are detected by an ultraviolet spectrophotometer.

Example 2: detection of mutations in BTG4 Gene

The invention adopts PCR combined with sequencing to search for BTG4 gene mutation. The principle is that the 5 exon coding regions of the BTG4 gene are firstly subjected to primer design (a primer sequence can be specifically given) and amplification, and the BTG4 gene mutation is searched. (DNA samples and reaction working solution (DNA polymerase, dNTP, water and buffer) after mixing, according to PCR program amplification, the product, through purification and further sequencing reaction, ABI3730 sequencing, analysis of results through HLA Fusion software (One lambda, CA, USA, HLA Fusion 3.0).

Example 3: BTG4 gene mutation and primary infertility caused by non-cleavage after ovum fertilization

As a result: we have gathered 3 cases of patients with primary infertility caused by the fact that the ova are not cracked after fertilization due to the BTG4 gene mutation. The corresponding mutation site information is shown in the following table (table 1). The distribution of the mutation sites is shown in FIG. 1.

TABLE 1 patient BTG4 Gene mutation information

。

In conclusion, the invention has the following important practical significance:

(1) the BTG4 gene provided by the invention can be used as a marker gene for predicting female infertility caused by non-cleavage after ovum fertilization;

(2) the BTG4 gene provided by the invention can be used for evaluating or preparing a screening kit for female infertility caused by non-cleavage after ovum fertilization;

(3) the invention can be used for researching and preparing the medicine for repairing the gene mutation target site, namely the medicine for treating primary infertility caused by no cleavage after ovum fertilization;

(4) the BTG4 gene provided by the invention can be used for guiding patients with the gene mutation clinically, judging the success possibility of test-tube infants and recommending subsequent egg donation.

Sequence listing

<110> university of Compound Dan

Zhuhai Zaidan Innovation research institute

<120> marker BTG4 gene for judging female primary infertility and detection kit thereof

<130>001

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>672

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgagagatgaaattgcaac aacagttttc tttgtcacaa gattggtgaa aaaacatgat 60

aaactaagta aacagcaaat agaagacttt gcagaaaagc tgatgacgat cttgtttgaa 120

acatacagaa gtcactggca ctctgattgc ccttctaaag ggcaagcctt caggtgcatc 180

aggataaaca acaatcagaa taaagatccc attctagaaa gggcatgtgt ggaaagtaat 240

gtagattttt ctcacctggg acttccgaag gagatgacca tatgggtaga tccctttgaa 300

gtatgctgta ggtatggtga gaaaaaccat ccatttacag ttgcttcttt taaaggcaga 360

tgggaggaat gggaactata tcaacaaatc agttatgccg ttagtagagc ctcatcagac 420

gtttcctctg gcacttcctg cgatgaagaa agttgtagca aggaacctcg tgtcattcct 480

aaagtcagca atccgaagag tatttatcag gttgaaaact tgaaacagcc ctttcaatct 540

tggttacaaa tcccccgcaa aaagaatgtg gtggacggcc gtgttggcct cctgggaaac 600

acttaccatg gctcgcagaa gcatcctaag tgttacaggc ctgctatgca ccggctggac 660

agaattttat aa 672

<210>2

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgaggaattg ctgttcttgg ct 22

<210>3

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gggctttgct ctgttgtttc c 21

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gggaagcaat caccaagcaa 20

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

tatccctgct gccaactcaa 20

<210>6

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

agcatattgt ctccaggaaa gat 23

<210>7

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

cctaaaagct cagccaagtg t 21

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gattgggttg gcagtggtga 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

tttcatgggc ctctcaacct 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cctggaacct ctggctttga 20

<210>11

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

ttcaggctcc agaaatcacc 20

Claims

1. The marker for judging female primary infertility is BTG4 gene and has a nucleic acid sequence shown as SEQ ID NO.1, and the female primary infertility refers to female infertility caused by no cleavage after ovum fertilization.

2. A method for screening female primary infertility is characterized in that whether a patient is primary infertility caused by no cleavage after ovum fertilization is judged by detecting whether mutation occurs in BTG4 gene, wherein the nucleic acid sequence of BTG4 gene is shown as SEQ ID NO. 1.

3. The primer for detecting whether the BTG4 gene has mutation is characterized in that for 5 exon coding regions of the BTG4 gene, PCR amplification primer pairs for detection sequentially comprise: SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO. 11.

4. A method for detecting whether a BTG4 gene is mutated or not is characterized by comprising the following specific steps:

for the 5 exon coding regions in BTG4, the corresponding primer pairs were used: SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, -SEQ ID NO.10, SEQ ID NO.11, PCR-amplified, and then sequenced using the same primers, the sequencing result is identical to the standard sequence of BTG4 in UCSC: SEQ ID NO.1 was aligned to find a mutation.

5. A kit for detecting whether BTG4 gene is mutated or not, which is characterized in that the kit comprises an amplification primer for amplifying the coding region of exon 1-5 of BTG4 gene and a corresponding sequencing primer: SEQ ID NO.2-SEQ ID NO.11, and a reaction mixture comprising DNA polymerase, dNTP and a buffer.

6. The site of BTG4 gene mutation is applied in preparing medicine for repairing gene mutation target site, i.e. medicine for treating primary infertility caused by non-cleavage after ovum fertilization.