CN113846156A

CN113846156A - MOS gene, primer and kit for judging female primary infertility and/or test tube infant fate and application

Info

Publication number: CN113846156A
Application number: CN202111231317.2A
Authority: CN
Inventors: 张松英; 林戈; 范衡宇; 张银丽; 郑伟; 童晓嵋; 金佳敏; 任佩佩
Original assignee: Zhejiang University ZJU; Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Current assignee: Zhejiang University ZJU; Reproductive and Genetic Hospital of CITIC Xiangya Co Ltd
Priority date: 2021-10-22
Filing date: 2021-10-22
Publication date: 2021-12-28

Abstract

The invention provides an MOS gene, a primer, a kit and application for judging female primary infertility and/or test tube infant fate, and belongs to the technical field of gene detection. The invention provides application of an MOS gene in judging female primary infertility and/or test tube infant fate, wherein a nucleotide sequence of the MOS gene is shown as SEQ ID No. 1. The invention judges whether the MOS gene of the patient is mutated or not by detecting the MOS gene sequence of the patient so as to judge the primary infertility and/or test tube infant fate of the female, provides a novel method for predicting the primary infertility and test tube infant fate of the female, overcomes the defect that the infertile patient can inform the fate only after the auxiliary reproduction, is beneficial to improving the early diagnosis rate and the diagnosis accuracy rate of hereditary primary infertility, and can reduce the test tube infant cost and the injury to the patient once the mutation is detected.

Description

MOS gene, primer and kit for judging female primary infertility and/or test tube infant fate and application

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to an MOS gene, a primer, a kit and application for judging female primary infertility and/or test tube infant fate.

Background

According to the statistical data of the national Weijian Commission, the infertility rate of the current society of the breeding age couples reaches 12 to 15 percent. Assisted Reproduction Technology (ART) solves the fertility problem of some infertile patients, but still some patients experience repeated ART failures, which are usually manifested as embryonic development stagnation, debris and other abnormalities, and the like, resulting in the failure of non-transplantable embryos and test-tube infants (in vitro fertilization-embryo transplantation).

The female reproductive health is seriously harmed by primary infertility caused by genetic factors. The genetic factors are defined after the infertility patients often suffer from the economic loss and mental stress caused by the failure of multiple test-tube infants. The utilization of the patient resources and the excavation of new pathogenic genes are beneficial to widening the molecular genetic etiology spectrum of the hereditary primary female infertility, and the popularization of early screening, early prejudgment, early diagnosis and early intervention of the genetic etiology is beneficial to the benefit of the vast infertility patients.

The patent aims to explore the genetic etiology of primary infertility, thereby helping understanding pathogenesis, assisting clinical diagnosis, gene targeting repair and development of therapeutic drugs.

Disclosure of Invention

In order to solve the problems, the invention provides an MOS gene, a primer, a kit and application for judging female primary infertility and/or test tube infant fate. The invention can be used for widening the gene screening detection of the infertility patients, is beneficial to improving the early diagnosis rate and the diagnosis accuracy rate of hereditary primary infertility, and can reduce the cost of test-tube infants of the patients once mutation is detected.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides application of an MOS gene in judging female primary infertility and/or test tube infant fate, wherein the nucleotide sequence of the MOS gene is shown as SEQ ID No. 1.

Preferably, the primary infertility of the female and/or the test-tube infant fate is judged by detecting whether the MOS gene is mutated or not.

The invention provides a primer for detecting whether an MOS gene is mutated or not, which comprises a PCR amplification primer pair 1 for detecting the first half section of an MOS exon and a PCR amplification primer pair 2 for detecting the second half section of the MOS exon;

the nucleotide sequences of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon are respectively shown as SEQ ID No.2 and SEQ ID No. 3;

the nucleotide sequences of the PCR amplification primer pair 2 for detecting the later half section of the MOS exon are respectively shown as SEQ ID No.4 and SEQ ID No. 5.

