CN105296409B - One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere - Google Patents
One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere Download PDFInfo
- Publication number
- CN105296409B CN105296409B CN201510412006.4A CN201510412006A CN105296409B CN 105296409 B CN105296409 B CN 105296409B CN 201510412006 A CN201510412006 A CN 201510412006A CN 105296409 B CN105296409 B CN 105296409B
- Authority
- CN
- China
- Prior art keywords
- pgl
- gene
- nanosphere
- alkaline
- coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses engineering bacterias and its construction method that one plant is used for One-step production alkaline pectin enzyme immobilization nanosphere, belong to enzyme immobilization technology field.The present invention constructs one plant of recombinant escherichia coli strain E.coli BL21 λ (DE3) pABC-PGL by the method for genetic recombination, is preserved in the common Bio-Centers of China Committee for Culture Collection of Microorganisms, and culture presevation number is CGMCC NO.10911.The present invention is based on the methods of recombinant escherichia coli strain disclosed above production immobilization alkaline pectase nanosphere：Utilize the method for Gene Fusion, current industrial widely applied alkaline pectinase gene is fused on the N-terminal of pha synthesizing enzyme gene phaC by link peptide, and this recombination segment is converted into recombinant bacterium and carries out inducing expression, energy synthetic surface has the nanosphere complex of alkaline pectase in recombinant bacterium body, alkaline pectase has just been effectively incorporated into nanosphere surface in this way, immobilization alkaline pectase is formed, a step realizes the production of alkaline pectin enzyme immobilizatio.
Description
Technical field
The invention belongs to enzyme immobilization technology fields, are related to a kind of new side of One-step production immobilization alkaline pectase
Method, in particular to one plant for One-step production alkaline pectin enzyme immobilization nanosphere engineering bacteria and its construction method with answer
With.
Background technique
Alkaline pectase refers generally to galacturonan lyase (E.C.4.2.2.2, polygalacturonate
Lyase, PGL), optimum pH can disconnect Pectin polymers main chain 8~10 under high ph conditions, generate unsaturated
Oligogalacturonans.The enzyme is a kind of important emerging enzyme in industrial circle, is widely used in inducing plant disease-resistant, pectin
Wastewater treatment and the fermentation of jamoke etc..The alkaline pectate lyase of research discovery in recent years is a kind of important clean manufacturing
With enzyme, mainly apply to the industries such as the biorefining of paper pulp bleaching and textile, traditional weaving essence is substituted by enzymatic hydrolysis refining
Refining come the problems such as solving environment and the energy, quality with all have the advantages that in terms of environmental protection traditional handicraft can not compared with.With alkali
The emergence of property pectin lyase new application, market is increasing to the demand of the enzyme, therefore, alkaline pectin ester lyases
It is the hot subject of recent years abroad research.
In order to improve the stability of alkaline pectase, promotes its reuse, be convenient for continuous industrialized production, alkaline fruit
Glue enzyme immobilizatio is always hot spot concerned by people.Traditional alkaline pectin enzyme immobilization method mainly includes：Absorption method, packet
Bury legal, cross-linking method of method, covalently bonded etc..But traditional process for fixation cuts both ways：Though 1. absorption method manufacturing conditions it is mild,
It is easy, at low cost, but enzyme in conjunction with carrier loosely, it is easy to fall off.2. covalently bonded is legal and although cross-linking method enzyme is in conjunction with carrier
Securely, enzyme is not easily to fall off, but reaction condition is fiercer, enzyme easy in inactivation, meanwhile, production formality is also cumbersome.3. though investment is not
It is influenced by chemical reaction, the immobilised enzymes of higher vigor can be made, enzyme is also not easily to fall off, but enzyme is limited in certain load
In vivo, the range for combining enzyme-to-substrate becomes smaller, and affects the performance of enzymatic activity.Meanwhile traditional immobilization technology substantially may be used
To be divided into three steps：The separating-purifying of enzyme, carrier preparation and the combination of enzyme and carrier；Complex process, at high cost, enzyme activity recycling
Rate is low.These all limit the industrialized production and application of alkaline pectase.Therefore, explore it is cheap, efficiently, application it is strong
The new method of immobilization alkaline pectase production, is the technical bottleneck for breaking current immobilised enzymes, solves immobilization alkaline pectin
Enzyme industrialized production and the key of application.
