CN105296409A - Engineering bacterium, construction method and application for producing immobilized alkaline pectinase nano micro-spheres - Google Patents

Abstract

The invention discloses an engineering bacterium and a construction method for producing alkaline pectinase immobilized nano micro-spheres by the aid of one-step processes, and belongs to the technical field of immobilized enzymes. A recombinant Escherichia coli strain E.coli BL21 lambda (DE3) pABC-PGL constructed by the aid of the gene recombination method is preserved in the General Biology Center of the China Committee for Culture Collection of Microorganisms, and a strain preservation number of the recombinant Escherichia coli strain is CGMCC NO.10911. The engineering bacterium and the construction method for producing the immobilized alkaline pectinase nano micro-spheres on the basis of the Escherichia coli strains have the advantages that alkaline pectinase genes which are currently industrially widely applied are fused at N tail ends of PHA (phytohemagglutinin) synthesis enzyme genes phaC by connecting peptides by the aid of the gene fusion method, recombinant gene segments are transformed into recombinant bacteria to be expressed in an inducible manner, nano micro-sphere complexes can be synthesized in the recombinant bacteria, alkaline pectinase is carried on the surfaces of the nano micro-sphere complexes and can be effectively combined with the surfaces of the nano micro-spheres to form immobilized alkaline pectinase, and alkaline pectinase immobilization production can be implemented at one step.

Description

One strain is for the production of the engineering bacteria of immobilization alkaline pectase Nano microsphere and construction process thereof and application

Technical field

The invention belongs to enzyme immobilization technology field, relate to a kind of novel method of One-step production immobilization alkaline pectase, particularly a strain is used for the engineering bacteria of One-step production alkaline pectin enzyme immobilization Nano microsphere and construction process thereof and application.

Background technology

Alkaline pectase refers generally to galacturonan lyase (E.C.4.2.2.2, polygalacturonatelyase, PGL), its optimum pH is 8 ~ 10, Pectin polymers main chain can be disconnected under high ph conditions, produce undersaturated oligogalacturonans.This enzyme is a kind of important emerging enzyme at industrial circle, is widely used in that inducing plant is disease-resistant, the aspect such as the fermentation of pectin wastewater process and jamoke.Research in recent years finds that alkaline pectate lyase is a kind of important cleaner production enzyme, mainly apply to the industries such as the biorefining of association with pulp bleaching and textiles, substitute traditional weaving refining by enzymolysis refining and solve the problem such as environment and the energy, quality with all have in environmental protection traditional technology cannot compared with advantage.Along with the continuous appearance of alkaline pectate lyase novelty teabag, the demand of market to this enzyme is increasing, and therefore, alkaline pectin ester lyase is the hot subject of recent years abroad research.

In order to improve the stability of alkaline pectase, promoting that it is reused, being convenient to continuous print suitability for industrialized production, alkaline pectin enzyme immobilizatio is the focus that people pay close attention to always.Traditional alkaline pectin enzyme immobilization method mainly comprises: absorption method, entrapping method, covalently bonded are legal, crosslinking etc.But traditional process for fixation cuts both ways: though 1. absorption method manufacturing conditions is gentle, easy, cost is low, enzyme is combined loosely with carrier, easily comes off.Be combined with carrier firmly with crosslinking enzyme although 2. covalently bonded is legal, enzyme difficult drop-off, reaction conditions is fiercer, enzyme easy in inactivation, meanwhile, makes formality also more loaded down with trivial details.Though 3. entrapping method is not subject to chemical reaction impact, can obtain the immobilized enzyme of higher vigor, enzyme is difficult drop-off also, is limited in certain carrier by enzyme, and the scope that enzyme-to-substrate is combined diminishes, and have impact on the performance of enzymic activity.Meanwhile, traditional immobilization technology roughly can be divided into three steps: the separating-purifying of enzyme, the combination of carrier preparation and enzyme and carrier; Complex process, cost is high, and enzymatic activity recovery is low.These all limit suitability for industrialized production and the application of alkaline pectase.Therefore, exploring the novel method that the immobilization alkaline pectase cheap, efficient, applicability is strong is produced, is the technical bottleneck breaking current immobilized enzyme, solves the key of immobilization alkaline pectase suitability for industrialized production and application.