Preferably, the nucleotide sequence of the amplification product of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon is shown as SEQ ID No. 6; the nucleotide sequence of the amplification product of the PCR amplification primer pair 2 for detecting the later half section of the MOS exon is shown as SEQ ID No. 7.

The invention provides a kit for detecting whether an MOS gene is mutated or not, which comprises the primer in the technical scheme.

Preferably, the kit further comprises 5x buffer solution, high-fidelity DNA polymerase and 10uM dNTPs.

Preferably, the kit amplification conditions are: at 95 ℃ for 3min, at 98 ℃ for 20s, at 57 ℃ for 20s, at 72 ℃ for 40s, for 35 cycles; 3min at 72 ℃.

The invention provides application of the primer in the technical scheme or the kit in the technical scheme in judging female primary infertility and/or test tube infant fate.

Preferably, the primers in the technical scheme or the kit in the technical scheme are adopted for amplification, the obtained amplification product is sequenced and compared with the standard sequence SEQ ID No.1 of the MOS gene, so that whether the MOS gene is mutated or not is determined; if the MOS gene is mutated, the female is judged to have primary infertility and/or test-tube infant failure.

The invention provides a medicine for repairing MOS gene mutation sites, which comprises the following 4 mutation sites:

has the advantages that:

the invention provides application of an MOS gene in judging female primary infertility and/or test tube infant fate, wherein the nucleotide sequence of the MOS gene is shown as SEQ ID No. 1. The invention judges whether the MOS gene of the patient is mutated or not by detecting the MOS gene sequence of the patient so as to judge the primary infertility and/or test tube infant fate of the female, provides a novel method for predicting the primary infertility and test tube infant fate of the female, overcomes the defect that the infertile patient can inform the fate only after the auxiliary reproduction, is beneficial to improving the early diagnosis rate and the diagnosis accuracy rate of hereditary primary infertility, and can reduce the test tube infant cost and the injury to the patient once the mutation is detected.

Drawings

FIG. 1 shows the size of the PCR amplified product fragment of MOS gene;

FIG. 2 shows the distribution of MOS mutations in a patient on the primary structure and the conservation analysis among species;

FIG. 3 is a graph of family validation of Sanger sequencing on MOS mutation-containing patients;

FIG. 4 is a graph of early embryo development in control and MOS mutation-containing patients.

Detailed Description

The invention provides application of an MOS gene in judging female primary infertility and/or test tube infant fate, wherein the nucleotide sequence of the MOS gene is shown as SEQ ID No. 1. The female primary infertility refers to abnormal embryonic development and female infertility caused by oocyte cytoplasm immaturity. In the present invention, the MOS gene is located at the position 8q12.1 of the long arm of human chromosome 8 and contains only 1 exon. The invention preferably judges the primary infertility of the female and/or the test tube infant fate by detecting whether the MOS gene is mutated. Patients carrying MOS complex heterozygous or homozygous genetic mutations manifest themselves as infertility, as a partial egg cytoplasm immaturity (cytoplasm blacking, particle aggregation, abnormal mRNA degradation), total embryo dysplasia, and tube infant failure. Whether the MOS gene is mutated or not can be used as a marker for judging the abnormal development of the embryo, the failure of the test-tube infant and the female sterility caused by the immature oocyte cytoplasm. In the invention, the nucleotide sequence of the MOS gene is shown as SEQ ID No.1, and specifically comprises the following steps:

ATGCCCTCGCCCCTGGCCCTACGCCCCTACCTCCGGAGCGA GTTTTCCCCATCGGTGGACGCGCGGCCCTGCAGCAGTCCCTCA GAGCTACCTGCGAAGCTGCTTCTGGGGGCCACTCTTCCTCGGG CCCCGCGGCTGCCGCGCCGGCTGGCCTGGTGCTCCATTGACTG GGAGCAGGTGTGCTTGCTGCAGAGGCTGGGAGCTGGAGGGTTT GGCTCGGTGTACAAGGCGACTTACCGCGGTGTTCCTGTGGCCAT AAAGCAAGTGAACAAGTGCACCAAGAACCGACTAGCATCTCG GCGGAGTTTCTGGGCTGAGCTCAACGTAGCAAGGCTGCGCCAC GATAACATCGTGCGCGTGGTGGCTGCCAGCACGCGCACGCCCG CAGGGTCCAATAGCCTAGGGACCATCATCATGGAGTTCGGTGGC AACGTCACTTTACACCAAGTCATCTATGGCGCCGCCGGCCACCC TGAGGGGGACGCAGGGGAGCCTCACTGCCGCACTGGAGGACA GTTAAGTTTGGGAAAGTGTCTCAAGTACTCACTAGATGTTGTGA ACGGCCTGCTCTTCCTCCACTCGCAAAGCATTGTGCACTTGGAC CTGAAGCCCGCGAACATCTTGATCAGTGAGCAGGATGTCTGTA AAATTAGTGACTTCGGTTGCTCTGAGAAGTTGGAAGATCTGCTG TGCTTCCAGACACCCTCTTACCCTCTAGGAGGCACATACACCCA CCGCGCCCCGGAGCTCCTGAAAGGAGAGGGCGTGACGCCTAA AGCCGACATTTATTCCTTTGCCATCACTCTCTGGCAAATGACTAC CAAGCAGGCGCCGTATTCGGGGGAGCGGCAGCACATACTGTAC GCGGTGGTGGCCTACGACCTGCGCCCGTCCCTCTCCGCTGCCGT CTTCGAGGACTCGCTCCCCGGGCAGCGCCTTGGGGACGTCATC CAGCGCTGCTGGAGACCCAGCGCGGCGCAGAGGCCGAGCGCG CGGCTGCTTTTGGTGGATCTCACCTCTTTGAAAGCTGAACTCGG CTGA。

the invention judges whether the MOS gene of the patient is mutated or not by detecting the MOS gene sequence of the patient so as to judge the primary infertility and/or test tube infant fate of the female, provides a novel method for predicting the primary infertility and test tube infant fate of the female, overcomes the defect that the infertile patient can inform the fate only after the auxiliary reproduction, is beneficial to improving the early diagnosis rate and the diagnosis accuracy rate of hereditary primary infertility, and can reduce the test tube infant cost and the injury to the patient once the mutation is detected.

The invention provides a primer for detecting whether an MOS gene is mutated or not, which comprises a PCR amplification primer pair 1 for detecting the first half section of an MOS exon and a PCR amplification primer pair 2 for detecting the second half section of the MOS exon.

In the invention, the nucleotide sequences of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon are respectively shown as SEQ ID No.2 and SEQ ID No. 3. In the invention, the specific nucleotide sequence of SEQ ID No.2 is: 5'-CGAAGGAGTAGTCAGTCATGTTTC-3' are provided. In the invention, the specific nucleotide sequence of SEQ ID No.3 is: 5'-TCTCAGAGCAACCGAAGTCAC-3' are provided. In the invention, the nucleotide sequence of the amplification product of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon is shown as SEQ ID No.6, the optimized primer combination has high power, good specificity and single segment, and the length is 766bp (shown as A in figure 1); the specific sequence is as follows:

CGAAGGAGTAGTCAGTCATGTTTCCAAAGTCCCGCGGTT TCCCCTAGTCTCTTCATTCACTCCAGCGGCCCTGGTGTCCCCCT GCAAAGTGCGATGCCCTCGCCCCTGGCCCTACGCCCCTACCTCC GGAGCGAGTTTTCCCCATCGGTGGACGCGCGGCCCTGCAGCAG TCCCTCAGAGCTACCTGCGAAGCTGCTTCTGGGGGCCACTCTTC CTCGGGCCCCGCGGCTGCCGCGCCGGCTGGCCTGGTGCTCCAT TGACTGGGAGCAGGTGTGCTTGCTGCAGAGGCTGGGAGCTGG AGGGTTTGGCTCGGTGTACAAGGCGACTTACCGCGGTGTTCCT GTGGCCATAAAGCAAGTGAACAAGTGCACCAAGAACCGACTA GCATCTCGGCGGAGTTTCTGGGCTGAGCTCAACGTAGCAAGGC TGCGCCACGATAACATCGTGCGCGTGGTGGCTGCCAGCACGCG CACGCCCGCAGGGTCCAATAGCCTAGGGACCATCATCATGGAGT TCGGTGGCAACGTCACTTTACACCAAGTCATCTATGGCGCCGCC GGCCACCCTGAGGGGGACGCAGGGGAGCCTCACTGCCGCACT GGAGGACAGTTAAGTTTGGGAAAGTGTCTCAAGTACTCACTAG ATGTTGTGAACGGCCTGCTCTTCCTCCACTCGCAAAGCATTGTG CACTTGGACCTGAAGCCCGCGAACATCTTGATCAGTGAGCAGG ATGTCTGTAAAATTAGTGACTTCGGTTGCTCTGAGA。

in the invention, the nucleotide sequences of the PCR amplification primer pair 1 for detecting the later half section of the MOS exon are respectively shown as SEQ ID No.4 and SEQ ID No. 5. In the invention, the specific nucleotide sequence of SEQ ID No.4 is: 5'-GTACTCACTAGATGTTGTGAACGG-3' are provided. In the invention, the specific nucleotide sequence of SEQ ID No.5 is: 5'-TTCTTCGACATCTCCACTTCC-3' are provided. In the invention, the nucleotide sequence of the amplification product of the PCR amplification primer pair 2 for detecting the later half segment of the MOS exon is shown as SEQ ID No.7, and the optimized primer combination has high power, good specificity and single segment, and the length is 573bp (shown as B in figure 1); the specific sequence is as follows:

GTACTCACTAGATGTTGTGAACGGCCTGCTCTTCCTCCACT CGCAAAGCATTGTGCACTTGGACCTGAAGCCCGCGAACATCTT GATCAGTGAGCAGGATGTCTGTAAAATTAGTGACTTCGGTTGCT CTGAGAAGTTGGAAGATCTGCTGTGCTTCCAGACACCCTCTTAC CCTCTAGGAGGCACATACACCCACCGCGCCCCGGAGCTCCTGA AAGGAGAGGGCGTGACGCCTAAAGCCGACATTTATTCCTTTGC CATCACTCTCTGGCAAATGACTACCAAGCAGGCGCCGTATTCGG GGGAGCGGCAGCACATACTGTACGCGGTGGTGGCCTACGACCT GCGCCCGTCCCTCTCCGCTGCCGTCTTCGAGGACTCGCTCCCCG GGCAGCGCCTTGGGGACGTCATCCAGCGCTGCTGGAGACCCAG CGCGGCGCAGAGGCCGAGCGCGCGGCTGCTTTTGGTGGATCTC ACCTCTTTGAAAGCTGAACTCGGCTGACTGAAAACCTGGTCAA GATAAGTTTTTGTCTGATTCTATTTGTTTTTAAAGGAAGTGGAGA TGTCGAAGAA。

the invention provides a kit for detecting whether an MOS gene is mutated or not, which comprises the primer in the technical scheme. In view of the fact that the average GC content in the MOS gene fragment is 61 percent and the GC content of a part of the segment is as high as 80 percent, the kit also preferably comprises three components of 5x buffer solution, high-fidelity DNA polymerase and 10uM dNTPs, and can avoid the phenomenon that the common DNA polymerase generates base jumping in the segment with high GC content to generate false positive mutation, thereby influencing the accuracy of the experimental result. In the present invention, the 5x buffer is preferably a 5x high GC content buffer. In the present invention, the high fidelity DNA polymerase ensures accurate amplification of PCR fragments. In the present invention, the volume of the amplification system of the kit is preferably 50. mu.L, and comprises 2.5. mu.L of genomic DNA sample, 10. mu.L of 5 Xhigh GC content buffer, 1.5. mu.L of forward primer, 1.5. mu.L of reverse primer, 1.5. mu.L of dNTPs, 1. mu.L of high fidelity DNA polymerase and 32. mu.L of ultrapure water. In the present invention, the primer is preferably used after being diluted with water to a working solution having a concentration of 10 uM. In the present invention, it is preferable that the two primer pairs are amplified separately. In the present invention, the amplification conditions of the kit are preferably: at 95 ℃ for 3min, at 98 ℃ for 20s, at 57 ℃ for 20s, at 72 ℃ for 40s, for 35 cycles; 3min at 72 ℃. After obtaining the amplification products, the invention preferably sequences the two amplification products, and compares the sequencing products with the standard sequence SEQ ID No.1 of the MOS gene, thereby determining whether the MOS gene is mutated. In the invention, the sample detected by the kit is DNA, and the DNA sample is preferably from peripheral blood of a human to be detected.