Polyhydroxyalkanoate (polyhydroxyalkanoates, PHA) is many bacteriums in the case where nutrient imbalance
A kind of intracellular polyester of synthesis, spherical, diameter about 50~300nm, the intracellular polyester of the spherical shape is by a hydrophobic PHA core
The heart and by phosphatide limitans and film be embedded in or attachment protein constitute.Pha synthesizing enzyme phaC is PHA biosynthesis and nanosphere shape
At key enzyme, end is synthesized with PHA molecular backbone by covalent bond and is connected, to be positioned at the surface of PHA nanosphere.
In recent years, with the development of molecular biology, external source functional protein and PHA polymerase are subjected to amalgamation and expression,
Energy synthetic surface has the nanosphere complex of functional protein in recombinant microorganism body, and such functional protein is just efficiently tied
Nanosphere surface has been closed, functional microsphere is formed.Since nanosphere is with individual inclusion body in microbial cell
Form exists, therefore so that it is separated from cell by the method for clasmatosis and centrifugation and obtain pure
Change.Currently, passing through merging antibody binding domain, biologically active polypeptide molecule, antigen fragment etc. and PHA polymerase PhaC
Expression has been successfully prepared living for the biology of bio-separation, protein purification, drug delivery, medical diagnosis on disease and enzyme immobilizatio
Property microballoon, become a kind of cheap, efficient protein immobilization and present new technology.
Currently, being had not been reported using the One-step production that the technology immobilizes alkaline pectase.
Summary of the invention
In order to overcome defect existing for existing enzyme immobilization technology, the purpose of the present invention is to provide one plant to be used for one-step method
The engineering bacteria and its construction method of production alkaline pectin enzyme immobilization nanosphere and application.
The present invention is achieved through the following technical solutions：
The invention discloses one plant of recombinant escherichia coli strain, which is named as E.coli BL21 λ
(DE3) pABC-PGL, is preserved in the common Bio-Centers of China Committee for Culture Collection of Microorganisms, and culture presevation number is
CGMCC NO.10911。
The invention also discloses the construction methods of above-mentioned recombinant escherichia coli strain, include the following steps：
(1) by the fusion of PHA precursor synthase gene phaAB, alkaline pectinase gene pgl and link peptide linker
Pgl-linker and pha synthesizing enzyme gene phaC are sequentially inserted into vector plasmid pCDFDuet-1, and building obtains recombinant plasmid
pABC-PGL；
(2) recombinant plasmid pABC-PGL is converted into E. coli BL21 λ (DE3), obtains genetic engineering large intestine bar
Bacteria strain E.coli BL21 λ (DE3) pABC-PGL.
Alkaline pectinase gene pgl is selected from bacillus subtilis Bacillus subtilis.
Pha synthesizing enzyme gene phaC derives from Ralstonia eutropha.
The concrete operations of step (1) construction recombination plasmid pABC-PGL include the following steps：
1) PHA precursor synthase gene phaAB is obtained using PCR amplification, then uses restriction enzyme cut vector
PHA precursor synthase gene phaAB is inserted into vector plasmid by plasmid pCDFDuet-1 and PHA precursor synthase gene phaAB
In pCDFDuet-1, vector plasmid pAB is obtained；
2) restriction enzyme cut vector plasmid pAB and gene pgl-linker is used, then by gene pgl-
Linker is inserted into plasmid pAB, obtains vector plasmid pAB-PGL；
3) phaC gene is obtained using PCR amplification, then uses restriction enzyme cut vector plasmid pAB-PGL and base
Because of phaC, gene phaC is inserted into vector plasmid pAB-PGL, recombinant plasmid pABC-PGL is obtained.
The nucleotide sequence of the fusion pgl-linker of the alkaline pectinase gene pgl and link peptide linker is such as
Shown in SEQ.ID.NO.1；The nucleotide sequence of pha synthesizing enzyme gene phaC is as shown in SEQ.ID.NO.2.