Polyhydroxyalkanoate (polyhydroxyalkanoates, PHA) be polyester in a kind of cell of synthesizing when nutrient imbalance of a lot of bacterium, spherical, diameter is 50 ~ 300nm about, and in this spherical cell, polyester is by a hydrophobic PHA core with by phosphatide limitans and film to embed or attachment protein is formed.Pha synthesizing enzyme phaC is the key enzyme that PHA biosynthesizing and Nano microsphere are formed, and synthesizes end and is connected, thus be positioned the surface of PHA Nano microsphere by covalent linkage and PHA molecular backbone chain.

In recent years, along with molecular biological development, external source functional protein and PHA polysaccharase are carried out amalgamation and expression, with regard to the Nano microsphere complex body of energy synthetic surface with functional protein in recombinant microorganism body, such functional protein has just been attached to Nano microsphere surface efficiently, forms functional microsphere.Because Nano microsphere is exist with independent inclusion bodies in microorganism cells, therefore by cytoclasis and centrifugal method just can easy, effectively make it be separated from cell and obtain purifying.At present, by by the amalgamation and expression with PHA polysaccharase PhaC such as antibody binding domain, biologically active polypeptides molecule, antigen fragment, successfully prepared the biological active microsphere for bioseparation, protein purification, useful for drug delivery, medical diagnosis on disease and enzyme immobilizatio, become a kind of cheap, efficiently protein immobilization present new technology.

At present, the One-step production of this being fixed of technology alkaline pectase is utilized to have not been reported.

Summary of the invention

In order to overcome the defect that existing enzyme immobilization technology exists, the object of the present invention is to provide a strain for the engineering bacteria of One-step production alkaline pectin enzyme immobilization Nano microsphere and construction process thereof and application.

The present invention is achieved through the following technical solutions:

The invention discloses a strain recombinant escherichia coli strain, this coli strain called after E.coliBL21 λ (DE3) pABC-PGL, be preserved in the common Bio-Centers of China Committee for Culture Collection of Microorganisms, culture presevation number is CGMCCNO.10911.

The invention also discloses the construction process of above-mentioned recombinant escherichia coli strain, comprise the following steps:

(1) by the fusion gene pgl-linker of PHA precursor synthase gene phaAB, alkaline pectinase gene pgl and connection peptides linker and pha synthesizing enzyme gene phaC successively insertion vector plasmid pCDFDuet-1, build and obtain recombinant plasmid pABC-PGL;

(2) by recombinant plasmid pABC-PGL transformation of E. coli E.coliBL21 λ (DE3), gene engineering colibacillus bacterial strain E.coliBL21 λ (DE3) pABC-PGL is obtained.

Alkaline pectinase gene pgl is selected from Bacillus subtilis.

Pha synthesizing enzyme gene phaC derives from Ralstoniaeutropha.

The concrete operations of step (1) construction recombination plasmid pABC-PGL comprise the steps:

1) pcr amplification is utilized to obtain PHA precursor synthase gene phaAB, then restriction enzyme cut vector plasmid pCDFDuet-1 and PHA precursor synthase gene phaAB is adopted, by in PHA precursor synthase gene phaAB insertion vector plasmid pCDFDuet-1, obtain vector plasmid pAB;

2) adopt restriction enzyme cut vector plasmid pAB and gene pgl-linker, then gene pgl-linker is inserted in plasmid pAB, obtain vector plasmid pAB-PGL;

3) utilize pcr amplification to obtain phaC gene, then adopt restriction enzyme cut vector plasmid pAB-PGL and gene phaC, by gene phaC insertion vector plasmid pAB-PGL, obtain recombinant plasmid pABC-PGL.