The primer and the kit for detecting whether the MOS gene is mutated or not can be used for screening early embryo dysplasia and primary infertility caused by immature oocyte cytoplasm; the physician may be instructed to make a judgment of the cause of the disease, to classify the disease correctly, and to inform the patient whether it is appropriate to proceed with IVF or ICSI (tube infant).

The invention provides application of the primer in the technical scheme or the kit in the technical scheme in judging female primary infertility and/or test tube infant fate. The primers in the technical scheme or the kit in the technical scheme are preferably adopted for amplification, the obtained amplification product is sequenced and compared with the standard sequence SEQ ID No.1 of the MOS gene, and thus whether the MOS gene is mutated or not is determined; if the MOS gene is mutated, the female is judged to have primary infertility and/or test-tube infant failure.

the mutation site of the MOS gene provided by the invention can guide whether a patient with the gene mutation is suitable for performing the test-tube infant operation or not. If the patient does not contain a MOS mutation or only a MOS heterozygous mutation, the patient may be advised to undergo in vitro treatment, and if the patient does contain a compound heterozygous mutation or a homozygous mutation, the patient is advised to terminate the course of the in vitro infant and to undergo subsequent egg donation.

In order to further illustrate the present invention, the following examples are provided to describe in detail the MOS gene, primers, kit and application for determining female primary infertility and/or test tube infant outcome provided by the present invention, but they should not be construed as limiting the scope of the present invention.

EXAMPLE 1 Collection of samples and extraction of peripheral blood DNA

The patients with early embryo dysplasia and primary infertility caused by the immature ovum cytoplasm come from the reproductive center of certain subsidiary hospital of Zhejiang university in China and certain reproductive genetic outpatient clinic in Hunan. Diagnostic criteria are set forth by M T Zenzes et al (M.T.Zenzes, L.Belkien, J.Bordt, I.Kan, H.P. Schneider, E.Niesclag, Cytologic induction of human in vitro transduction failure. Fertil Steril.1985 Jun; 43(6): 883-91.). The sperm of male is checked normally, the ovary function, the menstrual cycle and the basic endocrine (sex hormone level) of female patients are normal, more than 5 ova are taken each time in more than 2 ovulation-promoting cycles, the cytoplasm of part of the ova is abnormally mature (shown as the phenomena of cytoplasm blackening, granule aggregation, abnormal ovum shape, discharge of a plurality of polar bodies or larger polar bodies and the like), the embryo development is stopped after fertilization, the fragments are serious and the like. The test was performed with informed consent, blood was collected and an informed consent was signed. All patients enrolled excluded other genital endocrine diseases by medical history. The control population of the test was 100 women with normal fertility, 200ul of the blood was sampled, DNA was extracted according to the instructions of a DNA extraction kit (Beijing Tiangen Biochemical technology Co., Ltd., DP304-03), and the concentration and purity of the DNA were measured by a Nanodrop2000 ultramicro spectrophotometer.