The invention also discloses produce alkalinity based on recombinant escherichia coli strain One-step production immobilization disclosed above
The method of pectase nanosphere, by recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain in minerals culture
After carrying out inducing expression culture in base, then through separating-purifying, obtain alkaline pectase nanosphere.
It is described to lure recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain in mineral medium
Expression is led, concrete operations are：
Firstly, recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain is incubated overnight in LB culture medium
Seed liquor access is equipped in the 500mL triangular flask of 100mL MM culture medium as seed liquor, then by 2% inoculum concentration, wherein
The IPTG of the glucose of 1g/L, the Streptomycin of 100mg/L and 0.2g/L, 30 DEG C, 200rpm/ are separately added in MM culture medium
It is cultivated 48 hours under conditions of min；
Wherein the glucose of 0.5g/L, Streptomycin and IPTG are added when cultivating and starting, the grape of another 0.5g/L
Sugar is added after 24 hours of incubation.
The separating-purifying, concrete operations are：
Fermentation liquid is collected, supernatant is abandoned in centrifugation；Bacterium mud is sufficiently washed with 10mM phosphate buffer, then by bacterium mud weight
It is suspended from 10mM phosphate buffer；Then, ultrasonication is handled 20 minutes；By the method for glycerol density gradient centrifugation from thallus
Microballoon is purified in cell pyrolysis liquid, and is sufficiently washed with microballoon of the 50mM phosphate buffer to purifying, removal glycerol residual；
It is finally freeze-dried to obtain alkaline pectin enzyme immobilization nanosphere solid powder.
Compared with prior art, the invention has the following beneficial technical effects：
The present invention constructs plant weight group E. coli BL21 λ (DE3) pABC- by the method for genetic recombination
Current industrial widely applied alkaline pectinase gene is fused to pha synthesizing enzyme gene phaC by PGL, the recombination bacillus coli
C-terminal on, and this recombination segment is converted into host strain and carries out inducing expression, energy synthetic surface in host bacterial
Nanosphere complex with alkaline pectase, such alkaline pectase have just been effectively incorporated into nanosphere surface, shape
At immobilization alkaline pectase, a step realizes the production of alkaline pectin enzyme immobilizatio.This method has the advantage that：
1, the cumbersome process for avoiding conventional method, lowers production cost significantly；
2, enzyme is connected by covalent bond with carrier PHA, is firmly combined, not easily to fall off；
3, enzyme realizes immobilization while production, and the space structure of enzyme is not destroyed by other physical or chemical factories, system
The immobilized enzyme obtained is higher；
4, enzyme is connected to outside carrier, enzyme-to-substrate combine it is unrestricted, do not influence the performance of enzymatic activity；
5, it is present in into the cell due to nanosphere with individual inclusion bodies, passes through the side of clasmatosis and centrifugation
Method can be such that it separates from cell, and separation and Extraction step is simple, efficient.
Preservation explanation
The present invention has carried out following preservations to described recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL：
The preservation time：On May 25th, 2015, preservation place：China, Beijing.Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Number, Institute of Microorganism, Academia Sinica, China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC)；
Deposit number is CGMCC No.10911.
Classification naming is：Escherichia coli, Escherichia coli.
Detailed description of the invention
Fig. 1 is the illustraton of model for recombinating one-step synthesis alkaline pectin enzyme immobilization nanosphere in thallus；
Fig. 2 is the Technology Roadmap of recombinant plasmid pABC-PGL building.
Specific embodiment
Below with reference to specific embodiment, the present invention is described in further detail, it is described be explanation of the invention and
It is not to limit.
The method of One-step production alkaline pectase biological fixnig nanosphere provided by the invention.Referring to Fig. 1, first
Alkaline pectinase gene PGL is fused on the N-terminal of pha synthesizing enzyme gene phaC by one section of link peptide, is then recombinated this
Genetic fragment, which is converted into Escherichia coli, carries out inducing expression, when to synthesize PHA in recombinant microorganism body micro- by pha synthesizing enzyme phaC
When ball, alkaline pectase PGL has also and then loaded to PHA microsphere surface together, and the alkaline pectase nanometer for becoming immobilization is micro-
One step of ball realizes the production of alkaline pectin enzyme immobilizatio.