The nucleotide sequence of the fusion gene pgl-linker of described alkaline pectinase gene pgl and connection peptides linker is as shown in SEQ.ID.NO.1; The nucleotide sequence of pha synthesizing enzyme gene phaC is as shown in SEQ.ID.NO.2.

The invention also discloses the method for producing alkaline pectase Nano microsphere based on above-mentioned disclosed recombinant escherichia coli strain One-step production immobilization, after recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain is carried out abduction delivering cultivation in mineral medium, again through separating-purifying, obtain alkaline pectase Nano microsphere.

Described recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain is carried out abduction delivering in mineral medium, concrete operations are:

First, using recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain in LB substratum incubated overnight as seed liquor, by the inoculum size of 2%, seed liquor access is equipped with in the 500mL triangular flask of 100mLMM substratum again, wherein MM substratum separately adds the IPTG of the glucose of 1g/L, Streptomycin and 0.2g/L of 100mg/L, 30 DEG C, cultivate 48 hours under the condition of 200rpm/min;

Wherein the glucose of 0.5g/L, Streptomycin and IPTG add when cultivating and starting, and the glucose of another 0.5g/L adds after 24 hours of incubation.

Described separating-purifying, concrete operations are:

Collect fermented liquid, centrifugal, abandon supernatant; With 10mM phosphoric acid buffer, bacterium mud is fully washed, then bacterium mud is resuspended in 10mM phosphoric acid buffer; Then, ultrasonication process 20 minutes; By method purifying microballoon from somatic cells lysate of glycerol density gradient centrifugation, and fully wash with the microballoon of 50mM phosphoric acid buffer to purifying, remove glycerine and remain; Alkaline pectin enzyme immobilization Nano microsphere pressed powder is obtained finally by lyophilize.

Compared with prior art, the present invention has following useful technique effect:

The present invention constructs strain recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL by the method for gene recombination, the alkaline pectinase gene of current industrial widespread use is fused on the C-terminal of pha synthesizing enzyme gene phaC by this recombination bacillus coli, and this recombination fragment is converted in Host Strains carries out abduction delivering, with regard to the Nano microsphere complex body of energy synthetic surface with alkaline pectase in host bacterial, such alkaline pectase has just been attached to Nano microsphere surface effectively, form immobilization alkaline pectase, one step realizes alkaline pectin enzyme immobilizatio and produces.The method has following advantage:

1, avoid the cumbersome process of traditional method, production cost is lowered greatly;

2, enzyme is connected with carrier PHA by covalent linkage, in conjunction with firm, and difficult drop-off;

3, enzyme realizes immobilization while production, and the space structure of enzyme does not destroy by other physics or chemical factor, and obtained immobilized enzyme is higher;

4, enzyme is connected to carrier outside, and enzyme-to-substrate combines not limited, does not affect the performance of enzymic activity;

5, because Nano microsphere is present in cell with independent inclusion bodies, it just can be made to be separated from cell by cytoclasis and centrifugal method, separation and Extraction step is simple, efficient.

Preservation explanation

The present invention has carried out following preservation to described recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL:

The preservation time: on May 25th, 2015, preservation place: China, Beijing.No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC); Preserving number is CGMCCNo.10911.

Classification And Nomenclature is: colon bacillus, Escherichiacoli.

Accompanying drawing explanation

Fig. 1 is the model diagram of one-step synthesis alkaline pectin enzyme immobilization Nano microsphere in restructuring thalline;

Fig. 2 is the Technology Roadmap that recombinant plasmid pABC-PGL builds.

Embodiment

Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.