Example 2 detection of mutations in MOS Gene

The invention adopts PCR combined with sequencing to detect MOS gene mutation. Wherein, the PCR primers are a PCR amplification primer pair 1 for detecting the first half section of the MOS exon and a PCR amplification primer pair 2 for detecting the second half section of the MOS exon; the nucleotide sequences of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon are respectively shown as SEQ ID No.2 and SEQ ID No. 3; the nucleotide sequences of the PCR amplification primer pair 2 for detecting the later half section of the MOS exon are respectively shown as SEQ ID No.4 and SEQ ID No. 5. The nucleotide sequence of the amplification product of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon is shown as SEQ ID No. 6; the nucleotide sequence of the amplification product of the PCR amplification primer pair 2 for detecting the second half segment of the MOS exon is shown as SEQ ID No.7, the fragment size of the PCR product of the MOS gene is shown in figure 1, wherein A is the product amplified by the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon; b is the product amplified by the PCR amplification primer pair 2 for detecting the later half section of the MOS exon. The specific PCR reaction conditions were as follows: the genomic DNA of the patient is used as a template, and two pairs of primer pairs (SEQ ID No.2 and SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5) are used for PCR amplification aiming at the exons of the MOS gene. The amplification system was 50. mu.L, 2.5. mu.L of genomic DNA sample, 10. mu.L of 5 Xhigh GC content buffer, 1.5. mu.L of forward primer, 1.5. mu.L of reverse primer, 1.5. mu.L of dNTPs, 1. mu.L of high fidelity DNA polymerase and 32. mu.L of ultrapure water. The primers were diluted with water to give a working solution of 10uM concentration and used. The amplification conditions were: at 95 ℃ for 3min, at 98 ℃ for 20s, at 57 ℃ for 20s, at 72 ℃ for 40s, for 35 cycles; 3min at 72 ℃. The resulting product, purified and further sequenced for sequencing on ABI 3730. Analysis of the results was performed by HLA Fusion software (One lambda, CA, USA, HLA Fusion 3.0).

Example 3 MOS Gene mutation and Primary infertility due to embryonic dysplasia

In the invention, 20 cases of patients with recurrent embryonic dysplasia and test tube failure are collected, PCR is carried out by the steps of the embodiment 2 to generate two DNA fragment products (A and B in figure 1) covering the full length of the MOS gene, and the mutation of the MOS gene is detected by Sanger sequencing to discover 3 cases of patients with primary infertility caused by early embryonic dysplasia due to the MOS gene mutation. Among these, patient 1 carries pure and missense mutations (c.285C > A, p.Asn95Lys), patient 2 carries complex heterozygous missense mutations (c.416T > C, p.Met139Thr; c.737G > A, p.Arg246His), and patient 3 carries pure and nonsense mutations (c.960C > A, p.Cys320Ter). The corresponding mutation site information is shown in Table 1.

TABLE 1 patient MOS Gene mutation information

The distribution display of MOS mutations in 3 patients on primary structure and the analysis of conservation among species are shown in FIG. 2. After informed consent of patients, 3 patients collected the anticoagulation blood of parents, and the MOS gene mutation was detected according to the step of the above example 2, and the compound heterozygous missense mutation, pure and missense mutation or pure and nonsense mutation carried by the 3 patients were respectively inherited from the heterozygous mutation carried by the parents. The results of Sanger sequencing family validation of 3 patients with MOS mutations are shown in FIG. 3.

In the tube infant, the Day of ova aspiration is defined as Day 0, after in vitro fertilization, a fertilized egg is generated in Day 1, an 8-cell embryo is generated in Day3, a blastula is generated in Day 5, and both the 8-cell embryo of Day3 and the blastula of Day 5 can be used for transplantation; however, most of the embryos of patients carrying the MOS biallelic mutation can only develop to 2-cell to 5-cell embryos (i.e., stunted or blocked development) in the Day3 embryo and contain fragments in different proportions, such embryos cannot be generally used for transplantation or cryopreservation, and when the embryos are continuously cultured to Day 5, all the embryos are stunted to develop and cannot form blastula, such embryos cannot be used for transplantation or cryopreservation of the embryos. The patient is confronted with a non-transplantable embryo and is informed of the failure of the test tube infant. The results of early embryo development in normal women and in women with MOS mutations are shown in FIG. 4.