1, the building of recombinant escherichia coli strain
1.1 PCR amplification phaAB genes and phaC gene
According to pBHR68 plasmid (containing the phaABC gene cluster for deriving from Ralstonia eutropha bacterial strain, by Tsing-Hua University
University professor Chen Guoqiang give) in phaAB gene and phaC gene DNA sequence dna design primer phaAB EcoRI/phaAB
Hind III, phaC no start XhoI/phaC stop Avr II, difference amplification coding PHA precursor synthase gene phaAB
With coding pha synthesizing enzyme gene phaC.
Primer sequence is as follows：
phaAB EcoRI:TTGGAATTCTTGATGACTGACGTTGTCATCGTATCCG
phaAB HindⅢ：ACTAAGCTTTCAGCCCATATGCAGGCCGC
phaC no start XhoI：AAACTCGAGGCGACCGGCAAAGGCG
phaC stop AvrⅡ：TTTCCTAGGTCATGCCTTGGCTTTGACGTATCG
PCR reaction system (50 μ l)：5×SF Buffer(with 10mM MgSO4):10 μ l, dNTP Mix (10mM
each):1 μ l, phaAB EcoRI/phaAB Hind III:Each 1 μ l or phaC no start XhoI/phaC stop Avr II:
Each 1 μ l, Phanta Super Fidelity DNA Polymerase：0.5 μ l, pBHR68:0.3μl,DMSO:1.5μl,DDW
up to 50μl。
PCR reaction condition is：95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 2min, 32
A circulation；72 DEG C of extension 5min.
1.2 artificial synthesized alkaline pectinase gene pgl-linker.
The pgl gene order of synthesis is with reference to B.subtilis pel gene (GenBank in NCBI:X74880), remove 5 '
The termination codon subsequence at the signal peptide sequence at end and 3 ' ends, and add the preceding paragraph by 12 of 36 alkali yl codings at 3 ' end ends
The flexible linker (GGGSGGGSGGGGS) of amino acid, makes pgl gene and phaC gene be linked together with the linker.
The building of 1.3 expression plasmid pABC-PGL
After the phaAB genetic fragment that amplification obtains is isolated and purified with gel, through III enzyme double digestion of EcoRI, Hind, simultaneously
With III double digestion expression vector pCDFDuet-1 of EcoRI, Hind.PCR product and carrier after double digestion are purified through PCR product to be tried
Agent box (generay, GK2051) recycling.By 22 DEG C of connection 3h of the PCR product being recovered to and expression vector, construction of expression vector
Then pAB converts bacillus coli DH 5 alpha competent cell, picking positive transformant, and is bacterium colony PCR and enzyme to positive transformant
Cut identification.
Continue the pgl-linker gene that synthesis obtains and the expression vector pAB that previous step constructs using Bgl respectively
II, XhoI is into double digestion.Pgl-linker genetic fragment and carrier after double digestion is through gel extraction, the pgl- that is recovered to
Linker segment and expression vector pAB are in 22 DEG C of connections 3h, construction of expression vector pAB-PGL.Then bacillus coli DH 5 alpha is converted
Competent cell, picking positive transformant, and digestion identification is done to positive transformant.
After finally the phaC genetic fragment that PCR amplification obtains is isolated and purified with gel, through II double digestion of XhoI, Avr.Together
When with III double digestion expression vector pAB-PGL of EcoRI, Hind.PCR product after double digestion is through through PCR product purification kit
Recycling, carrier gel extraction.By the PCR product being recovered to and expression vector 22 DEG C of connections 3h, construction of expression vector pABC-
Then PGL converts bacillus coli DH 5 alpha competent cell, picking positive transformant, and is bacterium colony PCR and enzyme to positive transformant
Cut identification.