The method of One-step production alkaline pectase biological fixnig Nano microsphere provided by the invention.See Fig. 1, first alkaline pectinase gene PGL is fused on the N-terminal of pha synthesizing enzyme gene phaC by one section of connection peptides, then this recombination fragment is converted in intestinal bacteria and carries out abduction delivering, when pha synthesizing enzyme phaC synthesizes PHA microballoon in recombinant microorganism body, alkaline pectase PGL has also and then loaded to PHA microsphere surface together, becomes immobilized alkaline pectase Nano microsphere one step and realizes the production of alkaline pectin enzyme immobilizatio.

1, the structure of recombinant escherichia coli strain

1.1PCR amplification phaAB gene and phaC gene

According to pBHR68 plasmid (containing the phaABC gene cluster deriving from Ralstoniaeutropha bacterial strain, be so kind as to give by Tsing-Hua University professor Chen Guoqiang) in DNA sequence dna design primer phaABEcoRI/phaABHind III, the phaCnostartXhoI/phaCstopAvr II of phaAB gene and phaC gene, amplification coding PHA precursor synthase gene phaAB and coding pha synthesizing enzyme gene phaC respectively.

Primer sequence is as follows:

phaABEcoRI:TTGGAATTCTTGATGACTGACGTTGTCATCGTATCCG

phaABHindⅢ：ACTAAGCTTTCAGCCCATATGCAGGCCGC

phaCnostartXhoI：AAACTCGAGGCGACCGGCAAAGGCG

phaCstopAvrⅡ：TTTCCTAGGTCATGCCTTGGCTTTGACGTATCG

PCR reaction system (50 μ l): 5 × SFBuffer (with10mMMgSO ₄): 10 μ l, dNTPMix (10mMeach): 1 μ l, phaABEcoRI/phaABHind III: each 1 μ l or phaCnostartXhoI/phaCstopAvr II: each 1 μ l, PhantaSuperFidelityDNAPolymerase:0.5 μ l, pBHR68:0.3 μ l, DMSO:1.5 μ l, DDWupto50 μ l.

PCR reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 2min, 32 circulations; 72 DEG C extend 5min.

1.2 synthetic alkaline pectinase gene pgl-linker.

The pgl gene order of synthesis is with reference to B.subtilispelgene (GenBank:X74880) in NCBI, remove the termination codon subsequence that the 5 ' signal peptide sequence held and 3 ' is held, and add 12 the amino acid whose flexible linkers (GGGSGGGSGGGGS) of the preceding paragraph by 36 alkali yl codings at 3 ' end end, pgl gene and this linker of phaC gene are linked together.

1.3 the structure of expression plasmid pABC-PGL

After the phaAB gene fragment gel separation and purification that obtains of increasing, through EcoRI, Hind III enzyme double digestion, use EcoRI, Hind III double digestion expression vector pCDFDuet-1 simultaneously.PCR primer after double digestion and carrier reclaim through PCR primer purification kit (generay, GK2051).The PCR primer be recovered to and expression vector 22 DEG C is connected 3h, construction of expression vector pAB, then transformation of E. coli DH5 α competent cell, picking positive transformant, and bacterium colony PCR is done to positive transformant and enzyme cuts qualification.

The pgl-linker gene that synthesis obtains by continuation and previous step build the expression vector pAB obtained and enter double digestion with Bgl II, XhoI respectively.Pgl-linker gene fragment after double digestion and carrier reclaim through cutting glue, and the pgl-linker fragment be recovered to is connected 3h with expression vector pAB at 22 DEG C, construction of expression vector pAB-PGL.Then transformation of E. coli DH5 α competent cell, picking positive transformant, and enzyme is done to positive transformant cut qualification.

After the phaC gene fragment gel separation and purification finally pcr amplification obtained, through XhoI, Avr II double digestion.Use EcoRI, Hind III double digestion expression vector pAB-PGL simultaneously.PCR primer after double digestion is through reclaiming through PCR primer purification kit, and carrier reclaims with cutting glue.The PCR primer be recovered to and expression vector 22 DEG C is connected 3h, construction of expression vector pABC-PGL, then transformation of E. coli DH5 α competent cell, picking positive transformant, and bacterium colony PCR is done to positive transformant and enzyme cuts qualification.