The results of the above embodiments show that the invention overcomes the defect that the infertile patients can only inform the fate after assisted reproduction, is beneficial to improving the early diagnosis rate and the diagnosis accuracy of hereditary primary infertile, and can reduce the cost of test-tube babies of patients and the harm to the patients once the mutation is detected.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> Zhejiang university

REPRODUCTIVE & GENETIC HOSPITAL OF CITIC-XIANGYA Co.,Ltd.

<120> MOS gene, primer, kit and application for judging female primary infertility and/or test tube infant fate

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1041

<212> DNA

<213> MOS(MOS)

<400> 1

atgccctcgc ccctggccct acgcccctac ctccggagcg agttttcccc atcggtggac 60

gcgcggccct gcagcagtcc ctcagagcta cctgcgaagc tgcttctggg ggccactctt 120

cctcgggccc cgcggctgcc gcgccggctg gcctggtgct ccattgactg ggagcaggtg 180

tgcttgctgc agaggctggg agctggaggg tttggctcgg tgtacaaggc gacttaccgc 240

ggtgttcctg tggccataaa gcaagtgaac aagtgcacca agaaccgact agcatctcgg 300

cggagtttct gggctgagct caacgtagca aggctgcgcc acgataacat cgtgcgcgtg 360

gtggctgcca gcacgcgcac gcccgcaggg tccaatagcc tagggaccat catcatggag 420

ttcggtggca acgtcacttt acaccaagtc atctatggcg ccgccggcca ccctgagggg 480

gacgcagggg agcctcactg ccgcactgga ggacagttaa gtttgggaaa gtgtctcaag 540

tactcactag atgttgtgaa cggcctgctc ttcctccact cgcaaagcat tgtgcacttg 600

gacctgaagc ccgcgaacat cttgatcagt gagcaggatg tctgtaaaat tagtgacttc 660

ggttgctctg agaagttgga agatctgctg tgcttccaga caccctctta ccctctagga 720

ggcacataca cccaccgcgc cccggagctc ctgaaaggag agggcgtgac gcctaaagcc 780

gacatttatt cctttgccat cactctctgg caaatgacta ccaagcaggc gccgtattcg 840

ggggagcggc agcacatact gtacgcggtg gtggcctacg acctgcgccc gtccctctcc 900

gctgccgtct tcgaggactc gctccccggg cagcgccttg gggacgtcat ccagcgctgc 960

tggagaccca gcgcggcgca gaggccgagc gcgcggctgc ttttggtgga tctcacctct 1020

ttgaaagctg aactcggctg a 1041

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cgaaggagta gtcagtcatg tttc 24

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tctcagagca accgaagtca c 21

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtactcacta gatgttgtga acgg 24

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttcttcgaca tctccacttc c 21

<210> 6

<211> 766

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgaaggagta gtcagtcatg tttccaaagt cccgcggttt cccctagtct cttcattcac 60

tccagcggcc ctggtgtccc cctgcaaagt gcgatgccct cgcccctggc cctacgcccc 120

tacctccgga gcgagttttc cccatcggtg gacgcgcggc cctgcagcag tccctcagag 180

ctacctgcga agctgcttct gggggccact cttcctcggg ccccgcggct gccgcgccgg 240

ctggcctggt gctccattga ctgggagcag gtgtgcttgc tgcagaggct gggagctgga 300

gggtttggct cggtgtacaa ggcgacttac cgcggtgttc ctgtggccat aaagcaagtg 360

aacaagtgca ccaagaaccg actagcatct cggcggagtt tctgggctga gctcaacgta 420

gcaaggctgc gccacgataa catcgtgcgc gtggtggctg ccagcacgcg cacgcccgca 480

gggtccaata gcctagggac catcatcatg gagttcggtg gcaacgtcac tttacaccaa 540

gtcatctatg gcgccgccgg ccaccctgag ggggacgcag gggagcctca ctgccgcact 600

ggaggacagt taagtttggg aaagtgtctc aagtactcac tagatgttgt gaacggcctg 660

ctcttcctcc actcgcaaag cattgtgcac ttggacctga agcccgcgaa catcttgatc 720

agtgagcagg atgtctgtaa aattagtgac ttcggttgct ctgaga 766

<210> 7

<211> 573

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtactcacta gatgttgtga acggcctgct cttcctccac tcgcaaagca ttgtgcactt 60