The flow chart of expression plasmid is constructed as shown in Fig. 2, wherein：T7：T7 promoter；phaA(Re):It derives from
The beta-keto thiolase gene of R.eutropha bacterial strain；phaB(Re):From the acetoacetyl-CoA of R.eutropha bacterial strain
Reductase gene；PGL：Alkaline pectinase gene；PhaC(Re):From the pha synthesizing enzyme gene of R.eutropha bacterial strain；
SmR：Streptomycin resistance gene.Alkaline pectinase gene pgl and pha synthesizing enzyme gene phaC are inserted under second T7 promoter
Trip gives expression to PGL-phaC fusion protein under the starting of T7 promoter.
Expression vector pABC-PGL is converted E. coli BL21 λ (DE3) by 1.4
100 μ l competent cells are taken, 10 μ l connection products are added, mixes gently, places 30min on ice.By centrifuge tube 42
DEG C heat shock 90s.Quickly centrifuge tube is put on ice, is allowed to cool 2min.The not antibiotic SOC training of 800 μ l is added in every pipe
Base is supported, in 37 DEG C of shaking table low speed culture 1h.Low-speed centrifugal discards about 500 μ l supernatants, and remaining 500 μ l bacterium solutions is taken to be directly coated at
On LB solid culture ware containing 100 μ g/ml streptomysins.Plate is absorbed in 37 DEG C of positive place to liquid, and horizontalization plate is in 37 DEG C
Cultivate 18-24h.Picking monoclonal carries out digestion verification, and send to the raw work in Shanghai and carry out sequencing identification.
2, it inducing expression of the nanosphere in engineering bacteria and isolates and purifies
Inducing expression of 2.1 nanospheres in engineering bacteria
Expressive host bacterium E.coli BL21 λ (DE3) overnight incubation conduct in LB culture medium of the plasmid containing pABC-PGL
Seed liquor is inoculated into 100ml fermentation medium (mineral medium, table 1) by seed liquor according to 2% inoculum concentration, and is added
Enter glucose (1g/L), Streptomycin (100mg/L) and IPTG (0.2g/L), 30 DEG C, 200rpm cultivates 48 hours.Wherein
Glucose, Streptomycin and the IPTG of 0.5g/L is added when cultivating and starting, and the glucose of another 0.5g/L is small in culture 24
When after be added.
1 mineral medium formula of table
Using distilled water as solvent when components I, II configuration, using 1mol/L HCl as solvent when component III, IV configures.Components I,
II, III, the IV moist heat sterilization 20min at 121 DEG C respectively, to prevent reacting at high temperature between each component ingredient.
In 1L MM culture medium：Compositionⅱ：840mL；Components I：100mL；Component III：10mL；Component IV：1mL；20% Portugal
Grape sugar mother liquor：25mL；50mM IPTG：2mL；Amp/Sm：2/1mL；20% glucose mother liquid (culture adds afterwards for 24 hours)：25mL.
The separating-purifying of 2.2 nanospheres
50mL fermentation liquid is collected, 4000r/min is centrifuged 10min, abandons supernatant.10mM phosphate buffer sufficiently washs bacterium mud
Afterwards, bacterium mud is resuspended in 15ml10mM phosphate buffer.
Bacteria suspension stops 5S in 400W ice-bath ultrasonic 20min, ultrasonic 5S, sufficiently cracking somatic cells.
15mL cellular lysate liquid carries out glycerol density gradient centrifugation, is followed successively by from bottom to top in 40mL centrifuge tube：
88% glycerol 7.5mL, 44% glycerol 7.5mL, cellular lysate liquid 15mL.100000 × g ultracentrifugation 2.5h.
After centrifugation, nano particle is located at the white layer above 88% glycerin layer, carefully draws this white layer and collects microballoon, uses
The 50mM phosphate buffer of 10 times of volumes is sufficiently washed the microballoon of collection, finally freeze-dried to obtain microsphere powder.
The SDS-PAGE of 2.3 PGL-phaC albumen is detected and identification
The nanosphere 10mg that purification is obtained is added 1mL PBS and is resuspended, after Bradford method carries out protein quantification,
After taking suitable microspheres solution to mix with 5 × sds gel sample loading buffer, 10min is boiled, carries out 10%SDS-PAGE albumen electricity
Swimming.