The schema of construction expression plasmid as shown in Figure 2, wherein: T7:T7 promotor; PhaA (Re): the beta-keto thiolase gene deriving from R.eutropha bacterial strain; PhaB (Re): the Acetoacetyl-CoA reductase gene deriving from R.eutropha bacterial strain; PGL: alkaline pectinase gene; PhaC (Re): the pha synthesizing enzyme gene deriving from R.eutropha bacterial strain; SmR: streptomycin resistance gene.Alkaline pectinase gene pgl and pha synthesizing enzyme gene phaC is inserted into second T7 promotor downstream, under T7 promotor starts, give expression to PGL-phaC fusion rotein.

1.4 by expression vector pABC-PGL transformation of E. coli E.coliBL21 λ (DE3)

Get 100 μ l competent cells, add 10 μ l and connect product, mix gently, place 30min on ice.By centrifuge tube 42 DEG C of heat shock 90s.Fast centrifuge tube is put on ice, make it cool 2min.Often pipe adds 800 μ l not containing antibiotic SOC substratum, cultivates 1h in 37 DEG C of shaking table low speed.Low-speed centrifugal, discards about 500 μ l supernatants, gets residue 500 μ l bacterium liquid and directly coats on the LB solid culture ware containing 100 μ g/ml Streptomycin sulphates.Flat board is placed to liquid in 37 DEG C of forwards and is absorbed, and horizontalization plate cultivates 18-24h in 37 DEG C.Picking mono-clonal carries out digestion verification, and delivers to the raw work in Shanghai and carry out order-checking and identify.

2, the abduction delivering of Nano microsphere in engineering bacteria and separation and purification

The abduction delivering of 2.1 Nano microspheres in engineering bacteria

Containing expressive host bacterium E.coliBL21 λ (DE3) of pABC-PGL plasmid in LB substratum overnight incubation as seed liquor, seed liquor is inoculated into 100ml fermention medium (mineral medium by the inoculum size according to 2%, table 1) in, and add glucose (1g/L), Streptomycin (100mg/L) and IPTG (0.2g/L), 30 DEG C, 200rpm cultivates 48 hours.Wherein the glucose of 0.5g/L, Streptomycin and IPTG add when cultivating and starting, and the glucose of another 0.5g/L adds after 24 hours of incubation.

Table 1 mineral medium formula

Being solvent with distilled water when components I, II configuration, is solvent with 1mol/LHCl when component III, IV configures.Components I, II, III, IV moist heat sterilization 20min at 121 DEG C respectively, in case at high temperature react between each composition component.

In 1LMM substratum: compositionⅱ: 840mL; Components I: 100mL; Component III: 10mL; Component IV: 1mL; 20% glucose mother liquid: 25mL; 50mMIPTG:2mL; Amp/Sm:2/1mL; 20% glucose mother liquid (adding after cultivating 24h): 25mL.

The separating-purifying of 2.2 Nano microspheres

Collect 50mL fermented liquid, the centrifugal 10min of 4000r/min, abandons supernatant.Bacterium mud is resuspended in 15ml10mM phosphoric acid buffer after fully being washed by bacterium mud by 10mM phosphoric acid buffer.

Bacteria suspension is in 400W ice-bath ultrasonic 20min, and ultrasonic 5S stops 5S, abundant cracking somatic cells.

15mL cellular lysate liquid carries out glycerol density gradient centrifugation, is followed successively by from bottom to top in 40mL centrifuge tube: 88% glycerine 7.5mL, 44% glycerine 7.5mL, cellular lysate liquid 15mL.100000 × g ultracentrifugation 2.5h.

After centrifugal, nano particle is positioned at the white layer above 88% glycerin layer, and careful this white layer of drawing collects microballoon, is fully washed by the microballoon of collection, obtain microsphere powder finally by lyophilize with the 50mM phosphoric acid buffer of 10 times of volumes.