ggacctgaag cccgcgaaca tcttgatcag tgagcaggat gtctgtaaaa ttagtgactt 120

cggttgctct gagaagttgg aagatctgct gtgcttccag acaccctctt accctctagg 180

aggcacatac acccaccgcg ccccggagct cctgaaagga gagggcgtga cgcctaaagc 240

cgacatttat tcctttgcca tcactctctg gcaaatgact accaagcagg cgccgtattc 300

gggggagcgg cagcacatac tgtacgcggt ggtggcctac gacctgcgcc cgtccctctc 360

cgctgccgtc ttcgaggact cgctccccgg gcagcgcctt ggggacgtca tccagcgctg 420

ctggagaccc agcgcggcgc agaggccgag cgcgcggctg cttttggtgg atctcacctc 480

tttgaaagct gaactcggct gactgaaaac ctggtcaaga taagtttttg tctgattcta 540

tttgttttta aaggaagtgg agatgtcgaa gaa 573

Claims

The application of the MOS gene in judging the primary infertility and/or test tube infant fate of women is characterized in that the nucleotide sequence of the MOS gene is shown as SEQ ID No. 1.
2. Use according to claim 1, wherein the primary infertility and/or test tube infant fates of the female is judged by detecting the presence or absence of a mutation in the MOS gene.
3. The primers for detecting whether the MOS gene is mutated or not are characterized by comprising a PCR amplification primer pair 1 for detecting the first half section of the MOS exon and a PCR amplification primer pair 2 for detecting the second half section of the MOS exon;

the nucleotide sequences of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon are respectively shown as SEQ ID No.2 and SEQ ID No. 3;

the nucleotide sequences of the PCR amplification primer pair 2 for detecting the later half section of the MOS exon are respectively shown as SEQ ID No.4 and SEQ ID No. 5.
4. The primer according to claim 3, wherein the nucleotide sequence of the amplification product of the PCR amplification primer pair 1 for detecting the first half segment of the MOS exon is shown as SEQ ID No. 6; the nucleotide sequence of the amplification product of the PCR amplification primer pair 2 for detecting the later half section of the MOS exon is shown as SEQ ID No. 7.
5. A kit for detecting whether a MOS gene is mutated, comprising the primer of claim 3.
6. The kit of claim 5, wherein the kit further comprises 5x buffer, high fidelity DNA polymerase and 10uM dNTPs.
7. The kit of claim 5, wherein the kit amplification conditions are: at 95 ℃ for 3min, at 98 ℃ for 20s, at 57 ℃ for 20s, at 72 ℃ for 40s, for 35 cycles; 3min at 72 ℃.
8. Use of the primer of claim 3 or the kit of any one of claims 5 to 7 for the determination of primary infertility and/or test tube infant outcome in a female.
9. The use of claim 7, wherein the primer of claim 3 or the kit of any one of claims 5 to 7 is used for amplification, and the obtained amplification product is sequenced and compared with the standard sequence SEQ ID No.1 of the MOS gene to determine whether the MOS gene is mutated; if the MOS gene is mutated, the female is judged to have primary infertility and/or test-tube infant failure.
10. The medicine for repairing the MOS gene mutation site is characterized in that the mutation site comprises 4 of the following:

GenomicPositiononChr8(bp) cDNAChange ProteinChange 57,026,257 c.285C>A p.Asn95Lys 57,026,126 c.416T>C p.Met139Thr 57,025,805 c.737G>A p.Arg246His 57,025,582 c.960C>A p.Cys320Ter

。