Polyacrylamide gel electrophoresis：Bio-Rad electrophoretic apparatus is installed, 10% separation gel of 5% spacer gel and lower layer is recorded,
About 1h need to respectively be solidified.The above-mentioned sample prepared is loaded in order.Electrophoresis starting voltage is 90V, when dye front reaches
After separation gel, voltage is adjusted to stop electrophoresis when continuing electrophoresis to Bromophenol Blue dye forward position arrival separation gel bottom to 110V.It removes
Gel is placed in room temperature in Coomassie brilliant blue dye liquor and dyes 1-3 hours, is put into destainer and decolourizes up to gel-tape is clear, background
Until transparent, electrophoresis result is observed.
The enzyme activity determination of 2.4 alkaline pectin enzyme immobilization nanospheres
One-step production go out alkaline pectase biological fixnig nanosphere be through alkaline pectase enzyme activity determination：
129U/g。
Measuring method is as follows：The microsphere powder for taking 10mg is completely dissolved in the PBS solution of 1mL 50mM, and dilution is certain
Multiple.Enzyme reaction system is：Enzyme dilution 20 μ L, the glycine-NaOH buffer (0.2mol.L containing 0.2%PGA-1,
0.44mmol.L-1CaCl2, pH9.4) and 2mL, inactive enzyme solution is blank control.Reaction condition is：45 DEG C of water-baths
15min uses 3mL phosphoric acid solution (0.03mol.L-1) reaction is terminated, reactant absorbance value is measured at 235nm.
Enzyme-activity unit is defined as：Cracking polygalacturonic acid generates corresponding to 1 μm of ol unsaturation polygalacturonic acid within 1 minute
Enzyme amount.
Alkaline pectase (E.C.4.2.2.2) immobilization nanosphere of the present invention, the nanosphere be by
Hydrophobic polymer material preparation, hydrophobic polymer micro-sphere material be PHA, by poly butyric ester, poly- Hydroxyoctanoic acid ester,
Poly- hydroxydecanoic acid ester, hydroxybutyric acid-hydroxypentanoic acid copolyesters, hydroxybutyric acid-hydroxycaproic acid copolyesters, hydroxybutyric acid-hydroxyl are pungent
One or more of sour copolyesters, hydroxybutyric acid-hydroxypentanoic acid-hydroxycaproic acid copolyesters are polymerized.
Load has alkaline pectase protein molecular on the nanosphere surface, and alkaline pectase protein molecular passes through covalent bond
It is connected with the pha synthesizing enzyme protein molecular phaC of microsphere surface.
The alkaline pectase protein molecular is to merge egg by track fusion with the protein molecular phaC of microsphere surface
White, which is PGL-PhaC；Link peptide is additionally provided between alkaline pectin enzyme molecule and phaC albumen, link peptide is
GGGSGGGSGGGS。
The alkaline pectinase gene is selected from bacillus subtilis Bacillus subtilis (GenBank:X74880)
Alkaline pectinase gene pgl；The pha synthesizing enzyme gene phaC derives from Ralstonia eutropha.
Claims (8)
1. recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL, is preserved in Chinese microorganism strain preservation conservator
The common Bio-Centers of meeting, culture presevation number are CGMCC NO.10911；The recombination bacillus coli is that one kind is able to produce alkalinity
The recombinant bacterial strain of pectin enzyme immobilization nanosphere.