The SDS-PAGE detection and identification of 2.3PGL-phaC albumen

By the Nano microsphere 10mg that obtains of purifying, it is resuspended to add 1mLPBS, after Bradford method carries out protein quantification, gets after appropriate microspheres solution mixes with 5 × sds gel sample loading buffer, boils 10min, carry out 10%SDS-PAGE protein electrophoresis.

Polyacrylamide gel electrophoresis: install Bio-Rad electrophoresis apparatus, record 5% spacer gel and lower floor 10% separation gel, respectively need solidify about 1h.By the above-mentioned sample prepared application of sample in order.Electrophoresis starting voltage is 90V, after dye front reaches separation gel, adjusts voltage to 110V, when continuing bottom electrophoresis to Bromophenol Blue dye forward position arrival separation gel, stops electrophoresis.Take off gel and be placed in Xylene Brilliant Cyanine G dye liquor room temperature dyeing 1-3 hour, till putting into destainer decolouring, background transparent clear until gel-tape, observe electrophoresis result.

The enzyme activity determination of 2.4 alkaline pectin enzyme immobilization Nano microspheres

The alkaline pectase biological fixnig Nano microsphere that One-step production goes out through alkaline pectase enzyme activity determination is: 129U/g.

Measuring method is as follows: the microsphere powder getting 10mg, is fully dissolved in the PBS solution of 1mL50mM, dilution certain multiple.Enzyme reaction system is: enzyme diluent 20 μ L, containing the glycine-NaOH buffer (0.2mol.L of 0.2%PGA ^-1, 0.44mmol.L ^-1caCl ₂, pH9.4) and 2mL, the enzyme liquid of non-activity is blank.Reaction conditions is: 45 DEG C of water-bath 15min, uses 3mL phosphoric acid solution (0.03mol.L ^-1) termination reaction, 235nm place assaying reaction thing absorbance.

Enzyme live unit definition for: within 1 minute, cracking polygalacturonic acid produces enzyme amount corresponding to 1 μm of ol unsaturated polyester galacturonic acid.

Alkaline pectase of the present invention (E.C.4.2.2.2) immobilization Nano microsphere, described Nano microsphere is prepared by hydrophobic polymer material, hydrophobic polymer micro-sphere material is PHA, is polymerized by one or more in poly butyric ester, poly-Hydroxyoctanoic acid ester, poly-hydroxydecanoic acid ester, hydroxybutyric acid-hydroxypentanoic acid copolyesters, hydroxybutyric acid-hydroxycaproic acid copolyesters, hydroxybutyric acid-Hydroxyoctanoic acid copolyesters, hydroxybutyric acid-hydroxypentanoic acid-hydroxycaproic acid copolyesters.

This Nano microsphere on the surface load has alkaline pectase protein molecular, and alkaline pectase protein molecular is connected with the pha synthesizing enzyme protein molecular phaC of microsphere surface by covalent linkage.

The protein molecular phaC of this alkaline pectase protein molecular and microsphere surface is by the fusion rotein of track fusion, and this fusion rotein is PGL-PhaC; Also be provided with connection peptides between alkaline pectase molecule and phaC albumen, connection peptides is GGGSGGGSGGGS.

Described alkaline pectinase gene is selected from the alkaline pectinase gene pgl of Bacillus subtilis (GenBank:X74880); Described pha synthesizing enzyme gene phaC derives from Ralstoniaeutropha.

Claims (10)

1. recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL, is preserved in the common Bio-Centers of China Committee for Culture Collection of Microorganisms, and culture presevation number is CGMCCNO.10911.

2. recombination bacillus coli according to claim 1, is characterized in that, described recombination bacillus coli is a kind of recombinant bacterial strain can producing alkaline pectin enzyme immobilization Nano microsphere.

3. the construction process of recombination bacillus coli according to claim 1, is characterized in that, comprises the following steps:

(1) the fusion gene pgl-linker of PHA precursor synthase gene phaAB, alkaline pectinase gene pgl and connection peptides linker and pha synthesizing enzyme gene phaC is inserted in expression plasmid pCDFDuet-1 successively, build and obtain recombinant plasmid pABC-PGL;

(2) by recombinant plasmid pABC-PGL transformation of E. coli E.coliBL21 λ (DE3), recombinant escherichia coli strain E.coliBL21 λ (DE3) pABC-PGL is obtained.

4. the construction process of recombination bacillus coli according to claim 3, it is characterized in that, alkaline pectinase gene pgl is selected from Bacillus subtilis.

5. the construction process of recombination bacillus coli according to claim 3, it is characterized in that, pha synthesizing enzyme gene phaC derives from Ralstoniaeutropha.

6. the construction process of recombination bacillus coli according to claim 3, it is characterized in that, the concrete operations of step (1) construction recombination plasmid pABC-PGL comprise the steps:

1) pcr amplification is utilized to obtain PHA precursor synthase gene phaAB, then restriction enzyme cut vector plasmid pCDFDuet-1 and PHA precursor synthase gene phaAB is adopted, again by PHA precursor synthase gene phaAB insertion vector plasmid pCDFDuet-1, obtain vector plasmid pAB;

2) adopt restriction enzyme cut vector plasmid pAB and gene pgl-linker, then gene pgl-linker is inserted in plasmid pAB, obtain vector plasmid pAB-PGL;

3) utilize pcr amplification to obtain phaC gene, then adopt restriction enzyme cut vector plasmid pAB-PGL and gene phaC, by gene phaC insertion vector plasmid pAB-PGL, obtain recombinant plasmid pABC-PGL.

7. the construction process of recombination bacillus coli according to claim 3, it is characterized in that, the nucleotide sequence of the fusion gene pgl-linker of described alkaline pectinase gene pgl and connection peptides linker is as shown in SEQ.ID.NO.1; The nucleotide sequence of pha synthesizing enzyme gene phaC is as shown in SEQ.ID.NO.2.

8. the method for alkaline pectase Nano microsphere is produced based on recombination bacillus coli immobilization according to claim 1, it is characterized in that: after recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain is carried out abduction delivering cultivation in mineral medium, again through separating-purifying, obtain alkaline pectase Nano microsphere.

9. the method for alkaline pectase Nano microsphere is produced in immobilization according to claim 8, it is characterized in that: described recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain is carried out abduction delivering cultivation in mineral medium, concrete operations are:

First, using recombination bacillus coli E.coliBL21 λ (DE3) pABC-PGL bacterial strain in LB substratum incubated overnight as seed liquor, by the inoculum size of 2%, seed liquor access is equipped with in the 500mL triangular flask of 100mLMM substratum again, wherein MM substratum separately adds the IPTG of the glucose of 1g/L, Streptomycin and 0.2g/L of 100mg/L, 30 DEG C, cultivate 48 hours under the condition of 200rpm/min;

Wherein the glucose of 0.5g/L, Streptomycin and IPTG add when cultivating and starting, and the glucose of another 0.5g/L adds after 24 hours of incubation.

10. the method for alkaline pectase Nano microsphere is produced in immobilization according to claim 8, it is characterized in that: the concrete operations of described separating-purifying are:

Collect fermented liquid, centrifugal, abandon supernatant; With 10mM phosphoric acid buffer, bacterium mud is fully washed, then bacterium mud is resuspended in 10mM phosphoric acid buffer; Then, ultrasonication process 20 minutes; By method purifying microballoon from somatic cells lysate of glycerol density gradient centrifugation, and fully wash with the microballoon of 50mM phosphoric acid buffer to purifying, remove glycerine and remain; Alkaline pectin enzyme immobilization Nano microsphere pressed powder is obtained finally by lyophilize.