2. the construction method of recombination bacillus coli described in claim 1, which is characterized in that include the following steps：
(1) by the fusion pgl- of PHA precursor synthase gene phaAB, alkaline pectinase gene pgl and link peptide linker
Linker and pha synthesizing enzyme gene phaC are sequentially inserted into expression plasmid pCDFDuet-1, and building obtains recombinant plasmid pABC-
PGL；
Concrete operations include the following steps：
1) PHA precursor synthase gene phaAB is obtained using PCR amplification, then uses restriction enzyme cut vector plasmid
PCDFDuet-1 and PHA precursor synthase gene phaAB, then PHA precursor synthase gene phaAB is inserted into vector plasmid
In pCDFDuet-1, vector plasmid pAB is obtained；
2) restriction enzyme cut vector plasmid pAB and gene pgl-linker is used, then inserts gene pgl-linker
Enter in plasmid pAB, obtains vector plasmid pAB-PGL；
3) phaC gene is obtained using PCR amplification, then uses restriction enzyme cut vector plasmid pAB-PGL and gene
Gene phaC is inserted into vector plasmid pAB-PGL, obtains recombinant plasmid pABC-PGL by phaC；
(2) recombinant plasmid pABC-PGL is converted into E. coli BL21 λ (DE3), obtains recombinant escherichia coli strain
E.coli BL21λ(DE3)pABC-PGL。
3. the construction method of recombination bacillus coli according to claim 2, which is characterized in that alkaline pectinase gene pgl choosing
From bacillus subtilis Bacillus subtilis.
4. the construction method of recombination bacillus coli according to claim 2, which is characterized in that pha synthesizing enzyme gene phaC comes
Derived from Ralstonia eutropha.
5. the construction method of recombination bacillus coli according to claim 2, which is characterized in that the alkaline pectinase gene
The nucleotide sequence of the fusion pgl-linker of pgl and link peptide linker is as shown in SEQ.ID.NO.1；Pha synthesizing enzyme
The nucleotide sequence of gene phaC is as shown in SEQ.ID.NO.2.
6. special based on the method for recombination bacillus coli immobilization described in claim 1 production alkaline pectase nanosphere
Sign is：Recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain is subjected to induction table in mineral medium
Up to after culture, then through separating-purifying, obtain alkaline pectase nanosphere.
7. the method for immobilization production alkaline pectase nanosphere according to claim 6, it is characterised in that：It is described to incite somebody to action
Recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain carries out inducing expression culture in mineral medium, tool
Gymnastics conduct：
Firstly, recombination bacillus coli E.coli BL21 λ (DE3) pABC-PGL bacterial strain is incubated overnight conduct in LB culture medium
Seed liquor, then seed liquor access is equipped in the 500mL triangular flask of 100mL MM culture medium by 2% inoculum concentration, wherein MM is trained
Feeding base is separately added the IPTG of the glucose of 1g/L, the Streptomycin of 100mg/L and 0.2g/L, 30 DEG C, 200rpm/min
Under the conditions of cultivate 48 hours；
Wherein the glucose of 0.5g/L, Streptomycin and IPTG are added when cultivating and starting, and the glucose of another 0.5g/L exists
Culture is added after 24 hours.
8. the method for immobilization production alkaline pectase nanosphere according to claim 6, it is characterised in that：Described point
Concrete operations from purification are：
Fermentation liquid is collected, supernatant is abandoned in centrifugation；Bacterium mud is sufficiently washed with 10mM phosphate buffer, then bacterium mud is resuspended in
In 10mM phosphate buffer；Then, ultrasonication is handled 20 minutes；By the method for glycerol density gradient centrifugation from somatic cells
Microballoon is purified in lysate, and is sufficiently washed with microballoon of the 50mM phosphate buffer to purifying, removal glycerol residual；Finally
It is freeze-dried to obtain alkaline pectin enzyme immobilization nanosphere solid powder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510412006.4A CN105296409B (en) | 2015-07-14 | 2015-07-14 | One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510412006.4A CN105296409B (en) | 2015-07-14 | 2015-07-14 | One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105296409A CN105296409A (en) | 2016-02-03 |
| CN105296409B true CN105296409B (en) | 2018-11-27 |
Family
ID=55194245
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510412006.4A Active CN105296409B (en) | 2015-07-14 | 2015-07-14 | One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105296409B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6996680B2 (en) | 2017-09-25 | 2022-01-17 | 出光興産株式会社 | Bacterial cell manufacturing method |
| CN108623696B (en) * | 2018-04-20 | 2021-05-28 | 江南大学 | Method for immobilizing CBD-EndoS fusion enzyme by using cellulose |
| CN109287904A (en) * | 2018-09-07 | 2019-02-01 | 陕西省生物农业研究所 | A kind of preparation method of the fermented fruits and vegetables juice containing D-Psicose |
| CN110016472B (en) * | 2018-12-14 | 2021-01-19 | 西安交通大学 | DTE immobilized nano-microsphere, preparation method thereof and method for producing D-psicose based on DTE immobilized nano-microsphere |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102718869A (en) * | 2012-06-06 | 2012-10-10 | 西安交通大学 | Microballoon with immobilized presented immune co-stimulation molecules and preparation method of microballoon |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000006762A1 (en) * | 1998-07-30 | 2000-02-10 | Metabolix, Inc. | Production of block copolymers of polyhydroxyalkanoates in biological systems |
-
2015
- 2015-07-14 CN CN201510412006.4A patent/CN105296409B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102718869A (en) * | 2012-06-06 | 2012-10-10 | 西安交通大学 | Microballoon with immobilized presented immune co-stimulation molecules and preparation method of microballoon |
Non-Patent Citations (2)
| Title |
|---|
| Bacillus subtilis碱性果胶酶基因在大肠杆菌中的克隆和表达;肖静等;《高师理科学刊》;20110731;第31卷(第4期);摘要 * |
| Functional protein display on the surface of biobeads produced by recombinant Escherichia coli;Shuxiong Chen;《Massey University》;20150321;第28、29、37、38、45、48和109页，Figure 8、Figure10、Figure12 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105296409A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105296409B (en) | One plant of engineering bacteria and its construction method and application for producing immobilization alkaline pectase nanosphere | |
| CN104560844B (en) | A kind of tetrahydropyrimidine high yield colibacillus engineering and its application | |
| CN104593442B (en) | A kind of method of recombination bacillus coli High Density Cultivation production tetrahydropyrimidine | |
| CN106191025B (en) | A method of utilizing graphene oxide-metallic ion coordination immobilised enzymes | |
| CN110396505A (en) | Ketone group pantoic acid lactone reductase and its application | |
| Wen et al. | Enhanced photo-fermentative hydrogen production of Rhodopseudomonas sp. nov. strain A7 by biofilm reactor | |
| CN107446871A (en) | Produce genetic engineering bacterium and its construction method and the application of D phenyllactic acids | |
| CN109456960A (en) | A kind of method of redox graphene immobilization Phenylalanine dehydrogenase | |
| CN103898034A (en) | Method for biologically synthesizing poly-3-hydroxypropionic acid | |
| WO2023051077A1 (en) | Genetically engineered strain for producing polylactic acid and method for producing polylactic acid | |
| CN101463358B (en) | Nitrile hydratase gene cluster and use thereof | |
| CN110172470A (en) | A kind of method and application for expressing recombination human source prolyl -4- hydroxylase in Bichi yeast system | |
| CN105624128B (en) | Immobilized monoamine oxidase and application thereof in synthesis of chiral azabicyclo compound | |
| CN102191212B (en) | One kind production alkaline pectate lyase genetic engineering bacterium and its structure and application | |
| CN104673814B (en) | A kind of L threonine aldolases for coming from enterobacter cloacae and its application | |
| CN112063609A (en) | Method for preparing immobilized D-xylonic acid dehydratase | |
| CN108587990A (en) | A kind of organic phosphorus degrading reactive nanoparticles and the preparation method and application thereof | |
| CN113403245A (en) | Recombinant escherichia coli immobilized cell and application thereof | |
| CN106520870B (en) | High-density fermentation method for exogenously expressing tetanus toxin receptor binding region Hc | |
| JP5946080B2 (en) | Method for producing plastic raw materials and related substances in cyanobacteria | |
| CN102559733A (en) | Building method of lactococcus lactis genetic engineering bacterial strain loaded with clfA gene | |
| CN104762306B (en) | A kind of ocean esterase and its encoding gene E32 and application | |
| CN105200088B (en) | A kind of enzymatic conversion method DL-2- amino-△2The method of thiazoline -4- carboxylic acid synthesis L-cysteine | |
| CN103243054B (en) | Strain capable of producing carboxyethylhydantoinase and application thereof | |
| CN104450594B (en) | Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |